Re:Why *shouldn't* Apple release buggy software?
on
Another Look At OS X
·
· Score: 1
However, I am assuming for the sake of argument that you sincerely didn't realize that an important part of OS X was, in fact, opensource and beer-free.
Actually, none of OS X is "Open Source" as defined by the Open Source Initiative. As you'll notice, the list of licenses is missing the Apple Public Source License. Why? Because it does not comply with the standards that Open Source Software requires. Open Source isn't merely distributing the source to a program, and the APSL doesn't allow each of the points that are required. Darwin != OpenSource.
I wonder how long it will be before you will be able to get CDs with the complete source to MS Office, Visual Studio, Win2k, and so on via MSDN. Like how you get binary CDs now.
A very long time, if ever. It's really a ploy by M$ to be able to say to the DoJ that "3rd party individuals" are looking at the code. It also allows them to say, "Look at how confident we are in our code." I could also see them attempting to say something like, "It's open source for the 'big boys'. None of our secrets are out like those "other OSes", but we've got great new minds looking at the code." Meanwhile, those minds think the same way M$ does.
A software license should grant you the permission to use it freely (the real meaning of free, not the bastardized open source definition), while releasing the authors from liability.
So what you're saying is that you want to be able to take other people's code, use it to make your program work, and then close it up so that people can't do the same thing? Sounds really selfish to me.
It isn't that the scientists aren't biased at all, it's just that they aren't baised toward the either side specifically. They might feel that one technology/method is better, and explain that more, but s/he won't specifically say that the alternative is completely wrong, as most 'expert' witnesses do for their client.
It's just so that the judge can understand w/o having to rely completely on the witnesses from each side to explain it. At least, that's what I get from it.
I've driven drunk a bunch of times and till now I've never killed anybody, or even had an accident... so, drunk driving should no doubt be legal for me.
The last time I checked, drunk driving is against the law, whereas pretending to kill animated people on your computer/game system is not. Did you think at all before you posted this?
oh please. Children have always been exposed to levels of violence that have been 'excessive' at the time it was being shown. I highly doubt that all of the violence in the world is related to little Johny being able to play games where he can blow his friend up with a rocket launcher. If there is so much concern, why don't parents put the family computer out in the open and watch what their kids do on it? This would be a much better method, IMHO, of controling what children are exposed to.
Actually, what this is talking about is the services that the server part of the application will expose. Those don't have to be called, specifically from a Microsoft product. For example, say that Excel's server component exposed a formula calculator. Lets say, something as silly as Sum(). I make my Linux app connect to the Excel server, send in the parameters for the Sum() function, using some xml stream, and retrieve the answer. So it's not making the software Linux-compatible Microsoft apps, it's more like making Microsoft-compatible Linux apps.
But isn't the OS almost completely transparent, under normal circumstances? What part of the M$ Windows OS do you see? Explorer? That's not the OS though, it's just the shell. How about Linux? What do you use there? A GUI like GNOME, or KDE? How about a command line such as Borne shell? Aren't all of these just normal applications living in "user land"?
Maybe I'm going overboard with the distiction of the OS from shells, etc..., but, in reality, isn't Aqua just a pretty front to something that most people still never look at?
"And the recent security problems with Linux, coupled with the lack of key enterprise elements in the new kernel, really call into question whether Linux should be used at all," Miller added.
But we should all remember that Windows has a rock solid security system, and you'd never read anything bad about it.
This, and
this are really just figments of your imagination.
But it is just another flavor of a platform independant language. The only difference is that I seriously doubt that M$ is going to opensource the engine/compiler so that there can be versions made for Sun, SGI, Linux, Mac, etc...
And when they do, it will run slow and be full of security vulnerabilities and allow scr1pt k1d33s to haXor your site.
Vunerabilities such as specifing to do nasty things with pi, and e, and the number 1. Think of the chaos!...<mo><mo><mo>... Buffer overflow problems are probably going to be the first things to break. ^_^
How is redefining the protocol going to help? Even a firewall isn't much help when you're getting 10M/s of data pumping into it. Somewhere along the line there is an ISP that just doesn't want to deal with it, and will delink whoever the poor sap is that's the victim.
I'm sure that you're right that they want to take over channels, but for something this big, I don't really think that is the whole motivation. At this point, it would seem that their sole motivation is to see how long they can go on for, and what type of havoc they can cause. IMHO, of course.
I am a system admin for a large company in the UK, and I have never detected a sucesful breakin to our systems.
What you meant to say was that no one who was careless has ever broken into your systems. It is inevitable that a large company with an Internet presence is going to be hacked at one time or another.
There are new exploits found everyday. If you don't need to portscan your network to know it's secure, good for you. Other people aren't so confident. Also, it seems to me that being so confident in yourself is a Bad Thing(tm). I'm not saying that a system admin should doubt himself*, but it does seem important for them to have the humility to accept that he is probably not the best in the world, and that someone out there who knows more than him.
The real question is who will hack you, and how prepared you are to minimize downtime, if any.
* For grammatical correctness I say "himself/he", but if you would be so kind as to read it as "him or herself" and "he or she" I'd be ever so thankful.;)
I personally believe that every long lasting technology inevitably reaches a point where people worry if it has peaked and is going to level off. Whenever someone says this about the Internet, I wonder if people asked the same questions about cars after seeing Ford's Model-T. "What else could you ever want to put in/do with a car?"
Did anyone else notice that the proposed "standard" by Microsoft will require SQL server 2000? At the bottom of the article it is explained that SQL server is required to implement Microsoft's proposed "standard".
The actual 'standard' doesn't require SQL Server 2000; BizTalk Server requires SQL Server 2000.
Google has to get money to run their servers somehow, doesn't it? How is it selling out by getting money solely from donations? That might work for a small server, or one running as a university project, but for the 'real world' you need to have a stream of income.
Just quote the most damning parts of the bulletins under fair use, and tell MS to stick it if they don't like it.
As someone pointed out to me recently, "Never underestimate the power of lawers to bill by the hour." It might be "fair use", but is it worth getting sued and going to court?
Slashdot Mirror
Actually, none of OS X is "Open Source" as defined by the Open Source Initiative. As you'll notice, the list of licenses is missing the Apple Public Source License. Why? Because it does not comply with the standards that Open Source Software requires. Open Source isn't merely distributing the source to a program, and the APSL doesn't allow each of the points that are required. Darwin != OpenSource.
A very long time, if ever. It's really a ploy by M$ to be able to say to the DoJ that "3rd party individuals" are looking at the code. It also allows them to say, "Look at how confident we are in our code." I could also see them attempting to say something like, "It's open source for the 'big boys'. None of our secrets are out like those "other OSes", but we've got great new minds looking at the code." Meanwhile, those minds think the same way M$ does.
A software license should grant you the permission to use it freely (the real meaning of free, not the bastardized open source definition), while releasing the authors from liability.
So what you're saying is that you want to be able to take other people's code, use it to make your program work, and then close it up so that people can't do the same thing? Sounds really selfish to me.
It isn't that the scientists aren't biased at all, it's just that they aren't baised toward the either side specifically. They might feel that one technology/method is better, and explain that more, but s/he won't specifically say that the alternative is completely wrong, as most 'expert' witnesses do for their client. It's just so that the judge can understand w/o having to rely completely on the witnesses from each side to explain it. At least, that's what I get from it.
I thought Region 7 was reserved for Atlantis when it's found.
I've driven drunk a bunch of times and till now I've never killed anybody, or even had an accident... so, drunk driving should no doubt be legal for me.
The last time I checked, drunk driving is against the law, whereas pretending to kill animated people on your computer/game system is not. Did you think at all before you posted this?
oh please. Children have always been exposed to levels of violence that have been 'excessive' at the time it was being shown. I highly doubt that all of the violence in the world is related to little Johny being able to play games where he can blow his friend up with a rocket launcher. If there is so much concern, why don't parents put the family computer out in the open and watch what their kids do on it? This would be a much better method, IMHO, of controling what children are exposed to.
Actually, what this is talking about is the services that the server part of the application will expose. Those don't have to be called, specifically from a Microsoft product. For example, say that Excel's server component exposed a formula calculator. Lets say, something as silly as Sum(). I make my Linux app connect to the Excel server, send in the parameters for the Sum() function, using some xml stream, and retrieve the answer. So it's not making the software Linux-compatible Microsoft apps, it's more like making Microsoft-compatible Linux apps.
But isn't the OS almost completely transparent, under normal circumstances? What part of the M$ Windows OS do you see? Explorer? That's not the OS though, it's just the shell. How about Linux? What do you use there? A GUI like GNOME, or KDE? How about a command line such as Borne shell? Aren't all of these just normal applications living in "user land"?
Maybe I'm going overboard with the distiction of the OS from shells, etc..., but, in reality, isn't Aqua just a pretty front to something that most people still never look at?
But we should all remember that Windows has a rock solid security system, and you'd never read anything bad about it.
This, and this are really just figments of your imagination.
But it is just another flavor of a platform independant language. The only difference is that I seriously doubt that M$ is going to opensource the engine/compiler so that there can be versions made for Sun, SGI, Linux, Mac, etc...
Actually, a codon is just what they had "TACAGTGTCAGAATTAACTGTAGTC". A tri-base codon is special and is called a "triplet codon". That is TAC, etc...
Vunerabilities such as specifing to do nasty things with pi, and e, and the number 1. Think of the chaos! ...<mo><mo><mo>... Buffer overflow problems are probably going to be the first things to break. ^_^
I'm sure that you're right that they want to take over channels, but for something this big, I don't really think that is the whole motivation. At this point, it would seem that their sole motivation is to see how long they can go on for, and what type of havoc they can cause. IMHO, of course.
Ah, you know it as "Hotaru no Haka". So sad... Poor Seita & Setsuko! ;_;
Yeah, but playing with 2 players is what made if fun. ;)
Of course, along come the barbarians and mess up all my cities stuff. Grrr....
What you meant to say was that no one who was careless has ever broken into your systems. It is inevitable that a large company with an Internet presence is going to be hacked at one time or another.
There are new exploits found everyday. If you don't need to portscan your network to know it's secure, good for you. Other people aren't so confident. Also, it seems to me that being so confident in yourself is a Bad Thing(tm). I'm not saying that a system admin should doubt himself*, but it does seem important for them to have the humility to accept that he is probably not the best in the world, and that someone out there who knows more than him.
The real question is who will hack you, and how prepared you are to minimize downtime, if any.
* For grammatical correctness I say "himself/he", but if you would be so kind as to read it as "him or herself" and "he or she" I'd be ever so thankful. ;)
Couldn't it be said that every planet is just a moon of Sol? Does it really matter that it is not revolving around a star?
I personally believe that every long lasting technology inevitably reaches a point where people worry if it has peaked and is going to level off. Whenever someone says this about the Internet, I wonder if people asked the same questions about cars after seeing Ford's Model-T. "What else could you ever want to put in/do with a car?"
The actual 'standard' doesn't require SQL Server 2000; BizTalk Server requires SQL Server 2000.
Google has to get money to run their servers somehow , doesn't it? How is it selling out by getting money solely from donations? That might work for a small server, or one running as a university project, but for the 'real world' you need to have a stream of income.
Wouldn't it be cool to make a file manager type tool with the Quake/HalfLife engine?
I'm impressed with your bravery. I'd never trust a beta version of a programming language named after a musical note ;)
As someone pointed out to me recently, "Never underestimate the power of lawers to bill by the hour." It might be "fair use", but is it worth getting sued and going to court?