DNA-Radio, Tune In To Your Chromosomes

An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."

Comments

CCCCCAGCAAGCCCA

[Praedon]

I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA

Re:CCCCCAGCAAGCCCA

[!coward]

I was actually a little disappointed when I heard the feed.. Hadn't expected it to be just a robotic reader spelling out the sequence.

Thought they might have just used the fact that three of the bases start with letters that are also musical notes in the english notation (A, C and G).. Choose a suitable 4th note for Thymine (maybe E, its last letter) and then run it through a midi sampler..

To spice it up, they could do some fun stuff with combinations, for example altering the tempo when you found repetitions of the same base, something for sharp/flat (just to mix it up a bit), etc..

Maybe not the point of this experiment (well, if you can call it that -- this isn't exactly science anyway), but as with the previous graphics experiment, it might even produce some interesting tune somewhere down the line.

As it is, though a nice code hack I'm sure, the result is a tad boring.

Nice.

[Creepy Crawler]

So now, YOUR dna isnt just covered be somebody else's patents, but now your DNA is someone else's copyrights.

Re:Nice.

[dwywit]

Hence - all your base are belong to us!

Douglas Adams

[GrahamCox]

Douglas Adams (also DNA) used this idea in one of the Dirk Gently books - turning arbitrary data into beautiful audio. Then again he may have nicked it from Brian Eno, who was also talking about something similar in the 70s.

Re:Douglas Adams

[v1]

I was hoping they'd be playing some sort of music created from the sequences. listening to some monotone voice recite letters of the alphabet ad-nausium isn't going to attract anyone

Re:Douglas Adams

[clang_jangle]

Agreed, it's very disappointing. I guess samzenpus calling it an "artistic project" in TFS set me up to expect more. Wonder if he actually lisened to it? Here's a direct link to the stream, for sam and whomever else wants to hear.

Re:Douglas Adams

[Amouth]

to be honest i was thinking the same thing.. after seeng some of the patterns in the image versions i was wondering if they where going to take either the individual pairs and match them with and instrament or have one modify the other or something - kinda like the network analyser that turns logs and box loads into clasical music..

if they did that and it was remotely nice to listen to.. i would have it book marked - but after 30seconds of that thing i will never touch it again except maybe to troll someone

This project is overrated.

[gravos]

I can't figure out why this project is so interesting. The audio sounds like weird computer-generated noise to me and the images look like colored noise with some weird patterns in them. Who cares? It looks like the data segment of a program when I dump it to video memory accidentally. Yeah there are patterns but what is the value in them? Not much.