Slashdot Mirror
DNA-Radio, Tune In To Your Chromosomes
An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."
I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA
Just me
So now, YOUR dna isnt just covered be somebody else's patents, but now your DNA is someone else's copyrights.
Douglas Adams (also DNA) used this idea in one of the Dirk Gently books - turning arbitrary data into beautiful audio. Then again he may have nicked it from Brian Eno, who was also talking about something similar in the 70s.
I can't figure out why this project is so interesting. The audio sounds like weird computer-generated noise to me and the images look like colored noise with some weird patterns in them. Who cares? It looks like the data segment of a program when I dump it to video memory accidentally. Yeah there are patterns but what is the value in them? Not much.
This game will waste your life. Don't clicky!
Bring the 14.4 modem out of the closet and demodulate the audio sequence data.
Then, when you've got the entire code backed up locally, sue them for releasing
sensitive medical data over the internet without authorization.
Step 4: profit.
It is actually just some kid with a broken Speak & Spell.
It sounds like a numbers station, but at that it's still not very useful.
The problem with this and DNA-rainbow is that it doesn't transform the domain of the raw base pairs into a domain of human vision (or audition) in such a way that actual higher-order patterns occur. We take long strings of tabular numbers that have no pattern at all and transform it into a beautiful curve, and this gives us insight into what the numbers may mean, what they may do in the future, etc. But this stuff adds nothing to the noisy junk it's built on... imho
Don't blame me, I voted for Baltar.
It's the ultimate numbers station!
I have something in common with Stephen Hawking...
I did a dna to sound project as a graduate student that actually played notes for a given chromosome. In fact I created an entire virtual orchestra (multiple machines) that were able to sync up and play from the same piece of sheet music (DNA). I don't remember exactly how I encoded the notes (If I recall the user was able to (1) select how many alleles should be in a note (2) the program would then break a given strand up according to the value entered (3) the user would choose the frequency to apply to each generated collection of alleles (4) the strand would be played. It didn't sound too bad. Kind of random, but not too bad. Definitely better than just reading them outloud.
The idea was that while LOOKING at the string ACTGGGAACCTTA a person may not see (consciously) anything of interest... not even repeated sequences of characters if they were sufficiently far apart... However, humans are VERY good at noticing patterns in sounds. So are animals. I won't get in to exactly what we were trying to accomplish at the time other than pattern recognition of good and bad DNA (for one purpose or another), but I will say that these folks should be able to create "music" if they wanted.
[Now I'm going to have to dig through the archives to see if I can find my program]
My present is the activity I am currently engaged in with the purpose of turning the future into a better past.
Scientist implant DNA sequence downloaded by SETI. They didnt understand it, but it turns out to be BAD. Thats how the evil aliens propagate themselves.