So its true what my bio teacher said about being able to call up a biological supplier and say "I want a DNA molecule that goes ATTCGACAGATTGCTAGCTGAGTCCGAGTCGCCTATGACTCGA"
IPv4 32 bit addresses are easy enough to remember, but how do you suppose we remember IPv6 128-bit addresses? try memorizing this: 125.26.32.9.124.52.128.93.65.0.26.48.85.195.16.248
by the way.... does anyone mirror the povray www site? wait--i just got into povray.org. first reaction: AAAAAGGGGGHHHHH!!!!! why does everyone hate/stop using frames now? OH NOESS!
You still will probably get render times > 10 hours now. CPUs get faster, true, but so do monitors and povray itself. A 320x200 image looked big 10 years ago, but now is takes up about 1/20th of your desktop. And the simpler renders in old povray are boring now; using the new primitives/textures/radiosity/etc. will take longer. I tried MORAY once, but sort of stopped because it scared me and was to shareware-ish. Sometimes i exported a dxf from blender and converted that to pov. blender also no longer exists. The other problem is that modellers don't always keep up with povray.
the more open-source-y a program is, the more slowly the versions increase... except linux... on second thought, never mind... and besides, look at all the skipped major versions (netscape 5, slackware 5,6)
It wasn't enough to advertise 50x the speed of dialup, and give us 2.5x the speed?
Eventually they'll limit us to only outgoing connections on ports 80, 25, 110, and 21. then just 80.
Who made it legal t sue people about things they do on the internet??
Seriously, all of the fun of the internet has been killed now that anything you do comes with the danger of some huge corporation sueing your pants 0ff.
I think Ford is just p/o'd that the hackers and 2600 know more about the internet than they do, so they take the cowards legal way out, instead of registering www.fuck2600.com
Slashdot Mirror
So its true what my bio teacher said about being able to call up a biological supplier and say "I want a DNA molecule that goes ATTCGACAGATTGCTAGCTGAGTCCGAGTCGCCTATGACTCGA"
Could you integrate a GPS into the computer? or a wireless internet speaker phone?
technically, its a car Winamp player. It plays anything j00 have an input plugin for.
How exactly does the touch screen work?
IPv4 32 bit addresses are easy enough to remember, but how do you suppose we remember IPv6 128-bit addresses?8
try memorizing this:
125.26.32.9.124.52.128.93.65.0.26.48.85.195.16.24
My main beef with DNS is the cost.
by the way.... does anyone mirror the povray www site?
wait--i just got into povray.org. first reaction: AAAAAGGGGGHHHHH!!!!! why does everyone hate/stop using frames now? OH NOESS!
You still will probably get render times > 10 hours now. CPUs get faster, true, but so do monitors and povray itself. A 320x200 image looked big 10 years ago, but now is takes up about 1/20th of your desktop. And the simpler renders in old povray are boring now; using the new primitives/textures/radiosity/etc. will take longer.
I tried MORAY once, but sort of stopped because it scared me and was to shareware-ish. Sometimes i exported a dxf from blender and converted that to pov. blender also no longer exists. The other problem is that modellers don't always keep up with povray.
the more open-source-y a program is, the more slowly the versions increase... except linux... on second thought, never mind... and besides, look at all the skipped major versions (netscape 5, slackware 5,6)
w00t!
Now I don't have to download a new 8 meg file every month.
I'm still deciding whether to use pov 3.5 or megapov 0.7...
all they do is sue people. Why don't teh artists just distribute music over the internet or sell their own cd's and make money on action figures?
It wasn't enough to advertise 50x the speed of dialup, and give us 2.5x the speed?
Eventually they'll limit us to only outgoing connections on ports 80, 25, 110, and 21.
then just 80.
Who made it legal t sue people about things they do on the internet??
Seriously, all of the fun of the internet has been killed now that anything you do comes with the danger of some huge corporation sueing your pants 0ff.
I think Ford is just p/o'd that the hackers and 2600 know more about the internet than they do, so they take the cowards legal way out, instead of registering www.fuck2600.com
pray for the success of atheism
MS from MSnbc. Its all part of microsoft's plan to promote their shitty os and iis server.
I think it cost $6 before windows Me came along