Slashdot Mirror


User: Dambiel

Dambiel's activity in the archive.

Stories
0
Comments
33
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 33

  1. Re:Not pointless at all... on Cab Hailing Service Uber Collected Just $9M of Fares During 15 Months In Boston · · Score: 3, Informative

    American here. Filing suit for a taxi that never showed is a bit much but having been in that position I can understand the anger. Sometimes it's necessary to read "sue" as an American idiom for "Grrrr, I'm really mad and they should have done better."

    That said, these crazy new-fangled smartphone app taxi services show me exactly who's coming to pick me up and how far away they are. That's a big step up from "we'll send someone as soon as they're available".

    Voting with your dollars (euros, whatever) and putting them towards a better service will ultimately make a big difference. But, wait! Are you going to find another company to provide a taxi or file a complaint with regulators (generally run by livery companies in the US) (it's a problem, we know) while you're waiting for that cab who's taken another fare and won't be coming to pick you up after all?

    It's probably best not to think of uber, sidecar, lyft, etcetera as taxi companies. They're providing a marketplace for that kind of service. Folks that don't play nice (cabbies who don't show and customers too drunk to sit without vomiting) get weeded out.

  2. Amazon's is hardly a comparable business model so we'll look past that straw man. Uber is already profitable in most cities so, as a business, it kinda makes sense.

    Don't know where you're from but having recently moved to San Francisco from Boston it's not very likely in either city that you'd be able to hail a cab on the street save for at major transit stations. The value of this kind of service is to get a ride quickly, easily, and with a reasonable expectation for the level of service provided. Here in SF it's cheaper to use uberX (their not-a-black-towncar service) than a taxi for anything more than a couple blocks. Sure, Manhattanites south of 110th can live their whole lives without considering Uber but I've found it quite useful.

  3. Re:It seems that on Cab Hailing Service Uber Collected Just $9M of Fares During 15 Months In Boston · · Score: 3, Informative

    1) Currently in San Francisco uberX (their lower-cost, non-town-car service) is cheaper than a yellow cab and, unless you live at a Caltrain or BART station, far easier to find.

    2) If you were to reserve a ride with a cab company directly there's very little accountability for how long it will take to get a pick-up. All of these apps let you to see where your driver is while en-route and allow you to give feedback regarding the level of service received.

    That adds a lot of value for me on top of the fact that I don't have to wait on hold.

  4. Re:It depends on what you have and what you need on Ask Slashdot: Node.js vs. JEE/C/C++/.NET In the Enterprise? · · Score: 1

    GC = Garbage Collection? Six times the RAM req's?

    Sounds high but possible, can I get a link or citation on that article? Sounds like a decent read.

  5. Re:Shoudn't really be any question on RIAA v. Santangelo Default Judgment Vacated · · Score: 2, Informative

    I agree that $45/month is a steal to have what amounts to a lawyer on retainer, especially if you have considerable assets to protect.

    But, the middle class earning $55k to $170k? That seems high. Earning $170k puts you around the 95th percentile for household income, squarely in the upper class. $55k is about the 60th percentile, and I'm sure you don't mean to say that 60% of the U.S. is poor.

    Households in the middle quintile have incomes between $36,000 and $57,657. (http://en.wikipedia.org/wiki/Household_income_in_ the_United_States)

  6. Re:Hmm... some errors in the article on Massive Graphics Card Review · · Score: 1

    BFG overclocks their boards. Because the perceived risk in this they warranty them for life. 350MHz is standard for the GT, 370MHz is what BFG runs the card at.

    Check out the product description

  7. Software???? on Nokia Announces Hard-Drive Phone · · Score: 1

    I use iTunes, but I've never bought any music from apple. Instead I have a bunch of CDs because its an open format (yes, I know it supports the evil RIAA a little more than buying through apple).

    Does nokia have a software backend to this thing that will make me want to use my music in this thing? I don't think I'm alone in my distaste for separate music apps for playing music in my home versus on my portable music player.

  8. more than meets the eye on USS Ronald Reagan Commissioning Tomorrow · · Score: 5, Interesting
    From "The Carrier Reagan - Ahead of Its Class" (emphasis mine)
    After the next carrier, the George H.W. Bush, the Navy intends to unveil a new design; it will be roughly the size of a Nimitz-class ship but with automated systems that could cut the ship's company of 3,200 by one-third or more and a new reactor able to power electromagnetic catapults and directed-energy weapons .


    Directed energy weapons! what does that mean? High powered lasers? Something else that's super-secret?

    after reading that I half-expected a description of how the next carriers will transform into a gi-normous humanoid robot.
  9. Re:not revealing intellectual property versus GPL on GPL Issues Surrounding Commercial Device Drivers? · · Score: 1

    doesn't this leave us at the same problem we started with?

    you distribute a crippled driver which can work but only when your application does the secret handshake.

    how does this help any interoperability between the hardware and open applications which you don't tell the secret?

    Chris

  10. Re:Needs to review his genetics on Your Genome Scanned While You Wait · · Score: 1

    the information given in the article was in the form of a single strand of DNA's bases, which in turn tells you the other strand.

    SNP's happen on both strands. Regardless the general usage of giving nucleotide listings is to give one strand as it is the smallest set of information from which you can infer the rest.

    I am not saying that the DNA in the article's author has only one strand just that the nomenclature for describing it is to give the bases on one strand, including the polymorphism affecting both strands (which the author does not explain)

  11. Re:Needs to review his genetics on Your Genome Scanned While You Wait · · Score: 4, Informative

    he's talking about single strand bases, not pairing

    say you have:
    TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CG CTTGAACCT

    and I have:
    TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CC CTTGAACCT

    we each have a paired strand that would match them, but the CG/CC difference could still change susceptibility to a disease

  12. Re:G4 800 faster than Athlon 2Ghz?! on RC5-64 Success · · Score: 1

    >Am I missing something here? Are they claiming the 800mhz G4 is over 1.4 times as fast as an Athlon 2ghz??
    >Looks like the writer has been exposed to the "Steve Jobs reality distortion field" for a little too long...

    perhaps, but i think a more likely explanation is that they're using actual data. Doesn't seem highly improbably that differerent architectures could have different performance levels on a highly specialized task

  13. Re:...isn't this type of thing still legal in the on Shake-up At SonicBlue · · Score: 1

    yes and no

    directors are generally large stockholders themselves, so any shareholder vote against them would be skewed in their favor

  14. Re:Returning to the fold. [OT] on New IBM Plant Will Mass Produce .1 Micron Chips · · Score: 1

    >The SEC or the FTC won't go after them; the shareholders themselves can sue.

    The shareholders can sue the company, but that probably not be for the best. They own the company so the suit would be against themselves.

    OTOH they could sue/oust the C*O responsible (for negligence maybe?), but then we're back to two parents ago in the thread.

  15. Re:"For the benefit of humanity" on China Plans Moonbase · · Score: 1

    As long as you're talking about prisons in the U.S., it's probably important to mention the for profit prisons. They often manage to avoid inspection in many cases and are allowed to enforce a variety of compulsory labor activities.

  16. I didn't need another reason... on World's First Hydrogen Fuel Cell Powered Island · · Score: 5, Funny

    but this is just one more reason to drink scotch from Islay.

    It's not only delicious, but environmentally friendly too!

  17. quick oops on Kazaa Admits to Morpheus Shutdown · · Score: 1

    "Confusingly, this had nothing to do with encrypted messages" (also the reg.)

    so i guess my take is:
    Confusingly there isn't conclusive evidence as to what actually happened

  18. help from the reg on Kazaa Admits to Morpheus Shutdown · · Score: 2, Informative

    "As a result of MusicCity's breach, Kazaa BV did not provide version 1.5 to MusicCity. Kazaa has also terminated MusicCity's license." (from the cnet link)

    while TheRegister reports that the plug was pulled bc of attacks on the morpheus network:
    "It appears that the attacks included an encrypted message being repeatedly sent directly to your computers that changed registry settings in your computer," a statement by Griffin to users on the accelerated availability of Morpheus Preview Edition states.

  19. Re:Idea on Florida Surveillance Cameras Claim a Victim · · Score: 1

    if you can manage to sue (let alone breathe) after walking around with a plastic bag over your head, you should consider running for pope 'cuz i think that constitutes your first miracle.

    also, your idea probably infringes on the patent of the halloween costume from an old halloween snl 'consumer probe' (Dan Ackroyd sketch) - the 'Johnny Spaceman' costume also consists of a plastic bag

  20. a new marketing angle? on Pavlovich Jurisdictional Challenge Denied · · Score: 4, Funny

    now if we can just teach warez fanboys good programming, maybe we can tap a whole new market of emerging programmers...

    dude, wanna join our 1337 open-source group?

  21. who woulda thunk on Scrounging for Fun and Profit · · Score: 3, Funny

    research scientists scrounge around for stuff?

    It makes perfect sense, i know a few researchers who go out every weekend to scrounge for some Dewars.

  22. vertigo on Say Here Why Sklyarov Should Go Free · · Score: 1

    with all this arguing about not-a-crime-in-russia, shouldn't-have-come-to-the-US, etcetera, my head is swimming

    lets break it down simply:

    • lets say i go to amsterdam for vacation
    • i smoke marijuana !
    • I come to the USA where marijuana (and the smoking thereof) is illegal

    no matter where i'm from (moscow/boston) i won't get arrested for this. I could go to a police station and tell them i smoked pot in amsterdam and the only thing they could do is hassle me (and maybe give me some D.A.R.E. pamphlets)

    how is Dmitry's case different? no drugs are involved and he apparently pissed someone off in the fbi or doj. anything else?

  23. file under me-too-posts on Universal Manipulator Does Chess · · Score: 1

    hot damn, i was thinking the same exact thing!

  24. He should have been using Windows XP on Legal Challenge to FBI's Keystroke Sniffing · · Score: 1

    Then if the FBI installed a tap on the keyboard, windows would have stopped working because of the hardware change.

    I don't see linux employing privacy invasion countermeasures like this ;-)

  25. hmmm on Funding Software Development Through Bonds · · Score: 1

    so basically this is like sourceforge with money involved. sounds like a very well meant idea which got overly complicated. Sometimes simpler is better, daring venture capitalists seem like a more elegant solution to me (tho maybe harder to find).