Slashdot Mirror


Download The Human Genome

CMU_Nort writes: "The San Francisco Gate has a story about the completion of the human genome project. Apparently the University of California at Santa Cruz has put the Genome online for downloading here. I don't know about you, but I think this sort of sharing is very cool. We finally have the source for human beings. Now if only they'd GPL it."

159 comments

  1. GPL EVERYTHING! by Datafage · · Score: 1
    I hate seeing this kind of knee-jerk reaction in the front page blurbs. These people did not invent the human genome, and thus have no more right to put it under the GPL, or any other license, than Monsanto has to license pre-existing crop strains, yet Monsanto is quite frequently badmouthed for just htis behavior. Any comments?

    -----------------------

    --

    Nicotine free Amish .sig.

  2. Re:It's not done yet.... 21.1% as of July 7, 2000 by Crazy+Diamond · · Score: 1
    I hate to point out when someone contradicts themselves but I just have to do it this time. You seemed to miss the whole point of my post.
    There is no such thing as a "phisical gene", the genes only describe how to sintesize a given peptid, and usually changing the gene affects many things. You can change a gene and change skin color and give the subject some tendency to have short fingers, you can change another and make him process less efficiently fat acids, and you can change BOTH and have him grow a new nose in the armpit, and if you change a third one, that one would inhibit the former changes. Not to mention that many genes overlap between them, so you can't change one without changing the other.
    People are different BECAUSE THEIR GENES ARE DIFFERENT. The simple fact that there are in fact genes which determine our physical features (it doesn't matter if they affect other things too) means that a specific sequence of DNA describes a unique individual with their unique physical characteristics.

    The final results of the project which I was talking about (if you actually understood my post) was that if you have a sequence of DNA pairs and put those into a chromosome and put it into an egg cell, you get out a unique individual. For example, here's the beginning of the first sequence on chromosome 21 according to National Institute of Health.

    >gi|8134251|ref|NT_001035|Hs21_443| Homo sapiens 21q sequence /len=219256 GATCTTAGCAGAGTCCTGAAGATGAAGTCCTGGATGAGAGGAAAGCAAGG AAATGGCATC GTGGAAAATATCCTGAAGGATGTTTCGTGGGGGTTGTCCTGGGCAGCACC ATGCTACTGG GAGTGCCACTCACCTGGACAGGTCACCTGGCAGGTGGGCAGCTCTGCACA CCACATACCA CACACACCACATCCCATCCCATCCCATCCCACCCTCATCCCATCCCACCA CTTTTGCTGT
    Is that gene the same as my gene? Genes may be different between people right? You just stated it in your post:
    The map doesn't describe a particular gene set, but rather it describes the locus(positions) of the different genes(there's a difference between the position, which is invariable on the same species, and the genes that occupy it, which can be many on any given species).
    So that big old file I just downloaded with all the base pairs HAS UNIQUE GENES! It may be different than my genes which means... that that file describes someone other than me. Yes.. in fact it describes a single unique individual (hmm, am I repeating myself from my first post... I THINK I AM!)
  3. Re:Oh-oh... GPL restrictions... by / · · Score: 2

    Well, if nothing else, it should drastically increase the amount of paperwork filled out at spermbanks....

    --
    "If one is really a superior person, the fact is likely to leak out without too much assistance" -- John Andrew Holmes
  4. monkeys by epukinsk · · Score: 1

    We've got the source code... all we need is a compiler and an O'Reilly book...

    -Erik

  5. Re:Whose copy is it? by bugg · · Score: 2
    Take any two people, regardless of race. Their DNA is 99% similar. For every functional (no errors in chromosmal replication, etc) human our DNA is 99% identical. And of that 1% that differs, only 10% of that (.1% of our entire DNA) are introns, the rest being extrons that are of no known value as the sequences they code for will never be translated to protiens as they are removed in the creation of mRNA.

    Frankly, the point is it doesn't matter the race of the people. Only .1% of our DNA codes for _all_ of the attributes that make us different- eye color, skin color, hair color, etc. And we haven't even yet mapped all of these loci.

    --
    -bugg
  6. I hereby dub thee retarded! by Valar · · Score: 1

    Some ppl out there are just plain stupid. First off, we don't need to GPL it, it's not owned(except, perhaps, by god). Secondly, we have just mapped what amino acids they genes create, and in some cases, what the results are. Thirdly, it's in binary notation!! There are two possible combinations of neucleotides in DNA. To create one particular shade of eye color for example, it would take the setting of millions of genetic 'bits'. And the genome doesn't have a key, so to say. Basically, we are in the cockpit, know where the controls are, but none of them are labeled. So, to do anything useful with this, in your basement laboratories or whatever, it would take several million years. Have fun.

  7. Copyright, yes. Patent, no. by donutello · · Score: 1

    Copyright, yes. Patent, no.

    I'd say if you did the grunt work and figured out the sequence you should be able to charge people for using this information. But if someone else goes ahead and re-does all the work, then you cannot deny them the right to use the results.

    Of course, you could get a patent on some specific methods you developed to perform the sequencing and then other people would have to figure out other methods or pay you royalties for your patents.

    --
    Mmmm.. Donuts
    1. Re:Copyright, yes. Patent, no. by pudge · · Score: 1

      You cannot copyright what you did not create. You can possibly copyright the expression or form of the work, but not the data itself. You cannot patent what there is prior art for. The genome is mine, the data is mine, and you can't stop me from using it in any way I see fit.

  8. Ownership by ibjhb · · Score: 1

    Who actually owns the gene and information? Could the owner of that actual gene claim a sort of copywrite? Is is possible to copywrite part of your body, albeit very small?

    1. Re:Ownership by The+Grammar+Jew · · Score: 1

      The Grammar Jew wants you to know that the proper word is copyright, meaning "right to copy". The word "copywrite" does not appear in major dictionaries, but one may argue that it could mean "[to perform] a copywriter's job" or something similar. A copywriter is a writer of advertising or publicity copy.

    2. Re:Ownership by TheKodiak · · Score: 1

      That would be prohibitively difficult, even if the owners had not signed agreements prohibiting them from doing that. None of the owners of the sequenced DNA know that it was their DNA that was sequenced - only that they submitted their DNA into the pool of candidates.

      --
      -=Best Viewed Using [INLINE]=-
  9. Re:About 1500 MBs by HerrNewton · · Score: 1

    God is horrid about commenting code, apparently ;-)

    (So spaketh the agnostic.)

    ----

    --

    ----
    Am I the only one who thinks Microsoft is a misnomer? Perhaps Macrosoft would be a better fit?
  10. The sequenced the Genome, not specified it by donutello · · Score: 2

    IANAMB (Molecular Biologist) but I believe what they did here was figure out what the individual pieces of the human genome were.

    (For lack of the ability to come up with a better analogy) It's like if all cities had the same map, then they discovered the road map of cities. It's what is at each address in the city that makes the cities unique and gives them character. They are just telling you where the houses go, what makes people different is what the houses actually are.

    --
    Mmmm.. Donuts
  11. Nothing new by roswell · · Score: 1

    the 24 chromosomes has been online'd by project gutenberg for a while now

    --
    -- Kirk S
  12. Re:GPL'd Genes license question by The+Grammar+Jew · · Score: 1
    You better make sure your wife has a chance to read the license, because she will...er...distribute your code. (Jews may choose to put the license directly to the Ketuba).

    OTOH your kids are safe, because they are not likely to distribute the "cyb" parts of them, only "org" parts. It's ok to combine non-GPLed stuff with GPL-ed stuff as long as you don't distribute the combination.

    But wait...When you...erm...ugh...entertained yourself with your...oh...palm, didn't you actually release your genome to public domain?

  13. Re:Argh, everything is NOT open source by donutello · · Score: 1

    Dude, that was hilarious. Thanks for the good laugh.

    --
    Mmmm.. Donuts
  14. Re:About 1500 MBs by SEGV · · Score: 1

    My understanding is that it's only half that. There are two versions, one with larger files, and one with smaller files in more directories.

    --
    Marc A. Lepage (aka SEGV)

    --

    --
    Marc A. Lepage
    Software Developer
  15. Re:what about God? by The+Grammar+Jew · · Score: 1

    If He had, it expired some 5740 years ago.

  16. human genome 99% only by leenelson · · Score: 1

    The human genome is only 99% complete. The last 1% will apparently take years. This is due to the method used to discover the genome. In addition, only the composition is known, the function of the genes is far from known for many (I think most) genes.

    Still, the sharing is cool.

    Lee.

    PS I posted this before but with the cookies turned off I came off as a coward... Oh well, that's usually true..

    1. Re:human genome 99% only by jfern · · Score: 1

      Funny, we also share 99% of our genes with pygmy chimps. Maybe ut's not really the _human_ genome.

    2. Re:human genome 99% only by jfern · · Score: 1

      85%? Maybe that's a rat.

  17. Compression by the_demiurge · · Score: 2

    Of course, people actually downloading the whole human genome probable wouldn't worry about this, but couldn't they use a better compression format than .zip? I bet using bzip2 or rar would shave a couple of hundred MBs off of that 753MB file. Also, the differences in compression techniques would be interesting to see on a large group of files mainly consisting of G, A, C, and T.

    -- demiurge
    You find a file that appears important and obliterate it from memory!!!
    Score one for the downtrodden hacker!

    1. Re:Compression by tatarsky · · Score: 1

      We are going to take your advice and experiment with the best compression methods. We figured the zip format was available to the largest pool of users, but given we have the disk space, we should try to reduce the download size do to the massive interest. Thanks.

    2. Re:Compression by petebu · · Score: 1

      Its also the ASCII file format that worries me. If they only need to represent four code words (G, A, C, T) they could have used 2 bits (2^2 = 4) for each one rather than the ASCII 8 bits. This would take up only 1/4 of the space. Of course, this method doesn't take into account error correction and so on but then again, ASCII doesn't provide that either.

    3. Re:Compression by Jonathan · · Score: 5

      Actually, DNA compression is a topic of interest, not only from the standpoint of saving disk space, but also for analyzing the sequence -- areas that compress differently may have different functional roles. You can read a paper on the subject by some people I know here

    4. Re:Compression by FigWig · · Score: 1

      Don't forget the \n's!

      --
      Scuttlemonkey is a troll
  18. New flag by fishexe · · Score: 1

    They would have to add a new flag and invokacion command like g++ is for using gcc for c++. I guess that would be called using the DNA libraries to link it.

    That same invocation (hey, did I spell it right this time?) could be used to compile and link genomes for other organisms like the fruit fly, or anything else we may have mapped, from sources.

    Now we just need to right the libraries. Shhh, don't tell anyone that's the hard part.

    Ever get the impression that your life would make a good sitcom?
    Ever follow this to its logical conclusion: that your life is a sitcom?

    --
    "I don't care about the Constitution!" --Bill O'Reilly, November 17, 2009
    1. Re:New flag by fishexe · · Score: 1

      So when will gcc be able to compile the source into a working AI?

      The real question is, when will we invent a brand of coffee which keeps me from making crappy spelling errors in my slashdot posts late at night?
      They would have to add a new flag and invokacion
      Now we just need to right the libraries.

      That's not counting the ones I caught before I hit submit.

      Ever get the impression that your life would make a good sitcom?
      Ever follow this to its logical conclusion: that your life is a sitcom?

      --
      "I don't care about the Constitution!" --Bill O'Reilly, November 17, 2009
  19. licencing by norculf · · Score: 2

    If anyone tried to licence this, I'd hit 'em with a prior-art based lawsuit, based around the fact that I was using the code long before they licenced it. Of course, people born after it was licenced wouldn't have this option. Of course, I could always just make them pay me royalties...

  20. Gotta watch those errors... by Uruk · · Score: 3

    Keep in mind that there is only a 5% genetic variance between monkeys and humans.

    Which means, that unless they checked and double checked this data, if you actually try to compile it into a human, you may end up with a 5-nosed purple haired, blind and deaf armadillo-platypus mix with ESP and a penchant for buggery. :)

    They really do need to GPL this, if for no other reason than for the NO WARRANTY clause.

    --
    -- Truth goes out the door when rumor comes innuendo. -- Groucho Marx
  21. mirror of 15jun2000 genome release in australia by jason+andrade · · Score: 1

    for people in australia wanting to have a look
    at this - i've mirrored a copy for download at

    ftp://mirror.aarnet.edu.au/pub/genome/15jun2000/
    http://mirror.aarnet.edu.au/pub/genome/15jun2000 /

    -jason

  22. FASTA /fa viewer by Sgt.+Bilko · · Score: 1

    Does anyone know a program that can turn this information into something viewable in linux or, windows even? I wanna see the purdy helix :-P

  23. Re:We don't have the "source code" for humans. by Coleco · · Score: 2

    Actually we can 'compile' the code because we know all the enymnes (polymerases) etc that turn the dna into rna then into proteins, and we know how they work.

    So the higher level building block would be the resultant amino acid sequence... Then the functional protein..

    'Random' is not a good word to use when talking about genetic material. What influences that decide what information carries on through the generations isn't a result of randomness.. Although base-pair mutations do happen in a generally 'random' way. If a protein is rendered non-functional due to a mutation the other copy of the gene is still functional. Hence non-functional or seeming detrimental genes are carried through time until either they turn out to be an advantage at some point, or a whole new trait emerges. If you study genetics for some time you begin to realize that 'mistakes' or abberations are the pool by which functional innovations occur. Judging genetic fitness on a basically arbitrary basis i.e. anyone saying one trait is the prefered or 'correct' trait are demonstating their misunderstanding how evolution works. There are numerous examples of this. There's the classic sickle-cell enemia example, and those people that carry a defect in a specific protien so the hiv is unable to attach to and infect their cells.. hence, they are immune.

    Due to the billions of individuals.. Aside from other factors, randomness occurs within the context of the individual but not within the context of the popluation. Populations and species evolve or remain at a genetic equilibium for very systematic reasons.

  24. Source for Human Beings by zeck · · Score: 2

    We finally have the source for human beings. Now if only they'd GPL it.

    Yeah, too bad they didn't comment it.

    1. Re:Source for Human Beings by fatdave · · Score: 1
      It is commented. It is just that we can't read the comments. What do you think all this 'junk' DNA does between the genes?

      ..d

      --
      --- Four bases should be enough for any genetic code
    2. Re:Source for Human Beings by The+Grammar+Jew · · Score: 1

      Well, could it be that the junk DNA is what the name suggests --- junk?

    3. Re:Source for Human Beings by razorwire · · Score: 1
      /* I don't know what this does, but human.dna won't compile without it --God */

      GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT...

  25. Make your own Cindy Crawford by frippertronic · · Score: 1

    Where can I get the diffs and patches to assemble my own Cindy Crawford??? If this isn't proof that open source is the best way to date/recreate!

  26. Re:Genome online? by PsiPsiStar · · Score: 1

    If ya boot up that woman, by golly you're gonna marry her.

    --

    ___
    It's the end of my comment as I know it and I feel fine.
  27. No, it's not the source code. It's the binary. by yerricde · · Score: 2

    The DNA of a human being is the binary. Source code is normally commented, and that's what they're working out. They've sequenced the genome (== dumped the binary); now they're mapping it (== running a debugger, disassembling, and commenting the source).

    --
    Will I retire or break 10K?
  28. Re:Genetic stuff as Intellectual Property by PsiPsiStar · · Score: 1

    There was one poet who patented herself ( I think It was a patent. Could have been a copyright.)

    She claimed that she was a unique individual who had spent considerable time and effort 'inventing' herself.

    --

    ___
    It's the end of my comment as I know it and I feel fine.
  29. Re:Oh-oh... GPL restrictions... by The+Grammar+Jew · · Score: 1

    Not strictly modifies, but creates a derived work, which is the same as modification as far as GPL is concerned.

  30. Source Code for Humans by Samarian+Hillbilly · · Score: 1

    Hey, this ain't the source, it's the assembly!!! Anybody got the source out there? Preferably with comments?

    1. Re:Source Code for Humans by koekepeer · · Score: 1

      >Preferably with comments?

      Actually, I very briefly spoke to a guy, who presented his work on annotating the genome in the EnsEMBL project after his presentation. The software they have written to control the tremendous logistics involved in "commenting" the genome is released under a BSD-style license (disclaimer: as I recall).

      When I asked him why it wasn't released under the (L)GPL license, he said that the lawyers had declared the (L)GPL a "legal nightmare".

      This put aside (I don't remember the exact arguments), I think the fact that these people release their software using the open-source principle should be acnowledged, therefore I thought I'd just mention it here on /.
      meneer de koepeer

  31. Napster defense!!!! by frippertronic · · Score: 1

    As we now have Lars from Metallica's DNA (as well as everyone else) we now have prior art and thus the metallica copyright is invalid!!!!!!1

  32. Genome as binary? by Vidboy · · Score: 1

    This is a really weird idea, but what if the genome was translated into binary and compiled? There are two base pairs, (AT and GC, for those who didn't pay attention in biology), and binary has 0s and 1s.

    If the AT pairs were translated into 1s and the GCs into 0s, and vice versa, we might get some really interesting stuff, or a blue screen (hmm...mayble linux would be better for compiling).

    Of course, this same philosophy can be translated into organic computing in the same manner, and genetic code can store data.

    If somebody wins a nobel prize for this, remember it was my idea!

    --
    Your village called: Their idiot is missing.
  33. Oh-oh... GPL restrictions... by emac · · Score: 2

    Would that mean if I decide to have a kid (thereby utlizing and modifying my genes, and agreeing to the GPL) but then later give the kid up for adoption (redistributing the binary) I'd have to include a full copy of the source code? (Fully sequenced genome for the kid)

    That could get expensive! :)

    --
    Best new white rapper since Pimp Daddy Welfare... Pimp-T!
    1. Re:Oh-oh... GPL restrictions... by The+Grammar+Jew · · Score: 1

      GPL defines "the source code" as "the preferred form for making modifications". I don't know about you guys, but I prefer to modify my genome...er...differently.

      No, certainly The Sequence (how's that for a movie title?) is not "the source code" for humans.
      </just a thought>

    2. Re:Oh-oh... GPL restrictions... by razorwire · · Score: 1
      I don't know about you guys, but I prefer to modify my genome...er...differently.

      I prefer the traditional methods: being bitten by radioactive spiders, bombarded with gamma radiation, etc.

      Of course there are the occasional undesired side effects, like sudden transformations, excessive body hair, spontaneous posing, and terminal angst. But that's the price you pay for being on the bleeding edge of evolution!

    3. Re:Oh-oh... GPL restrictions... by The+Grammar+Jew · · Score: 1

      Um...I meant something else, like linking against somebody else's code...oh, nevermind.

    4. Re:Oh-oh... GPL restrictions... by Squeeze+Truck · · Score: 2

      but I prefer to modify my genome...er...differently.

      Sunbathing?

      --

      "Reactionaries must be deprived of the right to voice their opinions; only the people have that right." - Mao

    5. Re:Oh-oh... GPL restrictions... by Squeeze+Truck · · Score: 2

      And that modifies your genome?

      Holy Shit! No wonder my grades have been dropping! I need to start dating smarter girls!

      ...and girls with smaller breasts.

      --

      "Reactionaries must be deprived of the right to voice their opinions; only the people have that right." - Mao

  34. More GPL Programmers! CODE! by sness · · Score: 1
    This next small step is very exciting, and we *need* all you Linux hackers out there to get involved and write more code to do cool things for this project. There are not nearly enough young programmers working on this project, get out there, learn a little about DNA and start HACKING! We just had a young Linux hacker work for us at the BC Genome Sequence Centre, and he took a program (fpc) that used to take 1.5 WEEKS to run on a hot Sun box, and it now runs in about 17 hours on our distributed Linux cluster (30 processors)!!! FPC has been around for years, and this speedup has *revolutionized* map building. There's LOTS more opportunties, so get out there and get CODING

    send resumes! :) (sness@sness.net)

  35. Hey thats mine by slashdoter · · Score: 1

    look that genome it's mine, look i already have a copy on hand. Now that it is mine i would like a fee paid to me every time you use it.

    --
    Does anyone actually have a Java program designed to control air traffic, or for the operation of a nuclear facility?
  36. Re:Compiling the Source by nan0ok · · Score: 1
    Heh.. but that's an important question none the less.

    I would like to ask /. the following:

    What research or theory suggests that intelligence is encoded in DNA?

    Ok ok ok totally out of context (maybe) but as far as I understand this is assumed, just because there just isn't anything else to account for.

    It seems like scientists are trying to decode *everything* from DNA, without thinking of the consequences:

    Let's say that you and me are 99.999% genetically indentical (it's maybe even more than that). Could *really* that least digit make us so totally different ??

    Does not the fact that humans are so totally influenced by their environment point to that DNA really is not that much acountable for the more "deep" things like thoughts, consciousness and the like.

    --

    return -ENOSIG;

  37. It's not done yet.... 21.1% as of July 7, 2000 by ka9dgx · · Score: 1

    Disclaimer: I don't know genetics, and never took biology
    It appears to be a matter of taking DNA strands, breaking them up into smaller pieces, getting the individual genomes and then mapping everything back into a picture of the original. I didn't realize it until reading on the site that it's very possible to have read the codes backwards, which makes for an interesting twist on things(No pun intended).
    The Human Genome Sequencing Progress page shows that they have 21.1% complete data. I assume this means they are relatively certain everything fit right. (Imagine a puzzle with many pieces that fit in more than one place)
    I don't know how long until they get it all, but it seems to be paying off already. Of course, once done, they will have a map for one person, not everyone. (As I understand it)
    --Mike--

    1. Re:It's not done yet.... 21.1% as of July 7, 2000 by Coleco · · Score: 2

      DNA that is transcribed into RNA and hence into proteins is read off of only one strand. There are recognition sequences to determine the beginning and end points of transcription. Also DNA has a 'direction' 5'->3' so you can tell which direction is which. I'm sure whatever ind of software the transcription guys use recoginzes this.

      As for second point our DNA is for the most part almost identical. We need to have 99.9% of the same parts in order to run properly, i.e. everyone's gene sequence for hemoglobin is the same. So there is almost no variation in most of the genes in which mutations would be lethal or at least very bad. The genes that do allow variation.. i.e. eye color, are of a very small percentage and variation is allowed within those genes..

    2. Re:It's not done yet.... 21.1% as of July 7, 2000 by IAmSancho · · Score: 2
      Of course, once done, they will have a map for one person, not everyone.

      This is not correct. The privately funded Celera used DNA from several individual sources. Every normal human has the same set of genes (genes are fragments of DNA that are translated into functional proteins). Variations in this are due to mutation and can cause inherited or spontaneous disorders such as cystic fibrosis or marfans. Where we are different is in what's between the genes (composed of random junk and tandem repeats). When forensic scientists use DNA evidence to connect a suspect to a crime, they are not actually comparing the DNA base pair-for-base pair (that is to say, they're not looking at the A's, the T's, the C's, and the G's). Rather, they compare the lengths of fragmented DNA from two sources fragmented by the same enzyme(s). I digress. Basically, since the genes, though they make up a relatively small portion of the whole length of a strand of DNA, are what give us our fundamental human characteristics, and they are basically the same for everyone, the efforts of the Genome projects will produce a one size fits all product.

      --
      -------------------------

      Stupid people suck.

    3. Re:It's not done yet.... 21.1% as of July 7, 2000 by Crazy+Diamond · · Score: 1

      The genes that determine our our fundamental human characteristics still vary from person to person. Genes regulating fundamentals of our biochemistry are probably very, very similar if not identical BUT genes that determine our physical characteristics obviously are different from person to person. So say we find the exact gene related to eye color, it is probably not going to be identical from person to person. So the map that is being produced by these projects at this stage only describes the physical characteristics of a single individual. Do you see what I mean? If you take the all the base pairs and recreate all the chromosomes and put them into an egg cell, you get a very specific type of person because that sequence that has been generated is unique. Even if the DNA samples for different chromosomes are from separate source, the final result of the project still "describes" an individual with very specific characteristics (i.e. eye color).

    4. Re:It's not done yet.... 21.1% as of July 7, 2000 by aTMsA · · Score: 1
      Genes regulating fundamentals of our biochemistry are probably very, very similar if not identical BUT genes that determine our physical characteristics obviously are different from person to person.

      There is no such thing as a "phisical gene", the genes only describe how to sintesize a given peptid, and usually changing the gene affects many things. You can change a gene and change skin color and give the subject some tendency to have short fingers, you can change another and make him process less efficiently fat acids, and you can change BOTH and have him grow a new nose in the armpit, and if you change a third one, that one would inhibit the former changes. Not to mention that many genes overlap between them, so you can't change one without changing the other.
      Genome isn't a structured language, it has evolved from random changes, and thus it gives a whole new meaning to "spaghetti code".

      Even if the DNA samples for different chromosomes are from separate source, the final result of the project still "describes" an individual with very specific characteristics

      The map doesn't describe a particular gene set, but rather it describes the locus(positions) of the different genes(there's a difference between the position, which is invariable on the same species, and the genes that occupy it, which can be many on any given species).

  38. Contig Assembly -- a mere hack isn't enough by Jonathan · · Score: 5

    Although the article doesn't really explain it, what this programmer did was write a contig assembly program -- a program that tries to find the most likely ordering of the fragments in the raw sequence data.

    While it is very impressive that a programmer was able to write a contig assembly program in four weeks, and that it only took three days to assemble the entire genome, I really doubt that this particular assembly of the genome is going to be definitive. People like Gene Meyers and Phil Green have devoted years to developing such programs, and I think the results of their programs, although probably taking more than three days to run, are likely to yield more accurate results.

  39. Re:Whose copy is it? by jfern · · Score: 1

    Somewhere I heard that race accounts for less than half of the the genetic difference between two humans, it's only a few genes that make racial differences.

  40. Two words by MagPulse · · Score: 1

    I think some of us finally after laughing loudly at first, then more and more quietly, at joke after stupider joke, are realizing that maybe Slashdot should change. Maybe the Linux community as a whole should change (Linux.com has up stupid polls too, missing a chance at getting actual valuable feedback from the community). Maybe I'm wrong, maybe it's destined to stay the way it is. But if it is to change, that change will be to grow up. Then again.. serious news at Slashdot? Maturity from editors? (besides Jamie, she's the mature one) Maybe not in my lifetime.

  41. Please no!! by HaggiZ · · Score: 1

    Just imagine what microsoft could have instead of that annoying little paper clip!
    --
    Glenn

    HEALTH WARNING:

  42. Re:Whose copy is it? by perreira · · Score: 1

    It is not only: take two people. We share 99% of our genome with apes, about 96 or so with other mammals. So why bother about races... And wasn't it only 85% of the genome they mapped ?

  43. We don't have the "source code" for humans. by dotslash · · Score: 1


    I don't agree with the statement that "we now have the source code for humans". What we seem to have, is a core dump of the "binary", without a dissassembler or any concrete idea of what the higher-level building blocks are. Furthermore, this "binary" has not been produced by a heavenly programmer. Instead, it is the result of a "Genetic Algorithm". If you have ever looked at the results of a genetic algorithm, you would see that they lack any "logical" structure. It is very difficult to see what the code is actually doing, since it hasn't been produced by a logical process, but rather an almost random process over millions of years.

  44. Re:Linux was used in the sequencing by tatarsky · · Score: 1

    We are working on a writeup page about the technology used for this. It was indeed 100 Linux machines and yesterday the machines running as the web servers pushed out .5 TB of data.

  45. Linux was used in the sequencing by eperlman · · Score: 1

    I am surprised I don't see this mentioned anywhere, but the cluster of machines at UCSC that helped crunch the genome were all running Linux.

    It was quite an impressive site when they were all sitting in a lab room with huge window. :-)

    1. Re:Linux was used in the sequencing by eperlman · · Score: 1

      If it were students pushing out 5TB worth of 700meg files they would be accused of pirating VCDs...

      Can we now claim that we are just trading our genome with our friends?

      :-)

  46. Re:Argh, everything is NOT open source by The+Grammar+Jew · · Score: 1
    Um...no.

    If somebody will modify the genome to create a superhuman and then release that superhuman, without also releasing the modifications in source code form, that would violate GPL. (As if anyone will care.)

  47. Re:What Possible Use Would Anybody Have For This? by inio · · Score: 1

    Why of course they released it so we can generate pads and start off with a wonderfuly large (few hundred megs with the right algs) paddbase. So get crack'n!

  48. GodPL? by teddlesruss · · Score: 1
    I thought that anything like that was pretty much GPLed by God anyway? Or don't the bible and ten commandments count?

    ... maybe I'm getting them confused with the manual or the warranty.

    --
    -- ted russ http://www.arach.net.au/~ted/mydynes/ http://www.arach.net.au/~ted/myblogs/
  49. Re:Argh, everything is NOT open source by qnonsense · · Score: 1

    It was a joke!! "Now if only they'd GPL it" was a poke at the zealots on this site who parrot their little catch phrase without really understanding it. UCSC (go Slugs!!!) is doing us all a great service by actually publishing this stuff.

    PS. I go to UCSC if you hadn't noticed.

    --
    There comes a time in every man's life when he must say, "No mother! I do not want any more Jell-O!"
  50. Re:Argh, everything is NOT open source by Buck2 · · Score: 1

    I thought it was a joke, personally.

    I guess I was in the wrong since both Hrunting and, ATM, +3 moderators agree.

    Hmm.

    --

    As my father lik@(munch munch)... ....
  51. Making kids.. by bartok · · Score: 1

    Does that mean that if you make kids with this thing, you hace to have them cary their source with them?

  52. Damn! by Seumas · · Score: 1
    Even compressed, it's well over 700MB's.

    But for this blasted dial-up, I would generate my legion of SlashMonkeys!

    Maybe I'll just wait until "The Human Genome" comes out on audio-tape so I can hear it recited by James Earl Jones.
    ---
    seumas.com

  53. Genetic stuff as Intellectual Property by Stephen+VanDahm · · Score: 2

    Bruce is joking (he's joking, right?), but the question remains: can people really patent and copyright this kind of stuff (genes, and the like)? I can see how it is valuable intellectual property, so someone is bound to try it, but on the other hand, you don't invent anything, you just discover it.


    ========
    Stephen C. VanDahm

    1. Re:Genetic stuff as Intellectual Property by Tet · · Score: 2
      can people really patent and copyright this kind of stuff (genes, and the like)?

      Yep, they can (and do). The logic being that it costs a lot of money to do the research, and that without patent protection, they wouldn't be able to recoup that investment. This is, in fact, pretty much what patent law was designed for in the first place -- to stimulate progress by providing financial incentives to do so. The only problem with this theory is that they're patenting things that they didn't invent. And in the case of the human genome, the stimulating progress argument doesn't hold. The HGP was doing the work already. IMHO, the human genome is too important to allow any company to control.

      --
      "The invisible and the non-existent look very much alike." -- Delos B. McKown
    2. Re:Genetic stuff as Intellectual Property by The+Grammar+Jew · · Score: 1
      I don't see how discoveries are intellectual property, sorry. If Stephen VanDahm discovers a new law of nature, he may want others to call it "VanDahm's Law", and that's it. Newton invented calculus, but he never demanded royalties. He only demanded recognition of his priority (despite the fact that Leibnitz published first). Ditto for law of gravity.

      Laws of nature and math equations are just there, open to everybody to discover. (Note: I consider algorithms to be math equations).

  54. Hows this for diversity... by skiy · · Score: 1

    with 99% the same genes,
    we can start mating with monkeys.

    --
    skiy. www.Smokedot.org Drug Info, Rights, Laws, and Discussion
  55. To Moderators by skiy · · Score: 1

    Did you get that joke?
    was it funny?
    mod it up then.

    --
    skiy. www.Smokedot.org Drug Info, Rights, Laws, and Discussion
  56. Could we _please_... by Anonymous Coward · · Score: 1

    ...go through one article where the god damn GPL ISN'T mentioned???

  57. Re:chimps and other primates -- AND clouds! by Xanlexian · · Score: 1

    Okay, so we missed out by 1.6% from being a monkey. As I understand it (I'm definately not a science/biology fellow) we're also something like 95% water. Clouds are 100% water. Did we miss out by 5% from being a cloud?

    --
    "Congratulations, Boots. Your robot has become self-aware. You're a daddy now." -- Dr. Rho Bowman
  58. GATTACA by MOMOCROME · · Score: 1
    gattacagattacagattacagattacagattacagattacagattaca gattacagattacagattacagattacacatgagacctgatggttttata aggggctcttccccctttgctcagcacttctccttcttgccaccgtgca aagaaggtgctttgcttcccttcaccttccgccatgattgtaagttcctg aggcctccctagccaggttgaactgtgagtcaattaaaactctttccttt ataaattactcagtctcaggcgattacagattacagattacagattacag ttccgccatgattgtaagttcctgaggcctccctagccaggttgaactg agttctctatggcagtatgaaaacgtactaatacaaataacaaaggtttt atgtttcctcccaaattagtgtctagagtcaacgttagctcctagggtca agctattatacaggattagaggcatttaggagattacaacttttccctgg tttttcaaagattagtcacatgttcacttggctgaatacacaaggtagaa tggacaggacttgaggcaaataaccttgtggttaagagtactcaggttca gattacagattacagattacagattacagattacagattacagattaca

  59. Re:Compiling the Source by koekepeer · · Score: 1

    thoughts, consiousness, amd the like are just concepts we humans made up. think about that for a while and your mind will dazzle.

    nature vs. nurture is of course a very complicated thing. but i don't think it helps simplifying the argument by saying "well our genes are the same, why aren't we the same". the human genome is just a blueprint. imagine a large building, being built from a blueprint. imagine that happening again. can you honestly say that those two buildings will be exactly the same? no, therefore an identical twin will also not be exactly the same. but they do look alot alike.

    do they think alike. most probably not completely, since they're in the same enviroment, and have to somehow find their own niche in that enviroment.

    instead, try not to look at differences, but at similarities. although humans seem to behave in a very different way, their individuality arises from minor differences. in essence they are very similar.

    so:
    1.identical blueprints will not result in the same end product in a natural enviroment
    2. humans are very much the same, and not so different as you might think!

    ta,
    meneer de koekepeer

  60. Fun and games by potsy2 · · Score: 1

    Go Here and search for "GATTACA".

  61. spelling or lack of knowledge by koekepeer · · Score: 1

    i've heard of exons, but extrons are a totally new concept to me. tell me what are these special, human specific dna-elements called extrons. apparently an integral part of those dna element one refers to as genes.........

    excuse my cynical comment, moderate me to -100 if you wish

    meneer de koekepeer

  62. god's permission by koekepeer · · Score: 1

    Oh, you were attempting a joke? If not, you better explain what god (no caps) has to do with this. In my , not so humble, opinion this is off-topic.

  63. Re:Whose copy is it? by Kinlan · · Score: 1

    From what I remember, they can identify bits in the DNA, by sampling identical twins/triplets etc. because they should be quite similiar, they can then compare the DNA and see which bits make us unique.

    I am pretty sure that they use this technique as the basis of finding genetic disorders and hereditary disorders etc.


    -
    --
    As cunning as a fox, which has just been appointed professor of cunning at Oxford University. http://www.kinlan.co
  64. gpl by koekepeer · · Score: 1

    i'm not sure, but i don't think that all the software you just mentioned is gpl-ed (as if it matters)
    regards,
    meneer de koekepeer

  65. Re:Argh, everything is NOT open source by Turing+Machine · · Score: 1
    We're not dealing with software here

    The hell we're not. DNA is software. It's a coding scheme for assembling amino acids into a specific sequence to produce proteins. Each amino acid is coded for by a specific three-unit sequence of DNA bases (with some coding redundancy). DNA (more precisely, the information coded by that DNA. The physical DNA is a substrate for the information in exactly the same way that the pits on a CD are a substrate) is a software program that when loaded on to the proper hardware (a cell) will cause that hardware to perform particular functions.

    DNA implements a coding scheme just like ASCII or Unicode. It's not an "analogy", it's a fact.

    My greatest fear is simply that the genome will be modified at all.

    So we should ban evolution altogether, then?
    --
    WordSocket Voice BBS Software

  66. Re:What Possible Use Would Anybody Have For This? by fatdave · · Score: 2
    OK, I have downloaded the genome, indexed it and have it available for my users.

    The latest full release of EMBL (63) weighed in at about 4.7 Gb compressed. This took me about 30 hours to download.

    GPL'd tools are available. Checkout EMBOSS for a start, BioPerl, BioJava, bioPython, and BioXML, all linking in with a common biocorba interfaces, and many more besides.

    I run my bioinformatics service with a minimum of commercial software (only one commercial package which I am soon replacing with EMBOSS, and several non-open packages. The majority are open to some degree.

    Needless to say it is based on Unix systems (IRIX/Linux in my case).

    ..d

    --
    --- Four bases should be enough for any genetic code
  67. Human Genome by purefizz · · Score: 1

    Well, placing the human genome online is great. It doesn't make sense to patent a particular gene sequence... so it makes sense that it would be available. What WILL end up getting patented and licensed is PROCESS and METHODS to retrieve, map, and develop derivative drugs from dna. Some interesting stuff is what Protien Design Labs is doing. They *humanize* rodent therapies. I can imagine there are a slew of drugs that work in other species, yet will not work in humans. The ability to takes these and determine possible differences in geneitic components will aid creators of therapies (gene or otherwise).

    UG and GM to hold live Internet Conference

  68. Re:Argh, everything is NOT open source by Schnedt+McWapt · · Score: 1

    I for one am growing more and more disappointed in the way the editors of this website persist in throwing around the 'GPL it' phrase in matters where it's irrelevant.

    You guys are trivializing what the GPL represents, and you're bringing ridicule to the community of people who support the GPL for the things it is intended for.

    Content can't be 'GPLed' just by putting it out for public access. Books and information can't be 'GPLed' by merely being made freely available for downloading. The GPL describes a development process that involves a robust feedback mechanism for continual development and improvement, not a chunk of boilerplate that merely describes a release of information to the public.

    The process that the GNU license encompasses and supports is a development model, not a trivial release method. I would think that Slashdot, more than many other sites online, would recognize this and give the GNU licence and it's advocates the respect they are due.

    Please adopt a more decent, respectful attitude toward the GPL. Doing otherwise just waters down it's meaning.

    Go ahead and take away 'karma' if this sounds like flamebait. I'm not even the GNU movement's biggest advocate, but this message needs to be said.

  69. to make *another* source code analogy... by jamesh · · Score: 1

    ... if you can compare the human genome to source code, then the method they used to get the source code is obviously 'reverse engineering', with all the legal implications that has :)

    I've often wondered if some of the processing could have been made a distributable project (a la SETI)... it would have been cool to say I contributed to the human genome mapping effort!

  70. OFF-TOPIC -- Re:Patent your genome . . . by Stephen+VanDahm · · Score: 1

    A scary thought: my mother could patent her genome, and, since I have my mother's nose, she could charge me royalties for the next 20 years!! :-)


    ========
    Stephen C. VanDahm

  71. Re:Argh, everything is NOT open source by Imperator · · Score: 2

    My greatest fear is that the genome will be modified to create more zealots for /.. Imagine a race of superhumans capable of posting "Foo should be GPLd" messages as fast as today's trained apes are posting "First Post" messages. There'll be license jokes, insensitive "treat AOL users like dirt" jokes, Microsoft jokes, bad trolls moderated up as funny, good trolls moderated down as flamebait, and flamebait moderated up as insightful. It'll be July 2000 all over again! We must take action to prevent this!

    --

    Gates' Law: Every 18 months, the speed of software halves.
  72. Re:About 1500 MBs by Animats · · Score: 3
    ow much data is in a genome...
    Human DNA is roughly a gigabyte. It's interesting that the download, compressed, is also about a gigabyte.

    Now we have the object code. Much of the rest of this century will be spent trying to disassemble and comment it.

  73. its not rilly ture by moore · · Score: 1

    I was talking to somone, who has been staying up
    late hacking perl to make this happen, last
    thursday about this and it just is not true thay
    are not done. some one in marketing or somthing
    just desided to ship now. I am actuly not kidding
    what thay rilly have is some sort of plan of how
    to finish called the golden path or somthing.
    UCSC has been doing lots of good work on this but
    the sequencing is not finished from what I here.

  74. God No! by Perdo · · Score: 1
    I know releasing this to the public was the right thing to do but...

    Releasing it to SLASHDOT!?!?!

    After looking over the kernal source I'm simply terrified what they people here might do with the genome!!

    --

    If voting were effective, it would be illegal by now.

  75. Net another Genome story? by bartok · · Score: 1

    Ha! KDE 2.0 is way ahead of the Genome project. Slashdot is sooo biased toward the Genome project it a crime! :-)

    1. Re:Net another Genome story? by The+Grammar+Jew · · Score: 1

      me@ai-lab > reply with this:
      Hey dude, Genome and Gnome are two different things!
      ai: the poster tried to be funny
      me@ai-lab > abort post!
      ai: too late, stuff posted
      me@ai-lab > darn.

  76. The Human Source Code? by Whyte+Wolf · · Score: 1

    Despite it not being complete, the fact that the majority of what is essentially the source code for human beings has been released it fascinating. The day when we could literally look at what makes us 'us' on a computer screen--and meddle with our own genetics--isn't too far off. With this kind of data at your fingertips, and some programs to run DNA combinations, you could imagine 'compiling' a virtual human being within cyberspace.

    Who needs avatars when you can upload your genetic code and appear in cyberspace with the same 'realness' as in meatspace?

    Are we ready for any of this? Does it matter? Once again, the future is rusing at us, and we have to surf it and ride out the storm as best we can. Hopefully more good will come of the Human Genome Project and it's brethren than ill.

    As for GPLing the human genome, I think GOD already hols the patent. When you creat life, license it as you will, for now, I'm accepting the King James Bible as my EULA with God :)

    OTOH, I've always wanted to create life myself...

    --

    Beware the Whyte Wolf.

    With a gun barrel between your teeth, you speak only in vowels...

  77. Re:About 1500 MBs by IAmSancho · · Score: 1

    Yes.

    --
    -------------------------

    Stupid people suck.

  78. Re:What Possible Use Would Anybody Have For This? by ShamballaJones · · Score: 2

    For most of us it's not a lot of use, I'd agree. Howver, if you're a specialist researcher in numerous biological, medical fields (and possibly anthropology, archeology, geneology and others as well) this stuff is a potential goldmine.

    Provided you have the software to mine it of course.

    Putting the genome in the public domain is a great start but to make it truly accesable requires freely-availible (i.e. open source / GNU / FSF) tools with which to explore it. Otherwise, as you observed, it's pretty difficult to follow.

    My guess is that if those tools appear then one day not too far away kids in highschool will do lab exercises in biology class that involve cloning genes and so forth(*). That may seem far-fetched but I suspect that we're witnessing a nascient technological revolution at about the stage that the current "computer revolution" was in when a bunch of geeks were doing apparently pointless things with the original Altair.

    * If OS/GNU tools don't turn up most schools aren't going to be able to afford the tools - so no labwork.

    --
    [ Blairism is the continuation of Thatcherism by other means. ]
  79. Re:No need to GPL, it's public domain by SEE · · Score: 2

    Under the Universal Copyright Convention (Berne), a copyright notice is not required. As most nations are members of either or both the UCC and WTO (which requires adherence to the UCC), there are only a handful of nations on Earth where a copyright notice can possibly be required, and in few of those is there any actual recognition of copyrights at all.

    Steven E. Ehrbar

  80. No robots.txt! by Pseudonymus+Bosch · · Score: 2

    There is no http://genome.ucsc.edu/robots.txt. And we are talking of an enormous database.

    You'd better keep your robots off the site.
    __

    --
    __
    Men with no respect for life must never be allowed to control the ultimate instruments of death.
    GW Bu
    1. Re:No robots.txt! by tatarsky · · Score: 1

      Fixed. Thanks, oversight.

  81. Re:Girls Release 2.0 by Squeeze+Truck · · Score: 1

    Damn, where are my moderation points when I need them... :)

    --

    "Reactionaries must be deprived of the right to voice their opinions; only the people have that right." - Mao

  82. Way to go UCSC! by ttfkam · · Score: 1

    Having gone to Santa Cruz, it doesn't surprise me that they would be so willing to publish educational/scientific material online. It makes me proud to have been a banana slug (mascot of UCSC).

    The results may not be the definitive work, but it is definitely a huge leap in the right direction. I really wouldn't be surprised if we hear more from the bio-chem labs there soon.

    --

    - I don't need to go outside, my CRT tan'll do me just fine.
  83. In this case GPL would be bad by Ripat · · Score: 1

    If anything it should be entirely Public Domain.

    At least that's my opinion...

  84. LOL by bartok · · Score: 1

    Actually, this was a joke. I'm a Gnome user.

  85. I beg to differ by petebu · · Score: 1
    The GPL doesn't represent a particular development model at all. That's only what the "Open Source" movement would claim. In truth, the GPL represents a user's freedom when it comes to software. This is regardless of whether it was developed in the "Cathedral style" or the "Bazaar style."

    Otherwise, I agree that the "GPL it" phrase is overused. People need to understand the reasons for why the GPL came about (ie. freedom) and apply those *ideals* to items other than software rather than just slapping a "GPL" label on them.

  86. Open Source - completely broken by Anonymous Coward · · Score: 1


    <B>30 Ways to be Offensive at a Funeral</B>
    <OL>
    <LI>Tell the widow that the deceased's last wish was that she make love with you.
    <LI>Tell the undertaker that he can't close the coffin until you find your contact lens.
    <LI>Punch the body and tell people that he hit you first.
    <LI>Tell the widow that you're the deceasd's gay lover.
    <LI>Ask someone to take a snapshot of you shaking hands with the deceased.
    <LI>At the cemetery, play taps on a kazoo.
    <LI>Walk around telling people that you've seen the will and they're not in it.
    <LI>Ask the widow to give you a kiss.
    <LI>Drive behind the widow's limo and keep honking your horn.
    <LI>Tell the undertaker that your dog just died and ask if he can sneak him into the coffin.
    <LI>Put a hard-boiled egg in the mouth of the deceased.
    <LI>Slip a whoopee cushion under the widow.
    <LI>Leave some phony dog poop on top of the deceased.
    <LI>Tell the widow that you have to leave early and ask if the will can be read before the funeral is over.
    <LI>Urge the widow to give the deceased's wooden leg to someone poor who can't afford firewood.
    <LI>Walk around telling people that the deceased didn't like them.
    <LI>Use the deceased's tongue to lick a stamp.
    <LI>Ask the widow for money which the deceased owes you.
    <LI>Take up a collection to pay off the deceased' gambling debts.
    <LI>Ask the widow if you can have the body to practice tattooing on.
    <LI>Put crazy Glue on the deceased's lips just before the widow's last kiss.
    <LI>Show up at the funeral services in a clown suit.
    <LI>If the widow cries, blow a trumpet every time she wipes her nose.
    <LI>When no-one's looking, slip plastic vampire-teeth into the deceased's mouth.
    <LI>Toss a handful of cooked rice on the deceased and scream "MAGGOTS! MAGGOTS!" and pretend to faint.
    <LI>At the cemetary take bets on how long it takes a body to decompose.
    <LI>Goose the widow as she bends over to throw dirt on the coffin.
    <LI>Circulate a petition to have the body stuffed instead of buried.
    <LI>Tell everyone you're from the IRS and you're confiscating the coffin for back-taxes.
    <LI>Promise the minister a hundred dollars if he doesn't keep a straight face while praising the deceased.
    </OL>
    <BR>

  87. Re:Compiling the Source by jeremy+f · · Score: 1

    It already can, you just need to know the right flags to compile it with.

    gcc --WITHOUT_THE_NEED_TO_ENSLAVE_HUMANITY_IN_A_VERY_B AD_MATRIX_RIP-OFFISH_TYPE_OF_WAY genome.txt -o ai

    Also, you might want to check on any child processes spawned by your new program. If they get bad, you'll have to spank them manually.

    _jeremy

    (incidentally, you may wish to give it it's own /home directory once you're done with it. And have you ever tried to potty train a computer program? Let me tell you, when it dumps it's core, it's not a pretty sight.)

  88. Trolls rejoice!! by ninjalex · · Score: 1

    Now they can assemble their very own Natalie Portmans(Portmen?) from common household items like hot grits and raw potatoes!

    --
    Banned from moderation 01-27-2002. Fuck you too /.!
  89. About 1500 MBs by HerrNewton · · Score: 2

    Truly impressive when one realises that the compressed files alone weigh-in at just a bit over 1500 MBs. Has anyone actually downloaded and unzipped the files? I'm not looking for laughs or a troll here, but I'm honestly curious just how much data is in a genome... a viable storage medium, perhaps? I'm serious.

    ----

    --

    ----
    Am I the only one who thinks Microsoft is a misnomer? Perhaps Macrosoft would be a better fit?
  90. Only if God exists... by ShamballaJones · · Score: 1

    God only holds the patent if he/she/it exists and that may be very difficult to prove in a patent court.

    To complicate matters, if one religion's deity does exist then presumably the rest of the divine menagerie exists as well - so then we have to wait until the gang finishes duking it out and decide which one of them has to take responsibility for cocking up and creating the human race.

    Even after that there remains the problem that the deity who takes the rap for the humanity would have to fight various corporations through the courts and legislature for the rights to the genome. Unless he/she/it has been doling out a lot more soft money in Washington DC than appears to b the case recently they are going to loose that one.

    --
    [ Blairism is the continuation of Thatcherism by other means. ]
  91. Re:What's the big deal? by FigWig · · Score: 1

    Genbank & Pubmed rock my world....even if a lot of the genbank stuff is crap.

    --
    Scuttlemonkey is a troll
  92. Compiling the Source by lordpez · · Score: 1

    So when will gcc be able to compile the source into a working AI? I suppose that such an AI would have terrible social skills as it wouldn't have been brought up in a normal environment.

  93. Genome online? by N1UGLham · · Score: 1

    Nice! I was praying they'd make it available for download! Now if I could just get this darn DNA replicator to boot up...

    1. Re:Genome online? by slashdoter · · Score: 2

      Can you imagine if M$ tryed to make a DNA replicator. Can you say blue chromosome of death

      --
      Does anyone actually have a Java program designed to control air traffic, or for the operation of a nuclear facility?
  94. If they would only GPL it... by dcs · · Score: 2

    Yeah, that would give a whole new meaning to the expression "GPL virus". I can already picture it:
    I create virus, GPL it's DNA, and then release it. You get the virus, get contaminated, and now you are required to release your DNA specs for everyone to see! Yeah! Go, GPL, go!

    --
    (8-DCS)
  95. Patent your genome before it's too late! by Bruce+Perens · · Score: 3
    An oft-overlooked characteristic of the U.S. patent office is that they gladly accept models to support a patent claim. So, I suggest that Slashdot readers fill out the form and send in a test-tube to support their claim. What to put in the tube is left as an exercise for the reader :-)

    Bruce

  96. No need to GPL, it's public domain by gunner800 · · Score: 1
    There are plenty of very good arguments about whether or not this sort of thing can be copyrighted. But it's moot in this case; there's no copyright notice for the data or even the HTML pages.

    It's all public domain now.


    My mom is not a Karma whore!

    1. Re:No need to GPL, it's public domain by pudge · · Score: 1

      As noted, a lack of copyright does not imply public domain. It implies the exact opposite.

      However, since I own the data (as do the rest of us), it can't be copyrighted anyway. You might as well patent a smile or copyright a skin color.

    2. Re:No need to GPL, it's public domain by kdz · · Score: 1

      A lack of a copyright notice implies "All Rights Reserved" in most countries.

    3. Re:No need to GPL, it's public domain by Squeeze+Truck · · Score: 2

      Actually, I hear some biotech companies have acquired the rights to some of the "more interesting" genetic material in places like S. America in exchange for a new family cow or somesuch. I can't recall where I read this, but I ask that you believe me anyway.

      --

      "Reactionaries must be deprived of the right to voice their opinions; only the people have that right." - Mao

    4. Re:No need to GPL, it's public domain by Locutus+of+Microsoft · · Score: 1

      Hand over youe genome for assimilation amd Innovation(tm).

      --
      We are Microsoft. You will be Innovated(tm). Resistance it futile.
  97. Whose copy is it? by Frac · · Score: 2

    Since everyone's DNA is different, how do we determine which part is what makes us unique, which part is changable (to a certain extent to make us humans "compatible") and which part is disposable DNA? Was the genome a replica of a caucasian, asian, black, or a bit of each?

    Go get your free Palm V (25 referrals needed only!)

  98. Re:Argh, everything is NOT open source by pudge · · Score: 1
    You guys are trivializing what the GPL represents

    Is that even possible?

  99. Apache by CMU_Nort · · Score: 2


    So how long until someone writes mod_human for apache?

    Although the benefits of embedding a human in your web server are dubious.

    --
    --------- Beware the dragon, for you are crunchy and good with ketchup.
    1. Re:Apache by on · · Score: 1

      ...or when someone initiates an OpenHuman project :-)

  100. I downloaded the whole thing and I can't compile! by ownermachina · · Score: 1

    As soon as I heared, I downloaded the whole thing, and did this, but it didnt work! tar xzvf genome.tar.gz man/arms.c // written in C! man/legs.c man/brain.h ... and so on ./configure --with-bigboobs it seemed to work, and then: make woman but nothing happens! anyone can help???

  101. Re:Quicker by chainsaw1 · · Score: 1

    That's not the half of it. Think of whatt they'll do when they find out your doing cellular mitosis without extra genome licences!

    --
    - Sig
  102. Re:chimps and other primates -- AND clouds! by Webmonger · · Score: 1

    No, it's more like 80% water.
    Which is amusing because the surface of the Earth is about 75% water. Maybe if I pee a lot, I can become a planet!

  103. race and genetic diversity by TheDullBlade · · Score: 2

    race accounts for less than half of the the genetic difference

    Isn't that what you'd expect? In fact, I'd be rather surprised if it was anywhere close to half.

    Not only can the races interbreed with complete success, there are morons and geniuses, weaklings and strong men, over roughly the same large spread in each race. To me these facts alone suggest that there should be far greater diversity within races than between them.

    However, I don't take this to mean that racial differences are necessarily insignificant or uninteresting, though one should naturally expect all but the most blatantly obvious to be lost in the variety of individuals.

    But isn't the genome the complete set of genes for the species? Not the genes of one man, but the total genetic catalog of all mankind? If so, the question "Which man?" (to which you replied) is nonsensical.

    --
    /.
  104. This may take a while by SatanicPezDispenser · · Score: 1

    4.5 hrs, to be exact, and that's on a cable modem....Has anyone else finished d/l'ing it and taken a look at it?

    --
    Writhe your naked ass to the mindless groove.
    http://www.jackiereaper.com
  105. Re:Argh, everything is NOT open source by Jayson · · Score: 1

    >My greatest fear isn't that someone will modify
    >the genome to create a superhuman and then not
    >tell anyone

    the gpl fixes this.

  106. warranty by www.sorehands.com · · Score: 1

    I thought my genome had a lifetime warranty. If it completely failed, I could come in for an exchange.

  107. What Possible Use Would Anybody Have For This? =) by citizenc · · Score: 2

    I'm not looking to troll here, but, honestly, what possible reason, (besides being able to bring a chick over to your house and say 'hey baby, wanna see my source code?') would anybody have to download 1500 megs? I dug around the site, and I found a sample of what is contained in those mammoth files; you can check out what's contained within the zips here .

    Again, I'm not looking to troll here -- I'm just curious, that's all. =)


  108. Fits on a one and a bit CDs by ShamballaJones · · Score: 1

    Wow - The whole blueprint for a human being (approx. 750MB) almost fits on a CD-ROM. My Mandrake distro came on 6 CD-ROMs.

    Then again, I didn't have to feed the distro and wait twenty years for it to grow into something useful. The difference is the genome encodes the potential whereas the distro encodes the actuality.

    --
    [ Blairism is the continuation of Thatcherism by other means. ]
  109. GPL'd Genes license question by kevin805 · · Score: 2

    If I GPL my genes, then later, my children want to become cyborgs, would they be violating the license if they were to use implants that weren't GPL'd?

    Would I be better off releasing my genes under the LGPL?

  110. Re:what about God? by MOMOCROME · · Score: 1

    'Tis a razors edge between Flaimbait and Funny.

  111. Re:What Possible Use Would Anybody Have For This? by FigWig · · Score: 2

    There are a TON of freely available bioinformatics type programs available, a good start is to browse Biocat. Of course to get any use out of these programs you should have some knowledge of biology & computational biology. Traditionally academic software is very open, though not GPL (I'm beginning to hate all you GPL-wanting whining fuckers (this is not necessarily directed to the poster I am replying to)). An unfortunate trend as of late is servers which provide an application but no binaries to run locally, and no code. Not very scientific if you ask me. Also not helped by the GPL.

    one day not too far away kids in highschool will do lab exercises in biology class that involve cloning genes and so forth

    In high school I took Advanced Placement Biology (suppose to be equiv to an intro college course) and one of the labs was to introduce a plasmid into E. Coli so that it became immune to ampicyllin, an anti-biotic. Genetic experiments are definitely possible at the high school level, it's just a matter of getting the expensive machines and specialized knowledge. Maybe a schoold district could put its money into a couple PCR machines and a knowledgable lab tech?

    --
    Scuttlemonkey is a troll
  112. Compression by jfern · · Score: 1

    I didn't download the whole thing as it'd take over 5 hrs, but I determied that the compression ratio is about 75%, so it should be about 3 GB umcompressed, and is probably a text file consisting of A,G,C,Ts.

  113. Argh, everything is NOT open source by Hrunting · · Score: 3

    Now if only they'd GPL it.

    Geezus, why does everything have to be related to open-source software? We're not dealing with software here, folks, no matter how many analogies you want to make.

    Guess what, the human genome is better than GPL'd. It's completely free. If you alter it, you have a copy of the new code right in the genes. We did majority of the work on decoding the genome in the last 2 years. Decoding is practically trivial now, and the finished product carries with it the code that made it.

    Everything is not software, and not everything should live by the rules of software. I personally would love to stop hearing talk about licenses with respect to the human genome and start hearing talk about the responsible use of the code. My greatest fear isn't that someone will modify the genome to create a superhuman and then not tell anyone what they did. My greatest fear is simply that the genome will be modified at all.

    There's a fine line between advocacy and zealotry

  114. completeness of genome by Anonymous Coward · · Score: 1

    I talked with a molecular biologist on this issue and apparently the human genome is 99% done but the last 1% should take years to find. This is because of the method used to find it. In addition, note that the genome is only structurally identified, it is still unclear exactly what each part influences.

    In any case, the sharing is cool!

  115. Source released? by Steve+G+Swine · · Score: 2

    Are they accepting diffs?

    --
    "Consider yourself a member of a virtual corporation with Mr. Torvalds as your Chief Executive Officer." - Linux Advocac
  116. What's the big deal? by stm2 · · Score: 2

    I'm donwloading sequences (human included) since 1994 from NCBI web site (http://www.ncbi.nlm.nih.gov/).
    I'm working on sequence analysis to make philogenetic trees in Quilmes University (Argentina).

    --
    DNA in your Linux: DNALinux
  117. genome project needs contributors by fence · · Score: 1

    Since the UC Santa Cruz team considers this a "rough draft" of the human genome, it seems like they are in need of contributors. Just send in a single hair or a few drops of blood.

    Here's the chance for everyone, even the script kiddies, to contribute to a future open source project. No coding experience or 'leet skilz' are required. (sorry, me english->leetspeek translator is down)
    ---
    Interested in the Colorado Lottery?

    --
    Interested in the Colorado Lottery or Powerball games?
    check out http://colotto.com
  118. Re:what about God? by aTMsA · · Score: 1
    If He doesn't enforce the patent, He loses it.

    Note: Don't think that if i receive a "Cease and desist" letter from Him, i'm going to stop using my genes....

  119. Re:MEEPT SPEEKS by FigWig · · Score: 1

    You're not MEEPT. You don't seem very glorious, and you didn't make me laugh. I also don't see a sig about bringing together all the divided factions of /. into one big divided faction, so you must be fake. MEEPT is dead! Long live the MEEPT!

    --
    Scuttlemonkey is a troll
  120. Fount of Misinformation by Medievalist · · Score: 1

    I've said it before, I'll say it again, riflip mapping is bunk.
    This so-called "genome" is a VERY rough aproximation of a subset of human DNA.
    Have you ever wondered where the restriction enzymes come from? Go look it up.
    What we need is a decompiler, not munged binaries.
    --Charlie

  121. Product Placement? by localman · · Score: 1
    Hey! The title of the movie Gattaca appears 20 times in this tiny sequence alone!

    I had no idea that Sony or Columbia Pictures had these kind of connections...

  122. Free update! by www.sorehands.com · · Score: 1
    I found a few bugs, do I get a free update?

  123. GPL? by fishexe · · Score: 1

    Uh, wouldn't we need God's permission first?

    Ever get the impression that your life would make a good sitcom?
    Ever follow this to its logical conclusion: that your life is a sitcom?

    --
    "I don't care about the Constitution!" --Bill O'Reilly, November 17, 2009
  124. Quick by the_other_one · · Score: 2

    Quick download the human genome and spread it around the internet before the RIAA and MPAA try to stop links to it. Humans duplicate copyrighted material. These agencies do not want the information required to build a human to be available.

    We must stop them from eliminating humans in the name of greed.

    There is also a rumour that they are attempting to patent sex.

    --
    134340: I am not a number. I am a free planet!