Slashdot Mirror


User: Crazy+Diamond

Crazy+Diamond's activity in the archive.

Stories
0
Comments
84
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 84

  1. Re:subscription service on Nanotech: "Smart Fabrics" · · Score: 2, Funny

    After all you're just licensing the shirt! You don't own the shirt and must comply with the EULA or else the clothes will stop working! i.e. disintegrating into threads at the most inopportune times. I like this idea!

  2. Re:Er, no you can't. on X-server for PS2 · · Score: 1

    Here's some history:

    1982 - 80286. Supports virtual address space (Basic MMU). Addresses 16 Megs. 12.5 MHz, 2.7 MIPS.

    1984 - Macintosh w/68000. Address 16 Megs. 8 MHz, 0.7 MIPS.

    1985 - 80386DX. Has MMU. Addresses up to 4GB. At 20MHz, 6 MIPS.

    1987 - Mac II w/68020. 16MHz, 2.6 MIPS

    1988 - Mac IIx w/68030. Has MMU. Takes up to 128 MB. 16MHz 3.9 MIPS.

    1989 - 80486DX. Has MMU. Addresses up to 4GB. Math coprocessor included. 25MHz. 20 MIPS.

    1989 - Mac IIci w/68030. 25 MHz. 6.3 MIPS.

    Care to try justifying that 680x0 chips ran 2x faster than x86? Hell, the 680x0 didn't even have an MMU until 1988!

  3. Re:Er, no you can't. on X-server for PS2 · · Score: 1

    With the other abilities (graphics) that the PS2 has, it would be a waste to think of it as simply a general computational platform. Now tell me, I suppose the game developers had to write every instruction in assembly because they're no compiler on earth that could understand how to do vector operations. Am I correct? And all those scientific applications run on supercomputers (which vector processors) were also written in assembly, right?

  4. Re:Amazon - New Shopping Innovation? on Slashback: Sex, Freiheit, Differentiation · · Score: 1

    You're right. Perfect price differentiation doesn't make sense without a business being able to directly affect market prices for a good. I didn't mean to imply this situation has both price differentiation and perfect competition. Instead by "pure economics" I simply meant to put the statements following in terms of an entirely economical viewpoint of why a business would choose to price goods as it does.

  5. Re:Amazon - New Shopping Innovation? on Slashback: Sex, Freiheit, Differentiation · · Score: 1

    I've seen this misconception many times on /. so sorry for going off on you but I need to clarify the price differentiation thing. In pure economics which is what we're all arguing about with perfect price differentiation (and perfect competition, equal goods, etc.), McDonald's would know your price elasticity and charge you appropriately. The only time they would give you a price above your "walk-out" price is when they have more profit by not selling to you (MC > MP).

    Now Amazon has a idea of what people will pay... and people have an idea of what they will pay... so as long as Amazon's price is below what the people thing the DVD, CD or book is worth, then the people will buy from Amazon. It is very simple and consistent. If people value privacy, a DVD at a brick-and-morter store bought with small denomination unmarked bills is much more valuable than the same DVD bought using one-click purchase (of course with a credit card) on Amazon, Amazon will have to lower their price possibly so low that Amazon isn't even willing to sell it (again MC > MP). If Amazon is actually trying price differentiation they don't have individual price elasticity information on specific consumers... yet. However they are trying to figure out how much people think an item is worth. We as consumers like to pay less than we think the item is worth... Amazon simply wants to make up the difference.

  6. Re:Models on How Much Do Models Influence Our Thinking? · · Score: 2

    Electric current direction is a convention. It does not simplify anything about the true direction of current; it is basically just a reversal of signs. We know very well the direction electrons are flowing. It has simply become a *convention*. There are few places where the actual flow of positive/negative charge needs to be considered for understanding the electrical behavior (such as in semiconductor physics or electromagnetics).

    And I disagree that flawed models hinder breakthroughs... flawed models BY DEFINITION encourage breakthroughs. A model is only accepted as long as it fits all known observations. If it is flawed, an observation inconsistent with the model will force the flawed model to be rejected and replaced with better models. Yes an even more complex and still flawed model (i.e. Ptolomy's epicycles) can be created but there is every opportunity for someone (Kepler) to create a newer, better model.

  7. Definition of black hole "size"? on Baby Black Hole With Big Appetite · · Score: 1
    Now this is a little confusing...

    I thought the size/mass of a black hole (or any celestial body) can be determined by the observation of its affect on nearby mass.

    If this small black hole is attracting matter the same as a much larger black hole, where is this extra pull coming from? That might not be an easy question but it can be alternatively stated why is the black hole "small" if it has such a large gravitational pull? If it looks, feels, smells and tastes like a supermassive black hole, it must be a supermassive black hole... right?

  8. Re:Out Of Cheese Error! Redo From Start! on Water On The North Pole · · Score: 1

    If you are trying to correct someone, at least check your fact and proofread your comment! The poster was 100% correct in that the ice at the north pole is already taken into account in the sea level. Ever hear of displacement?

    Next if you read the article you would see that the expectation is that the northern hemisphere will warm faster than the southern hemisphere due to the larger land area in the north.

    You know the funny thing about ocean currents that people don't realize? If there were no ocean currents, most temperatures around the world would end up falling... very significantly. Also did you know that only in the past 8000 years have we seen relatively stable ocean currents? Before then, ocean currents were changing fairly quickly. In fact changes occured that significantly affected the climate in a matter of a couple decades. And these changes weren't the 1 degree celcius we are worrying about now. They were 5, 10 degrees celcius.

    A giant dynamic system, huh? I happen to believe that also but I don't believe it moves to stable points... I believe it moves in cycles or at least trends. You believe that natural "phenomina" have short term impacts lasting only days or weeks? Man... I would like to meet the humans that put together that ice age about 20 thousand years ago.

    I ask you this: How are we supposed to separate human acts on the environment from the known natural environmental changes that Earth has had in the past (and certainly will have in the future)? Since so much "scientific knowledge" about the environment is so clouded by fatalistic views such as your own (BTW do you support the EPA?), I do not believe we currently have the ability to make precise and accurate judgements about the future of Earth.

  9. Re:What about Flash ram memory on What Will Be The Next Generation Of RAM? · · Score: 3

    The difference between SRAM and DRAM is that SRAM stores bits in a circuit of two inverters in a loop (four transistors not including sense amp). DRAM bits are actually stored on capacitors which through leakage eventually will discharge. Because of the leakage, DRAM requires a refresh which means the value stored on the capacitor is rewritten every so often (measured in tens of milliseconds). This writing and rewriting of every single bit is why DRAM ends up being quite power hungry when compared with SRAM.

    Flash memory is really not like SRAM or DRAM. It actually reminds me more of ROM because bits are actually defined by a single transistor being on or off. The way that flash memory makes a transistor stay on or off is the cool part. Each transistor (one per bit) has two gates. One gate is used when you write to the bit, the other gate is not actually connected to anything. The second gate (called the floating gate) is given a voltage (charge) when you wrote the bit through some interesting electrical effects (remember it is not connected to anything, you have to get the charge on there somehow). After writing the bit, the charge from then on actually stays on the floating gate because it is insulated from everything. The charge ends up making the transistor be on or off. Flash memory does have limited number of write/erase cycles but it is usually measured in hundreds of thousands so I'm not worrying about my Rio failing anytime soon.

  10. Re:Prime Numbers on Physics Problems For The New Age · · Score: 1

    I think the poster was confused with the proof that there does not exist a largest prime. Like with the 2...13 example, 30031 is relatively prime to primes 2 through 13 but it obviously is composite.

  11. Re:Trace Width or Channel Length? on 0.01 Micron Process? · · Score: 5

    Numbers like 0.18um or 130nm are actually associated with.the minimum feature size. In actual chips, the metal widths are almost never drawn at the minimum feature size. The poly layer however can be drawn at the minimum features size and it is what defines the transistor channel length.

    Crosstalk between wires is not just a function of their decreasing spacing because the aspect ratio of wires is also increasing very significantly (anywhere between 50-100%) leading to a larger lateral area. Copper processes allow wires with a smaller aspect ratio but the same resistance per square leading to the decrease in coupling capacitance. Low k dielectrics also are used to decrease the interconnect capacitance.

    The problem that we are currently facing is that transistors are fast enough that the critical paths in a modern chip is almost entirely due to the delays of long global interconnects. There are many things we currently to do speed up these wires including shielding, buffer insertion, and simply more intelligent routing.

  12. Re: I'm slightly color blind on Neural Coloring In: How The Mind Sees Color · · Score: 1
    Maybe you can explain color constancy better than the article did. Is it the notion that a green dress is always green regardless of how much light it is currently reflecting? If given a dress that we agree is green because of the given reflectance function of visible light is it still considered a green dress if you put it into a sealed room without any light to reflect. (If a tree falls in a forest...)

    Or is color constancy an entirely psychological effect? So if this green dress is lighted by orange sodium street lights, are they saying that the brain identifies the dress as being green because it adapts it's color table to the ambient lighting or is it that the brain knows and understands that the dress is green but it only looks different because of the ambient lighting. If I look at a white paper under an orange light, the paper looks orange to me and from what I can tell, it is a much high mental process that must consciously realize that the paper is white even though it actually is reflecting orange light.

  13. Article misarticulates the point of the research on Neural Coloring In: How The Mind Sees Color · · Score: 2
    If we assume that eyes are responsive to specific wavelengths of light (which we know they are due to the pigments in the various types cones) brightness should have absolutely no affect on the color we see. That is if color is defined as the relative intensities of the wavelengths of light our eyes receives. Take the HSV (Hue/Saturation/Value) color scale for example. Simply put it separates the wavelength (hue) from the darkness (value) of the color. Saturation is almost like value and you can kind of think of saturation as brightness where value is more related to darkness. Hue can remain constant while value and saturation vary resulting in shades of the hue that are anywhere between black and white.

    Now the wavelength is very, very important to seeing color. As an example from a typical elementary school science class if you take a clear green sheet of plastic and you looked at green apple, the apple looks green as you expect. But with that same sheet of green plastic if you looked at a red apple, the apple will look black. The green sheet of plastic absorbs all wavelengths of light except green. Does your brain compensate? It can't help but see that red apple as black.

    What is the interesting part of this article is the fact that the brain while does not compensate for the gross abnormalities such as black apples, it does actually adapt to colors if the colors are in the visual field long enough. It is not an adaptation that is unique to vision though. Have you ever entered a room that smelled peculiar? After a short while you probably couldn't notice it anymore. The brain is adapating to filter out the constant information if there is no change in inputs. The brain apparently requires contrasts for optimal perceptions.

    Take the eyes for example and the Gestalt principles. Our best perception occurs when there is a contrast between stimulations. Microsaccades (small involuntary eye movements) seem to be involved in the contrast perception so that we can resolve contrast easier. If we are stationary and the environment is stationary, without our eyes involuntarily moving we would have a very difficult time resolving anything.

    BTW all this should have been covered in Freshman Psych 101.

  14. Re:Call it a hypothesis, not a theory on Slashback: Retroaction, Breakeven, Kansas · · Score: 1

    Definitely agree evolution is not a known fact but I disagree with what your distinction between a hypothesis and a theory. A theory does not have to imply any "experiment" but it requires facts. These facts are by definition independent of the analysis performed by the individual scientist. Unfortunately facts used in analysis are ultimately observations.

    Now a set of facts such as the analysis of C-14 isotopes is reproducible given access to the same skeletons. Many valid theories for the reason for the C-14 dating could be stated as long as they are consitent with the universe of facts relating to the theory. A theory simply has to be an analysis that has no contradictions with known facts and is also supported by facts.

    A hypothesis can be stated as merely an educated assumption of a particular subject. A hypothesis implies the ability to find facts that can support or reject the hypothesis. Only when facts are found to support a hypothesis can it be restated as a theory.

    I was not aware of any scientific laws... could you name a few? In other words, I don't know of any part of science that cannot be rejected if contradicting evidence is found (thus leading to a superceding theory).

  15. Re:Physics Faux Pas, or, Incredibly Narrow Band on Peeking At The Future: "Perfect Mirror" Cables · · Score: 1

    If you compare the frequencies of IR versus radio frequencies, you're talking the difference between 400GHz v.s. 1MHz (or much lower). Quite few orders of magnitude. If you split the spectrum at visible light, which is not unreasonable, yes, they are on the same side. But if you look at the EM radiation that we use for communication, they are almost as far apart as we can get (have gotten).

  16. Re:Description Fails to Mention... on Tethers Will Be Tested To Boost, Deorbit Payloads · · Score: 1

    The power can be provided only if the space station resultantly loses altitude. The normal procedure for maintaining the orbit altitude requires the space station to actually generate power and use it to drive a current on the tether.

  17. Re:Google? on MPAA Sues Scour: Will Google Be Next? · · Score: 2

    Years ago that little program you are talking about never transfered files through the Scour's servers at all. When Scour was used, SMB sharing was popular but most people didn't know how to get to SMB sites with Win95/98 that were outside of the local browsing network. You can always get the file directly from the providers computer though with NT or smbclient. The scour program just makes that easier by dealing with the SMB stuff for you, along with whatever other types of protocol the files could be downloaded from (HTTP and FTP).

  18. Re:digital vs. analog on On the Time Preference for Information... · · Score: 1

    The difference you hear between a record and a CD is how the analog media applies it's own filter to the original waveform of the recorded music. Certainly the CD inherently applies it's own through quantization, etc. So both are flawed but as long as that is clear, enjoy whichever sounds better.

    BTW I'm not a technophile. I'm an engineer.

  19. I like eight-tracks on On the Time Preference for Information... · · Score: 1

    1. In general I think it is difficult for a common media format used by the general public to become obsolete and un-supported (Betamax doesn't count due to the video cassette wars). Something as common as audio cassettes for example were superceded (by CDs or DATs) many, many years ago but remain incredibly common. As for art being inherently analog, that certainly leads to philosophical question of whether art exists on it's own or does it exist through the perception of one. If the latter, have I introduced you to my friend Nyquist?

    2. Vinyl to cassette was a very major step from physical recording to magnetic recording. This step led to one of the most dramatic changes in information storage. While audio cassettes are analog, their computer counterparts were digital which introduced magnetic recordings as a very versatile media especially due to the capability of being rewritable in both the analog and digital forms. CD's are just another form of digital recording. So I guess we agree, the switch from analog to digital was the point when everything changed (for the better!).

    3. Any ideas where I can get a good 8 track player? I still have a some tapes that I used to listen to in my first car.

  20. Hard-working dot-commers are 99% FRAUDS. on I Want to Blow Up Silicon Valley · · Score: 1

    You made this place breeding ground for fraudulent fly-by-night companies (A.K.A. the Dot-Coms). I lived here when personal computers were unheard of. Before Jobs and Wozniak started Apple. You "dot-commers" have nothing that the engineers of the past had. I like the engineers of the past became successful by producing things no one had imagined. You dot-commers jump on band-wagons at every possible opportunity, always the followers. Never the leader.

  21. Re:It's not done yet.... 21.1% as of July 7, 2000 on Download The Human Genome · · Score: 1
    I hate to point out when someone contradicts themselves but I just have to do it this time. You seemed to miss the whole point of my post.
    There is no such thing as a "phisical gene", the genes only describe how to sintesize a given peptid, and usually changing the gene affects many things. You can change a gene and change skin color and give the subject some tendency to have short fingers, you can change another and make him process less efficiently fat acids, and you can change BOTH and have him grow a new nose in the armpit, and if you change a third one, that one would inhibit the former changes. Not to mention that many genes overlap between them, so you can't change one without changing the other.
    People are different BECAUSE THEIR GENES ARE DIFFERENT. The simple fact that there are in fact genes which determine our physical features (it doesn't matter if they affect other things too) means that a specific sequence of DNA describes a unique individual with their unique physical characteristics.

    The final results of the project which I was talking about (if you actually understood my post) was that if you have a sequence of DNA pairs and put those into a chromosome and put it into an egg cell, you get out a unique individual. For example, here's the beginning of the first sequence on chromosome 21 according to National Institute of Health.

    >gi|8134251|ref|NT_001035|Hs21_443| Homo sapiens 21q sequence /len=219256 GATCTTAGCAGAGTCCTGAAGATGAAGTCCTGGATGAGAGGAAAGCAAGG AAATGGCATC GTGGAAAATATCCTGAAGGATGTTTCGTGGGGGTTGTCCTGGGCAGCACC ATGCTACTGG GAGTGCCACTCACCTGGACAGGTCACCTGGCAGGTGGGCAGCTCTGCACA CCACATACCA CACACACCACATCCCATCCCATCCCATCCCACCCTCATCCCATCCCACCA CTTTTGCTGT
    Is that gene the same as my gene? Genes may be different between people right? You just stated it in your post:
    The map doesn't describe a particular gene set, but rather it describes the locus(positions) of the different genes(there's a difference between the position, which is invariable on the same species, and the genes that occupy it, which can be many on any given species).
    So that big old file I just downloaded with all the base pairs HAS UNIQUE GENES! It may be different than my genes which means... that that file describes someone other than me. Yes.. in fact it describes a single unique individual (hmm, am I repeating myself from my first post... I THINK I AM!)
  22. Re:Now what the .. on Secretive Company Scanning the Net · · Score: 1

    Here's the man page from OpenBSD to show you're both right (sort of)

    ...blah, blah, blah...

    -P proto
    Change the protocol being used from UDP to a numeric protocol or
    a name as specified in /etc/protocols. This will not work reli-
    ably for most protocols. If set to 1 (ICMP), then ICMP Echo Re-
    quest messages will be used (same as ping(8)).

    ...blah, blah, blah...

    This program attempts to trace the route an IP packet would follow to
    some internet host by launching UDP probe packets with a small ttl (time
    to live) then listening for an ICMP "time exceeded" reply from a gateway.
    We start out probes with a ttl of one and increase by one until we get an
    ICMP "port unreachable" (which means we got to "host") or hit a max
    (which defaults to 30 hops & can be changed with the -m flag). Three
    probes (changed with -q flag) are sent at each ttl setting and a line is
    printed showing the ttl, address of the gateway and round trip time of
    each probe. If the probe answers come from different gateways, the ad-
    dress of each responding system will be printed. If there is no response
    within a 5 sec. timeout interval (changed with the -w flag), a "*" is
    printed for that probe.

    Solaris man page says it only uses UDP but as the OpenBSD man page says, tracerouting really can use whatever protocol tickles your fancy.

  23. Re:It's not done yet.... 21.1% as of July 7, 2000 on Download The Human Genome · · Score: 1

    The genes that determine our our fundamental human characteristics still vary from person to person. Genes regulating fundamentals of our biochemistry are probably very, very similar if not identical BUT genes that determine our physical characteristics obviously are different from person to person. So say we find the exact gene related to eye color, it is probably not going to be identical from person to person. So the map that is being produced by these projects at this stage only describes the physical characteristics of a single individual. Do you see what I mean? If you take the all the base pairs and recreate all the chromosomes and put them into an egg cell, you get a very specific type of person because that sequence that has been generated is unique. Even if the DNA samples for different chromosomes are from separate source, the final result of the project still "describes" an individual with very specific characteristics (i.e. eye color).

  24. Re:How will you tell a human, let alone a woman? on Artificial Chromosome Inheritance · · Score: 2

    This actually is adding a additional chromosome. Basically they made a copy of a normal chromosome, gutted it, added in multiple copies of their own specified gene and inserted it into the mouse.

    Down's syndrome is a very specific disorder caused by anomalies with the 21st chromosome pair. It is not a general result of having more than the normal number of chromosomes (for example having XXY sex chromosomes).

  25. Re:Silly! on Tripwire Going GPL · · Score: 1

    Here's how it works. They have a number of versions of Tripwire, one for each OS. These versions are essentially separate products. They are releasing the Linux version with GPL so if you port it to Solaris, you don't have the Solaris version of Tripwire, you have the Linux version of Tripwire ported to Solaris. The GPL is still for the Linux version, just you mucked around with it so that it can also work on other OSes.