I understand where you're coming from. And you have a point.
And just as a note, I'm the kind of person that would get dismissed as commie left wing whacko by most Americans, and a Canadian to boot.
But let's give credit where credit is due. The Americans were crucial in revitalizing, and bringing to the fore, the concept of democracy in the modern world. The US has done a lot of horrible things in the name of democracy, and in the name of freedom, from the distant past to the present. There is a fundamental conflict in the US between the principles that they want to hold themselves to, and their inherent desire to be prosperous and powerful. This leads to a lot of hypocrisy.
However, this does not detract from the fact that the concept of the modern democratic state derives largely from the American example. This is partly because they are powerful enough to project it across the world, but also because Americans have a fundamental need to see themselves as good people living by just rules. Double standards and hypocrisy is human nature.. as is abuse of power.
That doesn't mean that Americans are worthless. We should understand them for what they are - their faults and their strengths.
I love Bradbury. He's one of my favourite scifi (and other stuff) authors. It's not that he's a good science fiction author - he's a good author period (read some of his non-scifi stories - The Wonderful Ice-Cream Suit, A Medicine for Melancholy).
The thing about Bradbury is that what he focuses on is not the science, but more the social aspect of humanity. He writes about people, not spaceships.
For example, some of the earlier short stories use SciFi as backdrop against which to express more immediate social concerns. There are stories in which a population of black people build their own rocket, and quietly depart for Mars, where they can live in peace.
In the context of the civil rights movement and equality rights, this is a powerful and strong statement. It strongly reflects the simple sentiment that these people just want to be left alone to live their lives in peace.
Bradbury is a wonderful and imaginative author. He was a large influence on my views and perspectives. What he beleives and says deserves respect - because he is a respectable man.
About bioinformatics.. I would definitely recommend it. The connection with CS depends on what you mean. There are applications for both theoretical work and more applied programmatic work in bioinfo.
For CS people, bioinformatics starts with sequence data (coming from sequencers). The scientists and biologists generate some sequence data, and ask you to help them find out as much as possible about it. The ultimate goal of bioinformatics is to make it seamless and easy to go from raw sequence data (e.g ACTACGATCGTAAAGCATCGATCGAT) to a more useful functional description of what that sequence represents (what protein does it synthesize? What bilogical processes is that protein involved in? etc.)
The field is pretty young.. biologists have only recently figured out that computers can take care of a lot of the gruntwork for them. There are some pretty sophisticated tools in the business (phred/phrap, lucy, blast, interpro, crossmatch, clustal, etc.) to handle various different computations to do. However, there's very little in the way of standardized formal models, or communication methods, which deal with the field.
Most research groups end up using what tools are already available, but writing their own ad-hoc tools to put them all together into a pipeline that does what they want. As a CS person, it's immediately noticeable that there is a lot of potential for how to apply computational resources to greatly improve the state of the field.
I'm not at all educated on the biology side of things.. but I'm learning as I go. The thing is, the bioinformatics field is _hurting_ for people that have both good CS and Bio backgrounds. They are rare, and extremely useful - because they're the people that can both identify problems on the biology side of things, and then attempt solutions on the CS side of things.
It's a lucrative field.. but it requires a lot of study. At least bachelors in CS, and a degree (preferably masters of PhD) in an area of biology, will take you a _long_ way in this field. I have the CS knowledge.. I'm thinking I might go back to school at some point to get a Bio degree. I just graduated from school, though, so I don't feel like going back anytime soon.. but sometime in the future, maybe.
The work is pretty interesting too, if you're of that mindset.
Well, I havn't spent 5 years on VMs, but I'm interested in them.
I've worked at a company writing code to handle different targets for a retargetable C compiler for a while. Aside from that, no. Most of what I know about VMs, I generally pick up from books and papers and just thinking about different problems for long periods of time.
I wouldn't consider myself _that_ knowledgeable with VMs.. because I havn't done much actual work in that area. I tried for a while when I was in school.. but now I'm working in bioinformatics, and I don't really see myself switching away from it anytime soon.
Knowing good math.. makes you a better programmer. I would go as far as to say that computer science _is_ math. Knowing how to hook up a DB to a web front-end is not computer-science. It's a trade skill, like plumbing.
The difference between some web-scripting guy, and a guy who knows CS, is like difference between an automechanic and an automotive engineer. The engineer might not be able to fix your engine, but he understands the workings of it much better than your average mechanic.
From my perspective, being some random code-monkey is not too different from working at McDonalds. Pay might be better, but the work is still shit. Having a solid CS grounding lets you work in places and on problems that are actually _interesting_ and challenging. It allows you to actually contribute something new to the body of knowledge associated with computation.. or apply it well to some novel field.
I can pick up and learn a new language or API given a few months. It would take years of focused study for a random PHP programmer to acquire the knowledge I have.
Not to say that I'm special or anything.. but I've spent 5 years working my ass off to get myself to a proficient level in this area of study.. and most people who want to reach that same level will also have to spend several years doing it. It's just a question of wether you decide to do it early in your life (university), later in your life, or not at all.
I don't know. ATRAC support is in a lot of products - most notably sony minidisc players. I'm not sure how high the adoption rate for minidisc is as opposed to iPods, but they've been around for a lot longer than ipods have.
I'm curious about what kind of DRM is there as well. I know SonicStage is supposed to interact with windows DRM in some capacity, not sure why.
My main problem with this is SonicStage. Can't get it working under wine (because of aforementioned windows DRM integration). And even in windows it's a PIECE OF FUCKING ASS CRAP FUCKING SHIT software. I feel like blowing a hole in a sony executive's skull and urinating inside his brain cavity every time I use that piece of shit.
I own a NetMD.. the hardware is pretty well-engineered, but it doesn't come close to compensating for the pure hate that is SonicStage.
Man, and here I am writing my own little VM for a prototype OO system.. seems to be all the rage nowadays:D. I'm liking the recent trends of languages evolving to use simpler and simpler higher level semantics. I am a fan of smalltalk and self, but not their syntax. Their language environment and semantics, though, are worth pursuing.
One of the reasons I like prototype OO (specifically, delegation-based prototype OO, as opposed to languages that use embedding), is that a lot of _other_ dynamic language models fit well on top of it. For example, it would be very simple to make a Python -> Self compiler, because constructs that self exposes can be used directly to implement more specific class-oriented pythonic constructs. It leads me to beleive that a prototype-oo oriented base-vm can serve as a good abstract platform environment for several dynamic 'scripting' languages.
I'm not sure about the multiple dispatch though. I think multi-dispatch can be confusing.. especially in languages like these where the notion of runtime types is muddled quite a bit of the time.
Dude, you can't assume somebody doesn't know what they are talking about just because they don't have some certificate of formal education. Jesus, I've been through CS at a "good" university, and there's nothing I see there that precludes somebody getting a good grasp on it on their own.
I'm just curious, but did you consider suing the city for abuse? People have extracted million dollar settlements out of less than getting a nose broken.
If what you say is what happened, then you got fucked over by the system good. If I was in your case, I would have have felt no remorse about talking to a lawer and suing.
Well, personally, I would also have visited the girl's house and taken a baseball bat to her parents' car.. but I have a vicious vindictive streak -- As a child I got bullied quite a bit in school. One summer when one of them pushed me just a bit too far (a _hard_ punch to the stomach for no reason), I jumped up and sank my teeth into his back and extracted a sizable chunk of flesh from his back. I got in a lot of trouble for it, but just the pure pleasure of hearing that motherfucker scream and bawl like a child and hit the floor, made it all worthwhile.
Fuck, your story has made me very angry. People like the chick you were talking about, need to get their comeuppance in a very bad way. It's annoys me that the real world is not like that:(
I'm sorry, this argument is brought up a lot, but doesn't hold water.. stinks of the pedophile that claims "It's not about fucking nine year olds, it's about enjoying the natural beauty of children".
What do you think gets shared on p2p? Do-it yourself standup comedy routines? Independent music?
The amount of independent music on p2p networks is vanishingly small. Sure, it may go up in the future, but let's not blink innocently and talk about how p2p is an "independent music haven".
The vast majority of things that get shared on p2p networks fall into one of three categories: ripped music, ripped movies, and porn.
I'm not against p2p networks. I think it's a good thing that they're putting the fire to the feet of the greedy fucks that rip us off so that we can enjoy the "privilege" of listening to music. But let's at least admit a certain amount of intellectual honesty.
Well, MS wouldn't have to do much to topple our CS deparment's Unix environment, considering how sadly outdated it is.
I get depressed every time I log into bacon;)
The administration is doing a pretty good job of selling out the CS program there even without Microsoft's help (e.g. Faculty of Computer Science "Let's not bother with all of this hard 'math' stuff for our poor CS students").
Anyway, what can you say, it's still probably one of the few halfway decent CS programs in the country.
Yeah, I'm a student there:) Currently on work term, but heading back on Sept 1. What program are you in btw?
I dislike the company, but there are some really cool, nifty, interesting things, technologically, that disney does.
One of my favourite examples - The core development team of Squeak smalltalk is resident at Disney. Smalltalk hackers are a cool bunch. And yes, Squeak is open source.
Anyway, I'm sure there are many cool nerds at Disney.
They are mistaken, or making assumptions, when they make many of their complaints.
It's quite easy to tailor keywords searches in google.
Their first complaint is that many searches yield shopping sites as results instead of informational sites. Not surprising, since a lot of traffic on the internet is commercial. But it is easy enough to fix.
For example, in their article, they quote: Search for "flowers," and more than 90 percent of the top results are online florists.
True. However, search for "growing flowers" or "flowers gardening" or "flowers gardening tips", and you are immediately led to pages which focus on what you are looking for.
Also: The same goes for searching for specific products: Type in the make and model of a new DVD player, and you'll get dozens of online electronic stores in the top results, all of them eager to sell you the item. But you have to burrow through the results to find an impartial product review that doesn't appear in an online catalog.
If you are searching for reviews of products, just add "review" to the search. For example, searching for "dvd reviews" leads to many informative links.. the top one being "dvdreview.com".
The second complaint they have is about searches operating on synonyms of what you are searching for rather than what you actually want. Their example: Search for "apple" on Google, and you have to troll through a couple pages of results before you get anything not directly related to Apple Computer?and it's a page promoting a public TV show called Newton's Apple. After that it's all Mac-related links until Fiona Apple's home page. You have to sift through 50 results before you reach a link that deals with apples that grow on trees: the home page for the Washington State Apple Growers Association.
This too, is easy enough to get around just by being more specific. Not looking for sites about apple computer, but rather sites about the apple fruit? Just search for "apple fruit".
Their last few points give some insight into what they are actually trying to claim with the article. They are not saying that google is "bad", but rather that the idea of google being an objective impartial window into the web is flawed, because while google itself might be impartial, its algorithms are skewed by the biases inherent inherent populace, which affed the hyperlink patterns on the web that google uses for its search heuristics.
This is a valid point, but it is not a very useful one, because there is really nothing else that does better for general searches. Google is far and ahead of any of the other general search engines. Not to say that google is the best for searching for anything - for many resources, a more specific, niche search engine might do what you want. If you're searching for research publications in biology, PubMed might be a better idea than doing a general search on Google. For general searches, however, Google is king.
The main thing is, google has the pulse of the internet. It has a general sense of what content on the internet is geared towards, and it reflects that in its searches. Searching for "eclipse" leads to the JIBM Eclipse page, not a page on solar eclipses. Searching for "apple" leads to apple-computer related pages, not to apple-fruit related pages.
This problem is inherent in human relations too. If you approach an elderly woman and tell her "I bought an apple today", she would probably interpret it differently than, say, a friend in your fellow CS program at university. The woman might respond with "what? Granny smith?", while the CS student might respond with "A laptop or a desktop?".
In human converstaions we get over these ambiguities by adding context. If you were actually talking about buying a fruit when I was talking to the CS student, I might qualify my statement with.. "no, I mean the fruit". This technique works just as well in google.. and it's what people have been using to disambiguate communication in real life for millienia:)
-Laxitive
I had the pleasure of going to a Q&A session with Djikstra hosted by our university CSClub. It was interesting - he talked about shortest path, algol, and a whole bunch of other stuff.
One of the major points he made before he left, and somewhat adamantly at that, was that software is so poor in quality nowadays because developers don't really bother to come up with formal proofs of correctness for their programs.
There was some back and forth from the audience on this point, with people wondering wether it was feasible for large pieces of software (e.g. OS kernels) to be proven, because of their size and complexity. He didn't seem to think that it should really be a problem, and attributed the lack of correctness proofs to laziness on the part of programmers.
System recovery (using distributed backups over the lan), hardware autodetection, an installation blog
Yes, an installation blog is CRUCIAL. What's the point of installing debian if you can't blog it in excruciating detail right next to your much vaunted movie reviews, and internationally recognized kitten-jokes.
Ok, sorry, I had to.
-Laxitive
I recently started working at a bioinformatics position as well, coming from a pure CS background. I havn't learned enough of the biology side of things to really get into much more than tool support for distributed sequence analysis toolchains, but what the hell, might as well comment.
One thing I want to say before responding to your points: nature is _NOT_ "efficient" like computers are "efficient". Natural systems are enormous, ad-hoc, kludges. They work extremely well, and have tons of redundancy and fault-tolerance, but that's mainly due to about 4-billion years of slow, brutal, optimisation by the evolutionary process. Natural systems do certain things faster than computer systems because:
1. They've been optimised for a hell of a long time, and they've found ways to engineer and construct extremely complicated structures and processes that are still "small" (compared to modern human-engineered technology).
2. They've been allowed to search through a much larger solution space than what computers have searched through. Computers are inherently limited by the fact that they are tools which can still be reconciled for a large part with human reason - they were constructed using models that humans can understand and reason about, and explain fully from the start. Evolution, on the other hand, is much more of a blind search.
Another thing to note is that natural systems all try to solve one problem: existence and self-perpetuation. All the natural systems we are able to observe today exist because they are structured such that they can fulfill these basic requirements. Now, in the process of solving this single-minded problems, nature has managed to come up with solutions for many other problems - many of which can be borrowed and applied to human problems. But it's erroneous to think of nature as "god's textbook of problem-solving", or anything like that.
> In the long run, will biology rewrite computing or will > modern day technology concepts and theory be > integrated into biology? If both are true, which will have > the greater effect? I understand long run is ambiguous in > this question, but Iâ(TM)m interested in all thoughts using any > applicable definition.
There are two aspects to this - borrowing ideas from biology (i.e. reimplementation), and borrowing biological structures themselves (e.g. using bacteria to make enzymes, viruses as delivery vectors for drugs, growing muscle tissue for robot-locomotion, etc.). Both are happening to a certain extent.
I think it'll be a while yet before we will be able to jump into biological systems and "change the code to do what we want". We do it in really primitive, crude ways right now, but the level of complexity of biological systems, I think, will mean that it'll take time before we are able to fully control them.
>Tied to the first question: How will the nature of > computing, and how we perceive it, change due to > biology integration? More to the point, how much of the > theory we learn today may change?
I don't think biology will change theory that much. CS theory comes from the human reasoning process. I don't think there are that many abstract concepts that we can extract out of biological systems. I think the real impact will be in engineering aspects - mimicing, or reusing wholesale, biological structures to acheive the properties that we want.
> What will be the biggest issue determining the success > of the adoption of biology-integrated computing? Will it > be technology factors or will it be societal factors (e.g., > rebellion by the Right Wing), or something else? What > things must hold true to make the idea succeed?
Forget the right wing. They make a lot of noise, but ultimately they are not that powerful, especially in the capitalist west. The religious conservatives are used as a tool to get votes, by pandering to their pet causes, but once people figure out a w
I thought of something similar to this when trying to come up with a good spellchecking algorithm back in high school. To provide a simple example, we can start with trying to spellcheck binary strings. We can start off naively, representing each "word" as a point in a two-dimensional vector space over the field Naturals (N x N). Each word occupies a point in the space, calculated by summing the 1s and 0s in the word. "101000110" would occupy point (5, 4) - five 0s, four 1s. So given a misspelled word (let's say "101001110").. we first calculate that word's position in the vector space (in this case (6, 4)), and do a geograhic search for neighboring words. Just taking the sums of the different letters in the word for different domains keeps closely-spelled words together, but it also maps other, highly less likely words to the same (or close) point in the vector space. For example: "101111001000" and "010000110111" would map to the same point.. although it's unlikely that one would be trying to type one and accidentally type the other (unless the typer was dyslexic or something.. in which case the spellchecker doesn't really have to care). So we need something that gives a bit more information than simply positioning the word on a 2-dimensional vector space. So we can notice that often, similar words have similar sequences of letters, as well as a similar sum total of letters. I.e., the number of times a particular number "0" or "1" occurs after either a "0" or "1". For example in "10011101" and "10011001". The number of "0"s followed by "0"s is 1 in the first, 2 in the second. The number of "0s" followed by "1s" is 2 in both. The number of "1s" followed by "0"s is 2 in both, and the number of "1"s followed by "1"s is 2 in the first, 1 in the second. So the words would map to points (1, 2, 2, 2) and (2, 2, 2, 1) respectively, in the 4-dimenstional vector space over the Naturals (N x N x N x N). The distance between these two points, is sqrt(2).. which is pretty close. We can combine the first approach and the second, and for each misspelled word, do a search for other words in both the 2D space and the 4D space, and allow all words within a certain distance threshold that are present in both spaces near the misspelled word. Potentially you could extend the spaces out so that you consider 3 consecutive letters (an 8D space for binary strings).. but as the dimensions get higher, you have to put more work into optimizing the searches. If we move from binary strings to actual english words, it's not a 2D and 4D space anymore.. but a 26D and 676D space. But it's possible to come up with some nice sparse data structures that let you make searches reasonably efficient in both space and time.
I'm not exactly sure why I'm posting this.. but I blazed last night and the shit was good.. but my coat got stolen.. and I've got cobwebs this morning.. and I tend to think of CS things a lot when I have cobwebs in my mind after a night of battling the green ninja.
*Note* Don't read on if you havn't watched the end of the show.
It's not that the ending would be sad.. but that it would leave certain things to the viewer, instead of resolving it all in an nice little package and presenting it.
The fundamental issue being addressed is wether Vash's philosophy, which he has adopted from Lem, is feasible. And I don't think that the show's producers (let's leave the manga alone for a sec), have a good basis for saying "philosophy A" is the correct way of going about it.
It seems to trivialise the issue a bit. Vash confronts this grosse moral decision, and then in two episodes' time, rebounds to back to kick some ass and spread love and peace again. I thought the ending was a bit frivolous.
The end is not anticlimactic at all.. well, if you consider the show's end to be episode 24. I kind of mentally erase the last two episodes. Ep24 makes a much better ending for the series than the real ending.
It doesn't resolve all the issues, but leaves it up for the viewer to decide where they stand on the primary issue that's been presented in the show from the beginning.
Actually, marijuana is not a north american plant. It was used in China and India more than a thousand years ago.
The native american's main contribution was the concept of smoking it, as opposed to brewing or chewing.
The concept of smoking a plant to deliver chemical to the brain comes from tobacco. This custom may have come from another plant called sweetgrass. Sweetgrass is a grass that grows wild in north america, and releases a sweet scent when burned. It also has chemicals with psychoactive properties.
It's known that native americans burned sweetgrass in bonfires due to it's sweet smell. It's possible that they noticed it's hallucinogenic effects, and decided to apply the same method of consumption to tobacco, which they already knew provided certain mental effects when eaten.
And then when the colonists came, the concept of smoking as a way of taking in chemichals spread to the rest of the world.
This may be wrong, but it's my hypothesis. I havn't done much research into the origins of smoking.
This book probably has some insights to offer for a lot of people.
I think the first thing to take away from this book is that to build a successful business, you do NOT have to "revolutionize the world". The vast majority of successful businesses don't fundamentally change the way you or I live. They are successful not because they've done something that no-one's thought of before, but because they put effort into scoping out the market, keeping track of accounting, figuring out the logistics of where the money is going to come from and where it's going to go, and good marketing.
Want an example of a completely mundane, yet extremely successful company?
go here
They aren't revolutionary, they don't change culture or society, they don't bring people together. They make damn good tupperware (and other stuff).
-Laxitive
I understand where you're coming from. And you have a point.
And just as a note, I'm the kind of person that would get dismissed as commie left wing whacko by most Americans, and a Canadian to boot.
But let's give credit where credit is due. The Americans were crucial in revitalizing, and bringing to the fore, the concept of democracy in the modern world. The US has done a lot of horrible things in the name of democracy, and in the name of freedom, from the distant past to the present. There is a fundamental conflict in the US between the principles that they want to hold themselves to, and their inherent desire to be prosperous and powerful. This leads to a lot of hypocrisy.
However, this does not detract from the fact that the concept of the modern democratic state derives largely from the American example. This is partly because they are powerful enough to project it across the world, but also because Americans have a fundamental need to see themselves as good people living by just rules. Double standards and hypocrisy is human nature.. as is abuse of power.
That doesn't mean that Americans are worthless. We should understand them for what they are - their faults and their strengths.
-Laxitive
I love Bradbury. He's one of my favourite scifi (and other stuff) authors. It's not that he's a good science fiction author - he's a good author period (read some of his non-scifi stories - The Wonderful Ice-Cream Suit, A Medicine for Melancholy).
The thing about Bradbury is that what he focuses on is not the science, but more the social aspect of humanity. He writes about people, not spaceships.
For example, some of the earlier short stories use SciFi as backdrop against which to express more immediate social concerns. There are stories in which a population of black people build their own rocket, and quietly depart for Mars, where they can live in peace.
In the context of the civil rights movement and equality rights, this is a powerful and strong statement. It strongly reflects the simple sentiment that these people just want to be left alone to live their lives in peace.
Bradbury is a wonderful and imaginative author. He was a large influence on my views and perspectives. What he beleives and says deserves respect - because he is a respectable man.
-Laxitive
Well, thanks for asking :)
About bioinformatics.. I would definitely recommend it. The connection with CS depends on what you mean. There are applications for both theoretical work and more applied programmatic work in bioinfo.
For CS people, bioinformatics starts with sequence data (coming from sequencers). The scientists and biologists generate some sequence data, and ask you to help them find out as much as possible about it. The ultimate goal of bioinformatics is to make it seamless and easy to go from raw sequence data (e.g ACTACGATCGTAAAGCATCGATCGAT) to a more useful functional description of what that sequence represents (what protein does it synthesize? What bilogical processes is that protein involved in? etc.)
The field is pretty young.. biologists have only recently figured out that computers can take care of a lot of the gruntwork for them. There are some pretty sophisticated tools in the business (phred/phrap, lucy, blast, interpro, crossmatch, clustal, etc.) to handle various different computations to do. However, there's very little in the way of standardized formal models, or communication methods, which deal with the field.
Most research groups end up using what tools are already available, but writing their own ad-hoc tools to put them all together into a pipeline that does what they want. As a CS person, it's immediately noticeable that there is a lot of potential for how to apply computational resources to greatly improve the state of the field.
I'm not at all educated on the biology side of things.. but I'm learning as I go. The thing is, the bioinformatics field is _hurting_ for people that have both good CS and Bio backgrounds. They are rare, and extremely useful - because they're the people that can both identify problems on the biology side of things, and then attempt solutions on the CS side of things.
It's a lucrative field.. but it requires a lot of study. At least bachelors in CS, and a degree (preferably masters of PhD) in an area of biology, will take you a _long_ way in this field. I have the CS knowledge.. I'm thinking I might go back to school at some point to get a Bio degree. I just graduated from school, though, so I don't feel like going back anytime soon.. but sometime in the future, maybe.
The work is pretty interesting too, if you're of that mindset.
-Laxitive
Well, I havn't spent 5 years on VMs, but I'm interested in them.
I've worked at a company writing code to handle different targets for a retargetable C compiler for a while. Aside from that, no. Most of what I know about VMs, I generally pick up from books and papers and just thinking about different problems for long periods of time.
I wouldn't consider myself _that_ knowledgeable with VMs.. because I havn't done much actual work in that area. I tried for a while when I was in school.. but now I'm working in bioinformatics, and I don't really see myself switching away from it anytime soon.
Bullshit. He is as cool as he thinks he is.
Knowing good math.. makes you a better programmer. I would go as far as to say that computer science _is_ math. Knowing how to hook up a DB to a web front-end is not computer-science. It's a trade skill, like plumbing.
The difference between some web-scripting guy, and a guy who knows CS, is like difference between an automechanic and an automotive engineer. The engineer might not be able to fix your engine, but he understands the workings of it much better than your average mechanic.
From my perspective, being some random code-monkey is not too different from working at McDonalds. Pay might be better, but the work is still shit. Having a solid CS grounding lets you work in places and on problems that are actually _interesting_ and challenging. It allows you to actually contribute something new to the body of knowledge associated with computation.. or apply it well to some novel field.
I can pick up and learn a new language or API given a few months. It would take years of focused study for a random PHP programmer to acquire the knowledge I have.
Not to say that I'm special or anything.. but I've spent 5 years working my ass off to get myself to a proficient level in this area of study.. and most people who want to reach that same level will also have to spend several years doing it. It's just a question of wether you decide to do it early in your life (university), later in your life, or not at all.
But it's definitely worth it.
-Laxitive
You seem to have anger problems, mister. I'd get that checked out.
I don't know. ATRAC support is in a lot of products - most notably sony minidisc players. I'm not sure how high the adoption rate for minidisc is as opposed to iPods, but they've been around for a lot longer than ipods have.
I'm curious about what kind of DRM is there as well. I know SonicStage is supposed to interact with windows DRM in some capacity, not sure why.
My main problem with this is SonicStage. Can't get it working under wine (because of aforementioned windows DRM integration). And even in windows it's a PIECE OF FUCKING ASS CRAP FUCKING SHIT software. I feel like blowing a hole in a sony executive's skull and urinating inside his brain cavity every time I use that piece of shit.
I own a NetMD.. the hardware is pretty well-engineered, but it doesn't come close to compensating for the pure hate that is SonicStage.
Fuck sonicstage. Fuck sony.
-Laxitive
Man, and here I am writing my own little VM for a prototype OO system.. seems to be all the rage nowadays :D. I'm liking the recent trends of languages evolving to use simpler and simpler higher level semantics. I am a fan of smalltalk and self, but not their syntax. Their language environment and semantics, though, are worth pursuing.
One of the reasons I like prototype OO (specifically, delegation-based prototype OO, as opposed to languages that use embedding), is that a lot of _other_ dynamic language models fit well on top of it. For example, it would be very simple to make a Python -> Self compiler, because constructs that self exposes can be used directly to implement more specific class-oriented pythonic constructs. It leads me to beleive that a prototype-oo oriented base-vm can serve as a good abstract platform environment for several dynamic 'scripting' languages.
I'm not sure about the multiple dispatch though. I think multi-dispatch can be confusing.. especially in languages like these where the notion of runtime types is muddled quite a bit of the time.
-Laxitive
Dude, you can't assume somebody doesn't know what they are talking about just because they don't have some certificate of formal education. Jesus, I've been through CS at a "good" university, and there's nothing I see there that precludes somebody getting a good grasp on it on their own.
-Laxitive
I'm just curious, but did you consider suing the city for abuse? People have extracted million dollar settlements out of less than getting a nose broken.
If what you say is what happened, then you got fucked over by the system good. If I was in your case, I would have have felt no remorse about talking to a lawer and suing.
Well, personally, I would also have visited the girl's house and taken a baseball bat to her parents' car.. but I have a vicious vindictive streak -- As a child I got bullied quite a bit in school. One summer when one of them pushed me just a bit too far (a _hard_ punch to the stomach for no reason), I jumped up and sank my teeth into his back and extracted a sizable chunk of flesh from his back. I got in a lot of trouble for it, but just the pure pleasure of hearing that motherfucker scream and bawl like a child and hit the floor, made it all worthwhile.
Fuck, your story has made me very angry. People like the chick you were talking about, need to get their comeuppance in a very bad way. It's annoys me that the real world is not like that
Anyway, I empathize with you.
-Laxitive
legal p2p and legal mp3 distribution?
I'm sorry, this argument is brought up a lot, but doesn't hold water.. stinks of the pedophile that claims "It's not about fucking nine year olds, it's about enjoying the natural beauty of children".
What do you think gets shared on p2p? Do-it yourself standup comedy routines? Independent music?
The amount of independent music on p2p networks is vanishingly small. Sure, it may go up in the future, but let's not blink innocently and talk about how p2p is an "independent music haven".
The vast majority of things that get shared on p2p networks fall into one of three categories: ripped music, ripped movies, and porn.
I'm not against p2p networks. I think it's a good thing that they're putting the fire to the feet of the greedy fucks that rip us off so that we can enjoy the "privilege" of listening to music. But let's at least admit a certain amount of intellectual honesty.
-Laxitive
Fucking tories :(
-Laxitive
Well, MS wouldn't have to do much to topple our CS deparment's Unix environment, considering how sadly outdated it is.
;)
:) Currently on work term, but heading back on Sept 1. What program are you in btw?
I get depressed every time I log into bacon
The administration is doing a pretty good job of selling out the CS program there even without Microsoft's help (e.g. Faculty of Computer Science "Let's not bother with all of this hard 'math' stuff for our poor CS students").
Anyway, what can you say, it's still probably one of the few halfway decent CS programs in the country.
Yeah, I'm a student there
-Laxitive
Oh yeah.
I dislike the company, but there are some really cool, nifty, interesting things, technologically, that disney does.
One of my favourite examples - The core development team of Squeak smalltalk is resident at Disney. Smalltalk hackers are a cool bunch. And yes, Squeak is open source.
Anyway, I'm sure there are many cool nerds at Disney.
-Laxitive
They are mistaken, or making assumptions, when they make many of their complaints.
.. "no, I mean the fruit". This technique works just as well in google.. and it's what people have been using to disambiguate communication in real life for millienia :)
-Laxitive
It's quite easy to tailor keywords searches in google.
Their first complaint is that many searches yield shopping sites as results instead of informational sites. Not surprising, since a lot of traffic on the internet is commercial. But it is easy enough to fix.
For example, in their article, they quote:
Search for "flowers," and more than 90 percent of the top results are online florists.
True. However, search for "growing flowers" or "flowers gardening" or "flowers gardening tips", and you are immediately led to pages which focus on what you are looking for.
Also:
The same goes for searching for specific products: Type in the make and model of a new DVD player, and you'll get dozens of online electronic stores in the top results, all of them eager to sell you the item. But you have to burrow through the results to find an impartial product review that doesn't appear in an online catalog.
If you are searching for reviews of products, just add "review" to the search. For example, searching for "dvd reviews" leads to many informative links.. the top one being "dvdreview.com".
The second complaint they have is about searches operating on synonyms of what you are searching for rather than what you actually want. Their example:
Search for "apple" on Google, and you have to troll through a couple pages of results before you get anything not directly related to Apple Computer?and it's a page promoting a public TV show called Newton's Apple. After that it's all Mac-related links until Fiona Apple's home page. You have to sift through 50 results before you reach a link that deals with apples that grow on trees: the home page for the Washington State Apple Growers Association.
This too, is easy enough to get around just by being more specific. Not looking for sites about apple computer, but rather sites about the apple fruit? Just search for "apple fruit".
Their last few points give some insight into what they are actually trying to claim with the article. They are not saying that google is "bad", but rather that the idea of google being an objective impartial window into the web is flawed, because while google itself might be impartial, its algorithms are skewed by the biases inherent inherent populace, which affed the hyperlink patterns on the web that google uses for its search heuristics. This is a valid point, but it is not a very useful one, because there is really nothing else that does better for general searches. Google is far and ahead of any of the other general search engines. Not to say that google is the best for searching for anything - for many resources, a more specific, niche search engine might do what you want. If you're searching for research publications in biology, PubMed might be a better idea than doing a general search on Google. For general searches, however, Google is king. The main thing is, google has the pulse of the internet. It has a general sense of what content on the internet is geared towards, and it reflects that in its searches. Searching for "eclipse" leads to the JIBM Eclipse page, not a page on solar eclipses. Searching for "apple" leads to apple-computer related pages, not to apple-fruit related pages. This problem is inherent in human relations too. If you approach an elderly woman and tell her "I bought an apple today", she would probably interpret it differently than, say, a friend in your fellow CS program at university. The woman might respond with "what? Granny smith?", while the CS student might respond with "A laptop or a desktop?". In human converstaions we get over these ambiguities by adding context. If you were actually talking about buying a fruit when I was talking to the CS student, I might qualify my statement with
I had the pleasure of going to a Q&A session with Djikstra hosted by our university CSClub. It was interesting - he talked about shortest path, algol, and a whole bunch of other stuff.
One of the major points he made before he left, and somewhat adamantly at that, was that software is so poor in quality nowadays because developers don't really bother to come up with formal proofs of correctness for their programs.
There was some back and forth from the audience on this point, with people wondering wether it was feasible for large pieces of software (e.g. OS kernels) to be proven, because of their size and complexity. He didn't seem to think that it should really be a problem, and attributed the lack of correctness proofs to laziness on the part of programmers.
It was an interesting talk.
No point to this post, really.
-Laxitive
System recovery (using distributed backups over the lan), hardware autodetection, an installation blog
Yes, an installation blog is CRUCIAL. What's the point of installing debian if you can't blog it in excruciating detail right next to your much vaunted movie reviews, and internationally recognized kitten-jokes. Ok, sorry, I had to. -Laxitive
I recently started working at a bioinformatics position as well, coming from a pure CS background. I havn't learned enough of the biology side of things to really get into much more than tool support for distributed sequence analysis toolchains, but what the hell, might as well comment.
One thing I want to say before responding to your points: nature is _NOT_ "efficient" like computers are "efficient". Natural systems are enormous, ad-hoc, kludges. They work extremely well, and have tons of redundancy and fault-tolerance, but that's mainly due to about 4-billion years of slow, brutal, optimisation by the evolutionary process. Natural systems do certain things faster than computer systems because:
1. They've been optimised for a hell of a long time, and they've found ways to engineer and construct extremely complicated structures and processes that are still "small" (compared to modern human-engineered technology).
2. They've been allowed to search through a much larger solution space than what computers have searched through. Computers are inherently limited by the fact that they are tools which can still be reconciled for a large part with human reason - they were constructed using models that humans can understand and reason about, and explain fully from the start. Evolution, on the other hand, is much more of a blind search.
Another thing to note is that natural systems all try to solve one problem: existence and self-perpetuation. All the natural systems we are able to observe today exist because they are structured such that they can fulfill these basic requirements. Now, in the process of solving this single-minded problems, nature has managed to come up with solutions for many other problems - many of which can be borrowed and applied to human problems. But it's erroneous to think of nature as "god's textbook of problem-solving", or anything like that.
> In the long run, will biology rewrite computing or will
> modern day technology concepts and theory be
> integrated into biology? If both are true, which will have
> the greater effect? I understand long run is ambiguous in
> this question, but Iâ(TM)m interested in all thoughts using any
> applicable definition.
There are two aspects to this - borrowing ideas from biology (i.e. reimplementation), and borrowing biological structures themselves (e.g. using bacteria to make enzymes, viruses as delivery vectors for drugs, growing muscle tissue for robot-locomotion, etc.). Both are happening to a certain extent.
I think it'll be a while yet before we will be able to jump into biological systems and "change the code to do what we want". We do it in really primitive, crude ways right now, but the level of complexity of biological systems, I think, will mean that it'll take time before we are able to fully control them.
>Tied to the first question: How will the nature of
> computing, and how we perceive it, change due to
> biology integration? More to the point, how much of the
> theory we learn today may change?
I don't think biology will change theory that much. CS theory comes from the human reasoning process. I don't think there are that many abstract concepts that we can extract out of biological systems. I think the real impact will be in engineering aspects - mimicing, or reusing wholesale, biological structures to acheive the properties that we want.
> What will be the biggest issue determining the success
> of the adoption of biology-integrated computing? Will it
> be technology factors or will it be societal factors (e.g.,
> rebellion by the Right Wing), or something else? What
> things must hold true to make the idea succeed?
Forget the right wing. They make a lot of noise, but ultimately they are not that powerful, especially in the capitalist west. The religious conservatives are used as a tool to get votes, by pandering to their pet causes, but once people figure out a w
I thought of something similar to this when trying to come up with a good spellchecking algorithm back in high school. To provide a simple example, we can start with trying to spellcheck binary strings. We can start off naively, representing each "word" as a point in a two-dimensional vector space over the field Naturals (N x N). Each word occupies a point in the space, calculated by summing the 1s and 0s in the word. "101000110" would occupy point (5, 4) - five 0s, four 1s. So given a misspelled word (let's say "101001110").. we first calculate that word's position in the vector space (in this case (6, 4)), and do a geograhic search for neighboring words.
Just taking the sums of the different letters in the word for different domains keeps closely-spelled words together, but it also maps other, highly less likely words to the same (or close) point in the vector space. For example: "101111001000" and "010000110111" would map to the same point.. although it's unlikely that one would be trying to type one and accidentally type the other (unless the typer was dyslexic or something.. in which case the spellchecker doesn't really have to care).
So we need something that gives a bit more information than simply positioning the word on a 2-dimensional vector space. So we can notice that often, similar words have similar sequences of letters, as well as a similar sum total of letters. I.e., the number of times a particular number "0" or "1" occurs after either a "0" or "1". For example in "10011101" and "10011001". The number of "0"s followed by "0"s is 1 in the first, 2 in the second. The number of "0s" followed by "1s" is 2 in both. The number of "1s" followed by "0"s is 2 in both, and the number of "1"s followed by "1"s is 2 in the first, 1 in the second. So the words would map to points (1, 2, 2, 2) and (2, 2, 2, 1) respectively, in the 4-dimenstional vector space over the Naturals (N x N x N x N). The distance between these two points, is sqrt(2).. which is pretty close.
We can combine the first approach and the second, and for each misspelled word, do a search for other words in both the 2D space and the 4D space, and allow all words within a certain distance threshold that are present in both spaces near the misspelled word. Potentially you could extend the spaces out so that you consider 3 consecutive letters (an 8D space for binary strings).. but as the dimensions get higher, you have to put more work into optimizing the searches. If we move from binary strings to actual english words, it's not a 2D and 4D space anymore.. but a 26D and 676D space. But it's possible to come up with some nice sparse data structures that let you make searches reasonably efficient in both space and time.
I'm not exactly sure why I'm posting this.. but I blazed last night and the shit was good.. but my coat got stolen.. and I've got cobwebs this morning.. and I tend to think of CS things a lot when I have cobwebs in my mind after a night of battling the green ninja.
-Laxitive
Sweet! I am SO down with that.
-Laxitive
*Note* Don't read on if you havn't watched the end of the show.
It's not that the ending would be sad.. but that it would leave certain things to the viewer, instead of resolving it all in an nice little package and presenting it.
The fundamental issue being addressed is wether Vash's philosophy, which he has adopted from Lem, is feasible. And I don't think that the show's producers (let's leave the manga alone for a sec), have a good basis for saying "philosophy A" is the correct way of going about it.
It seems to trivialise the issue a bit. Vash confronts this grosse moral decision, and then in two episodes' time, rebounds to back to kick some ass and spread love and peace again. I thought the ending was a bit frivolous.
-Laxitive
The end is not anticlimactic at all.. well, if you consider the show's end to be episode 24. I kind of mentally erase the last two episodes. Ep24 makes a much better ending for the series than the real ending.
It doesn't resolve all the issues, but leaves it up for the viewer to decide where they stand on the primary issue that's been presented in the show from the beginning.
-Laxitive
Actually, marijuana is not a north american plant. It was used in China and India more than a thousand years ago.
The native american's main contribution was the concept of smoking it, as opposed to brewing or chewing.
The concept of smoking a plant to deliver chemical to the brain comes from tobacco. This custom may have come from another plant called sweetgrass. Sweetgrass is a grass that grows wild in north america, and releases a sweet scent when burned. It also has chemicals with psychoactive properties.
It's known that native americans burned sweetgrass in bonfires due to it's sweet smell. It's possible that they noticed it's hallucinogenic effects, and decided to apply the same method of consumption to tobacco, which they already knew provided certain mental effects when eaten.
And then when the colonists came, the concept of smoking as a way of taking in chemichals spread to the rest of the world.
This may be wrong, but it's my hypothesis. I havn't done much research into the origins of smoking.
-Laxitive
This book probably has some insights to offer for a lot of people. I think the first thing to take away from this book is that to build a successful business, you do NOT have to "revolutionize the world". The vast majority of successful businesses don't fundamentally change the way you or I live. They are successful not because they've done something that no-one's thought of before, but because they put effort into scoping out the market, keeping track of accounting, figuring out the logistics of where the money is going to come from and where it's going to go, and good marketing. Want an example of a completely mundane, yet extremely successful company? go here They aren't revolutionary, they don't change culture or society, they don't bring people together. They make damn good tupperware (and other stuff). -Laxitive
You're wrong about one thing: the USPS does not drain your taxes. It is actually a profitable government agency (yes, I know, hard to beleive).
-Laxitive