Slashdot Mirror


User: Syllepsis

Syllepsis's activity in the archive.

Stories
0
Comments
120
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 120

  1. Compressor / Limiter on Dune Scores Huge Ratings · · Score: 2

    The sound is not actually louder, but in a way it is. A common practice is to use a sound compressor to boost the level, and then a limiter to keep the level below the maximum allowable. This means that explosions and normal conversation will sound just as loud, and so what is really happening in the commercial is that the guy talking about the new car you should have is lifted to the level of the massive explosion you just heard in the TV movie.

    This, when overdone, makes the sound crappy, but allows for all sound to be near the maximum level. In effect, the ads are louder overall, but everything is kept within the threshold of the actual programming.

    I believe that this is used more on late night TV and specialty channels, and less in prime time on the major networks.

    This post is all "as far as I know" so please correct me on technicalities, etc...

  2. Re:Good Business, Bad Hype on Red Hat Closes SF, Office, Lays Off Staff · · Score: 2
    This company is the very def. of a dotcom.

    No, unlike most dotcoms, redhat was in existence and growing with revinue before they went IPO. Most dotcoms start on the VC they make in the IPO. By having hundreds of millions of cash they can affoard to massively upscale operations and take some hits for a few years. Now they are slimming with lots of cash in hand, and it looks like they may have a 50-50 chance of actually making it. In the world of small cap investment, those are very good odds (if they were actually small cap like they should be).

    Just because you don't like linux does not mean that there isnt a market. Investment in companies on the basis of whether you enjoy their products is a horrible mistake that many people make. This includes the people who love linux and bought redhat at $100 a share. It includes people who love windows and bought MS at $100 a share.

  3. Good Business, Bad Hype on Red Hat Closes SF, Office, Lays Off Staff · · Score: 4

    IMO, Redhat is a good $500M operation. They have lots of cash, are doing well with expectations, and are slimming down operations in the post-dotcom-internet-irrationalstockblitz era.

    Investors tend to hate on redhat now because they paid an irrational amount of money for the stock. However, the stock was good but just far to expensive. It is like paying $1000 for a sack of idaho potatoes. They will be great mashed with some roast garlic...Mmmmm. They were not worth the $1000, but they were worth a buck or two.

    The IPO was raised and raised and raised because everyone wanted redhat, and it went through the roof, and it was always an interesting model worth some attention, but a 25B market cap was insane! That is close to GM right now! I think redhat can sell to a small audience, but it won't ever be a 25B dollar operation.

    Target price: $3, and then it gets an ACCUMULATE rating.

  4. No, It isn't theft on Emusic Tracking MP3s On Napster · · Score: 2

    We have something that can control Napster. Let's hope it succeeds - people think they have a right to steal music, and they don't. Just because it's not physical theft, doesn't make it not theft.

    People do not have a right to copy music without permission under the current body of laws designed to compensate artists so that the increased body of art will further the public good. That being said, it is wrong to live under the contract of this society and disregard completely this piece of the contract.

    Unauthorized copying is not ethical under the currently accepted system of artist repayment in the US. However, this is not a universal ethical guideline, and in other places it may not apply. Unauthorized copying is in no wy, shape, or form theft. The artist still has the master locked away for themselves and no one looses access to the artwork (actually the record company owns the work). Stealing an idea is akin to talking away the notebook of secret plans, copying such a notebook is simply unlawful replication, and not theft. The only thing that is possibly lost when an mp3 is downloaded illegally is the monetary compensation which the record company is entitled to by agreed upon US law, and this compensation is only truly lost if the kid had some intention of actually buying the work.

    I am tired of the theft analogy. It was made up by software and record companies trying to sensationalize this entire process. Later society might realize that IP ownership applied to music has been in no way productive to society, esp. considering the downward spiral popular music has made in the last century, from baroque masterpieces and culturally viable folk art, to trite commercial music marketed to the LCD of the 14 year old population, with large stadium concerts (the worst accoustic environment imaginable) in which overpriced tickets result in riot and death.

    Furthermore, as an owner of over 300 legally purchased CDs, I have found that through false promises and illegal trade restrictions, the music industry more of less owes me about $500-$1000. Add to that the piracy surcharge I paid on my blanks I used to copy BSD and Slackware legally. Fair, no?

    You must own stock to actually support these theives.

  5. Re:Why is this bad? on It's Official: MS Office 10 Subscription Version · · Score: 1
    We don't think MS is stupid. We know they are very clever indeed - especially at the business of business models. And the subscription business model is clearly more attractive than the "I'm happy with my Office 2000 and don't feel inclined ever again up pay to upgrade".

    Or '97 like myself. I didn't think that I really needed the new icons.

  6. The first step... on Even More Porn Image Recognition Software · · Score: 2

    Now all we need is advertisement recognition software.

  7. Re:Here is the gene I claim. on Squatting On Life · · Score: 1
    Err...the code is still in beta, and remember that this code is a "published trade secret" so don't go using this information to enhance the protamine p1 gene.

    I know what you people are up to...you can't fool me with your tricks...I will not sell!

  8. Here is the gene I claim. on Squatting On Life · · Score: 2

    So what happens if I or one of my offspring happen to have naturally developed a patented gene through mutation? Does it count as a "clean room" implementation, or due we still owe royalties.

    BTW, better check yourselves for this:

    TAGCTAGCTAGCTTTACAGCTACCGCTAGCTTAGCTGA GCTTCTGATCGATCGAAACGATCAGCTGATCGGCTAGCTTA GGCTTAGCTAGCTTAGCGAGACTAGCGATCGACTAGGCGCG CTAGCGGCTAGCTATTATTATATGCGGCCTTAATAGAGAGG AAATATCGACTGACTACTAGCTACGCGCGTACGCT

    because this source code was developed by me just now, is copyright by me, and any unauthorized duplication of this code through sexual reproduction, mitosis, or other means is STRICTLY PROHIBITED.

  9. Copyright Law on IDSA Goes After Abandonware · · Score: 3
    Copyright law was designed only to allow authors compensation for their works. Obviously, the spirit of the law is entirely absent in this case, and what I cannot figure out is why the authors and companies can possibly care about abandonware.

    The only reason I can see is force upgrading, which is a bizzarre thing to happen in gaming. Perhaps a law stating that you loose your copyright after 3-5 years of not selling your work would be in order.

  10. Re:Actually, he has a point on MS To Virginia Beach: Prove You Own Your Software · · Score: 1

    There are two points on which I concede MS-Windows is superior to Linux. The first is hardware support. The second is installation ease. Which is easier, to follow the procedure you mentioned, or to double-click on "setup.exe"?

    This is entirely true, windows is much, much easier. However, I wish to remain in the outdated old linux crowd where everyone knew that linux was *NOT* for everyone and no one cared about ease of use.

    BTW, have you ever used kdevelop? The KDE/Qt libraries are much better than Microsoft's MFC for GUI programming, that's why I have abandoned MSVC. However, configuring kdevelop to use different versions of the libraries is a real piece of shit.

    No, I only program for mathematical work in n-dimensions, so graphics are pretty much useless to me, although they would be fun to learn.

  11. Re:Read this - You need the full story. on More Candidate Answers - Bush and Hagelin · · Score: 1
    Considering that you had no links to any other report other than the one written by some kid at PSU, we'll look at just this one.

    From the report you linked to: about effects of Cannabis: Psychomotor impairment. Synergism with alcohol and sedatives. Apathy and mental slowing, impaired memory and learning (brain damage?). Impaired immune response?

    Only One report? I linked to four and gave a reference to a fifth. Brain damage in that report is listed as brain damage. Lets put this into perspective by listing the effects of alcohol from the same report:

    Psychomotor impairment, impaired thinking and judgment, reckless or violent behavior. Lowering of body temperature, respiratory depression. Hypertension, stroke hepatitis, cirrhosis, gastritis, pancreatitis. Organic brain damage, cognitive deficits. Fetal alcohol syndrome. Withdrawal effects: shakes, seizures, delirium tremens.

    Now, I think that makes marijuana look like a walk in the park. Do you wish to go back to alcohol prohibition?

    Nt only that, but the brain damage part was a guess on the part of the PSU student, who was expositorily gathering all suggested effects. If you had read the article concerning long term cognitive damage, you would see that those fears are largely laid to rest. Most of the speculation of cognitive damage comes from a report showing lowered scores in visual recognition, only 18 hours after taking the drug, which hardly qualifies as long term.

    Furthermore, I wish you would try tearing apart my references, because they are funded by either respected universities or the government, there are very few pro-cannabis sig's and they don't have that kind of money. You should look at NIDA's own comparison of marijuana to other recreational drugs including alcohol, tobacco, and caffiene. I have a reprint from the new york times at this site which reprints news about marijuana issues. I will agree with you that the additional commentary is biased, but the text is from the NYTimes, and the figures directly from NIDA, who is most certainly biased towards your side of the issue.

  12. Read this - You need the full story. on More Candidate Answers - Bush and Hagelin · · Score: 1

    Come on, people make mistakes. They shouldn't have to die just because they fell off a goddamn cliff.

    Excuse me: despite all the new hippie-ass candidates for president declaring that smoking up mellows you out and puts you in harmony with nature, it's a fact that weed contains carcinogens, is mildly hallucinogenic, and reduces inhibitions.

    So says scientific studies.

    Umm, Jumping off a cliff is a far cry from smoking weed, considering there has never been a recorded case of a marijuana overdose. The carcinogens can be considered negligable (all smoked plant matter contains carcinogens) as researchers at John Hopkins University have been unable to link smoked marijuana to any form of cancer, see this study. Furthermore, it has been shown that long term marijuana smokers show no more (in fact less, although not significant) cognitive decline than non smokers over a 15 year period. (Constantine G. Lyketsos, et al., "Cannabis Use and Cognitive Decline in Persons Under 65 Years of Age," American Journal of Epidemiology, May 1999, vol. 149, p. 794-800

    Canadian judges have ruled (in official findings of fact) that marijuana (if not used in the conjunction with operating heavy equipment) poses nearly no significant harm to either the individual or society, see this here.

    You should look at the mortality rate due to cocaine, written here at this report. The rate is 4 per 100,000 users! Compare to alcohol at 150, and marijuana is certainly safer than cocaine.

    Moreover, it's not like kids don't _know_ drugs are bad for them. Most of the ones I know are like "yeah, fuck that ... who gives a shit about cancer ... I'm gonna fucking smoke my joint 'cause I wanna fucking smoke my joint."

    See above. I smoked dope in High School, and graduated with several academic awards. (and 46 hours of college credit going in) I am just glad I wasn't dumb enough to drink like so many of my peers, hell, I am 37 times more likely to die from that than cocaine.

    They're not stupid, they _willingly_ commit said error. After constantly being told that they should not. I mean, name one kid who has not seen hundreds of "drugs are bad" posters and commercials in their life. Who hasn't seen the crack addicts in the airports.

    Again, see above.

    Kids know better, and if some of them are still stupid enough to smoke up, they need punishment, not help.

    I think people who enforce this unscientific crap need punishment. Come back with some references and we will talk.

  13. Re:Bush on Targeting Kids with Drugs on More Candidate Answers - Bush and Hagelin · · Score: 3
    So what? Does that mean they are above the law?

    No, but the fact that they are children means they are not subject to it.

    What I'm sick of is people blaming external factors for their problems. Its not the kids fault because his parents got divorced. That's crap, the kid hears all over the place the dangers of drugs and if he chooses to use them then he faces the consequences.

    Again, this is children we are talking about. Children are not entirely responsble for their actions as they are neither adults or full citizens. I think parents and educators have a responsibility for every child, and dumping off the black sheep is not meeting that responsibility. If we were talking about adults, I would agree with you, except that in a society where adults take full responsibility for their actions no drug laws are needed.

  14. Mind Control on More Candidate Answers - Bush and Hagelin · · Score: 4
    The violent protests in the streets of Seattle also reflect the Administration's failure to build a domestic consensus in favor of free trade. In fact, this is the first administration in 25 years to fail to secure presidential trade negotiating authority from Congress.

    Regardless of what you think about free trade, think about this:

    Bush thinks that the government should create a domestic consensus on the side of the issue rather than respond to the views of the people. i.e., the Clinton administration failed in swaying public opinion towards the wishes of Washington.

  15. Bush on Targeting Kids with Drugs on More Candidate Answers - Bush and Hagelin · · Score: 5
    In contrast to the past seven years, I will send a clear and unwavering message: drug use is wrong, and we will have zero tolerance for those who target our children with the plague of drugs.

    I wish Bush and all the other politicians would once and for all realize that the people targeting children with drugs are children

    I have been there, done that, and I know how this works: The 13 year old 7th grader got dope from the 15 year old in 9th grade who bought an eigth from the 17 year old in 11th grade who bought a half from the 19 year old in college or working who got a qp from a 25 year old who bought 2 lbs from the 30 year old grower. I guarantee that the 30 year old grower would be appalled if he knew that his crop was in the hands of a 7th grader.

    So go ahead Bush, lock the 15 year old away for ten years. Kids make mistakes, they shouldn't have their lives ruined for them. Suspension and counselling for drugs, not this zero tolerance crap. Kicking a kid out of school is not going to help him. Besides, these evil drug dealers are usually kids with divorced parents and/or fathers who beat them, and are socially rejected because their parents haven't taught them basic social skills, and turn to drug dealing to make friends, get respect, and also money.

    So much for compassionate conservatism. You would think a recovering alcoholic who snorted blow would have more understanding of youthful mistakes.

  16. or maybe for Sun on Gartner Group Squints At Future OS Growth · · Score: 2
    A way of looking at the .NET roll-out is that MS have given up their strategy of trying to convert heterogenous systems over to MS only systems, and have attampted to go for peaceful coexistence.

    This is a possibility. It is also possible that they are trying to displace java and take all of java's promises away from sun. Right now, Sun is poised in a very interesting position, and I am sure that MS strategy revolves around sun to some degree.

  17. Social Classes on the Net on The Net as the New Jerusalem · · Score: 2
    As much as I love my internet access, the thought that it will bring the classes together, without the boundries of race, sex, religion, or class, is a bit naieve.

    ---snip---

    Furthur, while those who have access to the net have a voice, it doesn't mean anyone is listening. Discusion forums such as this one are still dominated by the educated and by those with a gift for public expression.

    Good Point, but assume just for a moment that the old ideas of social class IRL were dissolved. Here we are seeing the beginnings of new criteria forming. Education and public expression are certainly good skills, but we are inventing other modifiers as well.

    Consider HTML. On who knows HTML can express themselves with hyperlinks, formatted text, and generally outwrite someone with only textual writing skills.

    We also have concepts of property and status. Do you wish you had a full suit of rubicite armor? A nice house in your favorite shard? Level 80? 120,000 platinum coins?...or more realistically, a fully secured BSD box? A T3 piped into your home? A highly regarded webpage? Operator status on several EFNet or Undernet channels?

    Even here, we have moderators (although randomly selected). This was posted with a +1 Bonus.

    To remove social class, it may be necessary to form a society of ACs, that is to say, distinguishing characteristics necesarily form social class.

  18. Re:Reality check? on The Net as the New Jerusalem · · Score: 3
    Although I partially agree; the Net is certainly a thing that can really increase someone's knowledge and understanding, and potentially lead to enlightenment...

    But it's currently chuck full of commercial nonsense and porn pop-up ads, so I don't think we'll be seeing any of that happening soon.

    Replace "Net" with "Physical Reality". Pretty scary, huh?

  19. What to learn from this post: on Lawson Of Japan To Install 15,000 Linux Terminals · · Score: 3

    OK, we may finally come to the end of linux 'zealotism' where people desperately bash MS at every opportunity. Go look at zdnet postings and you will se a flock of newly emerging windows zealots who make the linux zealots look like fair weather fans.

    The point is, never say this about MS products. The MS admin base is growing more vocally upset with linux and has begun large scale bashing. Let this happen. Adopt a come and see attitude towards linux, be evangelical like a buddhist, that is, only answer questions for as long as interest is shown. Underhype the OS, and people will arrive at their own conclusions, which will be correct. (notice I dont say what those conclusions are)

    People are not THAT dumb. They usually turn against zealot-like rage. Compute with a smile on your linux or BSD box, and people will come and see. Those people will install linux or BSD if and when it and they are ready for each other, and not before.

    Notice in this post, the poster explains how easy win2k is. The new win2k user who has difficulties will turn to disbelief quickly. If you say linux is hard to install, the user may or may not be pleasantly surprised. If you say linux has far less software than windows, the user may or may not be pleasantly surprised. If you say linux is not necessarily the most stable or fast thing around, the user may be pleasantly surprised. The user will not, however, be disillusioned.

    I ran NT4 until it ate my FAT. I switched to linux expecting it to eat ext2. It never did. I still use linux.

  20. Of course they took the coffee maker on Slashback: Duality, Mosaic, G-Men · · Score: 1

    No computer criminal can operate without coffee. Caffiene is the first necessary component to breaking networks. They probably searched for penguin mints as well. Come on, you people all run around with caffiene molecule t-shirts...you should know this.

  21. WebTV seems a bit of a technicality on FTC Names Top-10 "Dot-Con" Types · · Score: 1

    I am usually the last person to defend MS, but when I read the complaint it looked like the large problem with the ads is that the ISP service is not available as a local call for everyone. That seems fine so long as the sales reps explain to potential customers in areas not locally covered that the call will be long distance. Am I missing some part of this?

  22. Re:off topic, your user number... on Using Minesweeper to Solve NP · · Score: 1

    Have you considered the possibility that your number might be worth something on ebay as well?

  23. Stay Away on Using Minesweeper to Solve NP · · Score: 1
    Anyone know what's going on with this kind of work these days?

    Yea, this is the problem they tell young researchers not to delve into. It is the Grendel of Mathematics, a lurking monster that crushes GAs in its jaws. Whenever you work on NP problems, never think about proving NP!=P or P=NP. Don't even consider trying to prove that it is unprovable. Stay away from this kind of thinking. Go study something harmless, like Godel's proof. Havent You People Seen PI???

  24. Re:The outer gods wont like this one... on Chandra Discovers Enormous 'Skull' · · Score: 1

    Your right, I believe they all do. Nyarlahotep (sp?) is the messenger of the gods, so I imagine he would be the one to come and reduce the astronomers to babbling psychotics, if any are allowed to live.

  25. The outer gods wont like this one... on Chandra Discovers Enormous 'Skull' · · Score: 5
    Nyarlahotep (sp??) should be coming to deal with those astronomers, the outer gods don't like to be photographed. It didnt look like Azathoth, but it could have been Cthugha, or hopefully just a star vampire.

    Pray that we won't be seeing Cthulhu anythime soon, but be on the lookout for fungi from Yuggoth.