Slashdot Mirror


User: MOMOCROME

MOMOCROME's activity in the archive.

Stories
0
Comments
164
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 164

  1. Re:Big Bass Boom on The MIDI-fied Large Hot Pipe Organ · · Score: 1

    LOL, sweet troll, shoeboy. look how many responses!!! And yet through all the sarcasm, you even have a point about the all the shameless imperialistic land grabbing of the past 200 years... to bad most of these people are so thick...

  2. Re:Big Bass Boom on The MIDI-fied Large Hot Pipe Organ · · Score: 1

    As for the cannonade, I believe it represents the glory of US military might. IIRC, Tchaikovsky wrote the piece in honor of the Spanish-American war. or should that be War with a capital W? The point is, the cannonade is totally, unequivicably appropriate to the piece. No gun lovin US bashing needed.

    I believe what you are trying to express with that 'USAians' is a confused use of the newish USAsians, a term coined to describe emmigrated oriental folk.

    And finally, you used a tympany because you were still a kid in school! They don't just hand a keg of explosives to any ol' teenager or twenty something fool. That behavior is reserved exclusively for the militaries of the world.

  3. Re:This is not "how we live" at all on Snapshotting the Whole Internet? · · Score: 2

    let me try and clear this up for everyone: JE is a troll.

    But what's worse is his strategy of arguing against humanities' overall increase in knowledge, and having many of the lurkers take this stuff seriously. Those lurkers in turn become the grousing bitches in the workplace, the fux0rs that make it impossible to achieve greatness. Daikatana is a perfect example of not only inept management, but a bunch of nasty grunts that regurgitate base cynicism, by way of sucking up this sort of troll born tripe.

    Why would you discourage the archiving of such a valuable chunk of data? Besides just eliciting responses... In the final analysis, there is no reason not to support (or at least stand clear of) these archive.org folks, is there?

    In short, this is the crank-assed behavior that hobbles the entire high tech world. This is not a well formed criticism or a burst of insight, this is a wanky know-it-all piece of crap designed to spark a useless debate. The problem is, that is more damaging than anything else going on on the web today.

  4. GATTACA on Download The Human Genome · · Score: 1
    gattacagattacagattacagattacagattacagattacagattaca gattacagattacagattacagattacacatgagacctgatggttttata aggggctcttccccctttgctcagcacttctccttcttgccaccgtgca aagaaggtgctttgcttcccttcaccttccgccatgattgtaagttcctg aggcctccctagccaggttgaactgtgagtcaattaaaactctttccttt ataaattactcagtctcaggcgattacagattacagattacagattacag ttccgccatgattgtaagttcctgaggcctccctagccaggttgaactg agttctctatggcagtatgaaaacgtactaatacaaataacaaaggtttt atgtttcctcccaaattagtgtctagagtcaacgttagctcctagggtca agctattatacaggattagaggcatttaggagattacaacttttccctgg tttttcaaagattagtcacatgttcacttggctgaatacacaaggtagaa tggacaggacttgaggcaaataaccttgtggttaagagtactcaggttca gattacagattacagattacagattacagattacagattacagattaca

  5. Re:what about God? on Download The Human Genome · · Score: 1

    'Tis a razors edge between Flaimbait and Funny.

  6. Re:Of course! It's the acronym. on WAP Under Fire · · Score: 2

    GNU is already an idiotic acronym that stands for GNU is Not Unix. Example: "I gnu that would piss you off". Besides, Gary Gnu was a demented childhood nightmare for many of us. I cringe every time I hear it (though reading it is fine) I think GPL is a better acronym, just in the way it sounds, and has the added benefit of containing a nested recursive acronym, as opposed to simply a recursive acronym.

    Meanwhile, here is a list of replacement GNU definitions to start everyone off:

    Giant Nerd Unit
    Grasp Not Understanding (glasshoppah)
    Good N Ugly
    Gonna Need Undies
    Get New Uniforms(!)
    Geeks Need Universities
    Gandalf is Not Ungoliant
    Giant Needless Undertaking
    Got No Users
    Going Noodle Up
    Getting Nothing Unique
    Girls Not Understood
    Greasy, Nasty Unguent
    Good News Undelivered
    Group Needs Umpire
    Get your Neices' Umbilical-cord
    Gates is Not Ubermensch
    Gates Needs Underlings
    Glorious New U-turn
    Gamma Necto Umbrus!

  7. Re:Check out the interview. on Paul Steed Interview · · Score: 1

    The following is definately a rant, be warned...

    All videogame artists are sweaty dullwits. take it from me, I should know, it's what I do.

    No 'seasoned programmer' I currently know or have ever heard of would place his/her fate in steed's sweaty wacom gripping mits, that's for sure! Not for the shred of 'celebrity' he has to offer. Only sweaty dullwit programmers (a little on the gamey side, rather than 'seasoned') would even think about it. Or maybe he could impress some naive croatian enlisted men. Oh, but that's right, they already have a great art dept. over at Croteam, don't they?

    Video games are all about 'what have you done for me lately'. Steed lost it years ago, that's why he needed to be fired. All the rumors you hear about this being 'retalitory' have little to d with the overall realization that he is a rich lazy primadonna.

    Nobody that's made it in this industry has the slightest shred of dignity or honor excepting focused types like Carmack. And he only appears that way in his .plan files. Have any of you ever worked with him? is he petty and cruel like the other 99% of the industry? That's one thing I doubt, but you can never be sure.

    It's really amazing that the industry stays afloat at all, given that the vast majority of the fools in it are utter pinch-mouthed preppies that rarely venture out of their little valley or burg into the real world, or beyond websites like msnbc/financial. Where are the people that made Doom? Steed's not one of them, not for a long time. None of those schmucks have what it takes any longer. Romerero? disgraced. Steed? fired. Carmack? well, he still kicks ass, is focused alright, but without a complete team, UT will kick their ass every time. Doom3 stands a fair chance at bringing id back up front, but they better do it right!

    The video game industry is full of nothing but visionless, overly comfortable, tea-totalling, anal retentive, ass kissing, backstabbing schmucks, that's what I say. MY GOD THESE PEOPLE SUCK!

  8. Re:It's pretty simple on Understanding Script Kiddies · · Score: 1

    i ain't kidding here, I got me a geek loving teenager!

    well, she was 19 when we started dating. she's 21 now. i am 29. She actually demanded that i go out with her to begin with- I even had another girlfriend my age when it happened. But I was powerless to resist her pouting breasts and firm teen buttocks. not to mention she was working help desk at a high end isp at the time...

    now she brings up marriage constantly. I have to ask, is it only because of the fat cash geeks like me pull down? I am a touch overweight, have dishevveled clothing and low hygeine standards. Then again, I also play lots of guitar and smoke el dube' like it's beer. maybe she is attracted to my 'inner rocker'?

  9. Re:Oh, great. on Could The Moon Power Earth? · · Score: 1

    where are our jet cars now?

    I believe they are called computers.

  10. Re:Oh, great. on Could The Moon Power Earth? · · Score: 1

    Do you have any idea how fucked up our energy situation is right now?

    Hmmm. back that up with something. Seems to me we are on the verge of fusion, fuel cell and superconductors. I do like the point you make in that comment you link to though, I'll give you that...

    I know I may be coming off harsh, but you haven't really answered to any of my serious points:
    Spurring tremendous advances in science- Good or Bad?
    Millions of jobs involved in gas economy- True or False?
    Many people drive used cars- True or False?
    etc.

    They went and fucking found other work.

    Hmmm. Those were some seriously terrifying examples you provided- asbestos worker? medical leech collector!?! ro-diculous. I am talking about millions of jobs being lost.

    How many million able bodied workers are there in a population of approx 300 million? surely millons of suddenly un-employed adults represent a significant percentage. even spread over a 5 year period, we are still talking about a disaster. can you deny that?

    anyway, don't bother replying if I've only angered you. Besides, I am sure your rant about research funding is entirely on topic and astute. I probably should have just kept my mouth shut.

  11. Re:Oh, great. on Could The Moon Power Earth? · · Score: 2

    we could already be abusing html tags.

    but seriously, there is more to it. you present a somewhat naive take on the situation. I believe the benefits of a large scale moon operation far outweigh the trouble caused by using conventional fuels. Sure we could pour research dollars into corn powered cars, but how will that spur materials sciences? nuclear physics? astro-navigation?

    I suppose we could all spend the next thousand years driving our corn powered cars to coffee houses next to granola factories and vegan 'cheese food' silos... But I would rather get my Orbital Hilton reservations confirmed, thank you, and get there via fusion powered lear plane, constructed of the finest Bolivian strip-mined titanium. All on my meager salary. This is the promise of another space race.

    Not to mention the huge amount of inertia going on in the gas powered car scene. By your stern use of the bold tag it would seem you think the Auto mfctr's can just start selling electric cars exclusively if they want? What about the gas stations? what about the 4 million parts & service companies servicing the auto industry directly? or the 8 million companies servicing consumers? or the auto manufacturers? what about all of their employees? and those employees families? what about the millions of people driving vintage early 80's pos cars cause they can't afford new ones? do they still get to buy gas?

    sheesh.

    Maybe you could try to think in terms of science and economics before you sputter off about corn cars next time. After all, those are the only things that matter.

  12. Re:TOUCH MY MONKEY on GUI Research - Is it Still Being Done? · · Score: 1

    wtf kinda idiot moderator did this!? (score:0 flamebait)? my comment is on topic, correct, insightful and funny. That really is how the new Apple mouse works. The interface from eXsistenz really is supposed to be obscene. gah! get with the program!

  13. Re:very old news on Printing Out A New Monitor · · Score: 1

    Minimeme and I have a secret to share: we're getting engaged! * * After 14 short minutes of knowing and loving one-another, we have decided to get hitched!
    We will meet for the first time next week.

    I can hardly wait! Especially so I can change my last name. I have a really horrible last name. I am cursed with the hideous name of Momocrome Imelda Malda, but now I can be Momocrome Imelda Evil. Much sweeter on the lips, you have to admit!

    You haven't been telling, have you minimeme?

    -NOTE- The above is only a test. This has been part of an exercise in embedding the YHBT hint in a 3 voice, single author, multi account troll thread. Had this been intended to be a real troll, you can be sure it would follow proper decorum and sobriety.

    This has all been a test.

  14. Re:very old news on Printing Out A New Monitor · · Score: 1

    shut up fool, you'll blow my cover!