Slashdot Mirror


User: TummyX

TummyX's activity in the archive.

Stories
0
Comments
2,237
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 2,237

  1. Re:Live in the now man... on Microsoft And Sun Settle · · Score: 1

    I do believe that C# will adapt, but how can it compete with a 'relatively' open and cross-platform language

    C# and the CLI have been submitted to the ECMA for standardization. It will be more open than Java.
    The .NET framework is also being ported to other platforms.

    Java is really one of the few great enterprise server solutions (for the internet) that is both robust and scalable. (I don't consider a 4-cpu Dell running windows 2000 scalable).

    No, this is scalable.

  2. Re:Microsoft lose all rights to 'Java Compatible' on Microsoft And Sun Settle · · Score: 1
  3. Re:Java and the JDKs run on M$ (& everything else. on Microsoft And Sun Settle · · Score: 2

    They're going to try to ramp up C# to use the VB VM. They realize that C# doesn't quite cut it as a language (like they care about semantic and syntactic purity,) and that VB's VM is pokin' slow and its been cracked to bits.

    Ahem. C# uses the .NET runtime's VM (Common Language Runtime). VB.NET is a completely rewritten VB and it targets the CLR just like C# will. VB.NET is nothing like the old VB (except for syntax).

    Also, VB has been natively compiled since version 6, so it has had no need for a VM for quite a while.

    VB's VM is pokin' slow

    Compared to what? Java? LOL

  4. Re:Microsoft lose all rights to 'Java Compatible' on Microsoft And Sun Settle · · Score: 1

    C# doesn't cut it. It's not here now and Java is and has been for six years.C# is still months off release and even at the first release it won't get wide use until the development tools and toolkits catch up. That will hurt.

    .NET development tools are already lightyears ahead of java development tools. And the class libraries are already richer than java's. The first release of the classes includes collections, regex, reflection, interop, xml, soap etc. How long did it take java to get those?

    Microsoft can develop much faster than sun can. Already there are numerous websites running on the beta of .NET and ASP.NET.

  5. Re:Under the hood on Understanding the Linux Kernel · · Score: 1

    In VC++ you can use the _msize function.

    size_t _msize( void *memblock );

    Not ANSI tho.

  6. Re:Before it gets /.ed on Will Browser-Neutral Web Soon Become Thing Of Past? · · Score: 1

    He has certainly every right in the world to target whoever he wants, but he might consider a message that doesn't blurt to the world that he's full of it.

    Full of it? What exactly is he saying that is incorrect?

  7. What it looks like. on A Genome Mark-up Language · · Score: 1


    ttaacattgagctaacgataggatacgattacattgagctaacgatag ga
    tacgattacattgagctaacgataggatacgattacattgagctaacg at
    </genes>

  8. Re:It's not exacly the same thing... on Dumping LinuxPPC For MacOS X? · · Score: 1

    Win32 is horribly incompatible with itself. If you are trying to do anything the slightest bit non-standard you need to test on every revision of Windows.

    Please check your facts.
    Talk about FUD.
    Almost all Win95 software runs on win98, winme, winnt and windows 2000. The only things that don't are platform specific things like realmode applications and device drivers.

  9. Source code to a Windows app on Linux and Gnome Go to the Movies · · Score: 1

    Look at the third picture down. That is a GNOME looking dialog box, but the source code in the background is definitely for a Windows application. GetDlgItemText? Hungarian? Yep, Windows alright.

  10. Re:Also netscape had to hire ex ms employees on MS Anti-Trust Litigation - The Case For Standards · · Score: 1

    what a load of crap

    Maybe netscape should have tried speeding up their browser by writing a better rendering engine. Just like ie, opera and mozilla has.

    Netscape's speed problem has very little to do with winsock or secret apis.

    I maybe pro microsoft. But I don't talk about absolute crap.

  11. Re:IE built into Windows on Proposed Legal Test For Combining Programs · · Score: 1

    And when they said that, they were correct. However, the same could be said for literally anything. My Lego X-Wing fighter at home is also made up of smaller components; does that mean that the Lego bricks are integrated? My computer is made up of a video card, processor, memory, monitor, keyboard, mouse - does that mean all of those components are integrated with each other? (If so, how do you explain the ability to upgrade components without replacing the entire system?)

    They are integrated with each other. That does not mean they are permanently integrated.

    This is especially true with software. By your definition, NOTHING is integrated. Even printf() wouldn't be an integral part of ANSI C. Which to most people, it would be. Almost nothing in the universe is permanent. Your definition of integration is distorted.

    Take the case of IE. IE started to replace Windows Explorer because it did the same functionality as explorer - but more. It allowed you to browse the local file system, remote file systems, the www and ftp sites. So instead of developing two programs that did the same thing, microsoft just made the source trees into one. IE itself is made up of smaller "integrated" components such as an XML parser (which itself is a seperate product too), an HTML parser, a renderer, an image decompressor, etc etc. Now is it legal for Microsoft to not only integrate IE and Windows, but to even integrate the components of IE into a web browser?
    Should Netscape be allowed to ship Messenger with navigator and call it "communicator"?

  12. Re:TFB it crashes IE 5.50 on Flash For The Rest Of Us · · Score: 1

    It isn't IE or Windows crashing. It is flash, which is running in the same process as IE.

  13. Re:IE built into Windows on Proposed Legal Test For Combining Programs · · Score: 1

    Microsoft has touted IE as a component for other developers to use, which means that the IE user interface, Explorer, and every other application which uses the IE component is accessing the API. As a result, Microsoft implicitly admits that IE is a component, and thus replaceable, and thus their claims that it is a true integration are simply wrong.

    You're just arguing over microsoft's interpretation of the word integration. Microsoft has publicly said that all software components (especially microsoft ones) are made up of smaller components. Windows could work perfectly well without TCP/IP, a GUI, etc. But it wouldn't be as useful. Integration doesn't mean that it won't work without it. You can say that car seats are integrated into (or an integral part of) cars for example.

  14. Re:IE built into Windows on Proposed Legal Test For Combining Programs · · Score: 1

    Not really. What Microsoft did was simply to add an extra few DLLs onto each Windows CD and then write their applications to take advantage of the capabilities of the DLLs.

    And so what? They can't do that? The APIs to IE are published so 3rd parties can use these DLLs, just like they would GDI, or COM.

    Yes, it would. But that doesn't necessarily mean the two are integrated, any more than my car and my tires are integrated. If I take the tires off my car, my car doesn't move - therefore my car and tires are integrated components? ... Microsoft was wrong with this claim. I'm rather surprised at the number of Slashdot readers who can't seem to comprehend the distinction between dependency and integration.

    Who gives a shit about the difference? Removing IE from windows, whether you call it integrated or a dependency still cripples windows and windows applications. Just as removing TCP/IP would (to make win98 more like win31).

  15. Re:IE built into Windows on Proposed Legal Test For Combining Programs · · Score: 1

    Ahh, so lets see.

    Some company complains that integrated TCP/IP, networking, a GUI, sound system etc into windows is anti competitive.

    Pinhead Jackson orders Microsoft to remove it, but Microsoft says it would make "windows not work" (in your words btw).

    Now, you'd say: "Well, DOS works just fine without all that built in. It didn't have it before, why would you need it now?"

    See how stupid that sounds?

    Microsoft should be allowed to add new features to their products. IE integration and now the eventual DHTML skinning in whistler is being copied in the Linux world as well (KDE, Gnome etc). Microsoft and their customers aren't the only ones who think it was and is a good idea.

  16. Re:Blue screens s'not a problem? on Linux 2.4 Wins 4th Place ... in Vaporware · · Score: 1

    .NET is about software running on top of another OS. A runtime. It is not a kernel nor does it have kernel level modules. why would it cause a BSOD?

  17. prove it on MS Anti-Trust Litigation - The Case For Standards · · Score: 1

    First of all, all those dollar signs really make you look intelligent.

    Now, you say MS Office needs to be seperate from VC++ and VB. Well it is. Office is only integrated with VBA (its macro/scripting envirometn) - which BTW, you are able to integrate into your own applications (Wordperfect is integrated into VBA).

    VC++ is a development envioroment, I hardly see how it has to do with publishing the full APIs like you imply (from your silly OS compiler commment).

    VC++ comes with MFC, the class library set microsoft use to write Office in. If you would just look, you'd find out MFC is free, and comes with source code. The VC++ wizard also lets you produce applications that conveniently allow document embedding just like Office.

    Since you seem convinced MS Office is leading cause it uses "special API calls", would you care to point out anything microsoft does in MS Office which seems IMPOSSIBLE to do in windows without secret API calls?

    Can you backup your claims?

    I'm sure there are exported dll functions that are in windows which aren't documented. But that means they aren't APIs. They are used internally by windows - or aren't yet finalized so can't be published for developer use. That is fine, and only is a problem if you can prove other microsoft products (office in this case) use these undocumented API calls. Spying on the API calls Office makes, I've seen no such thing.

    If you could somehow find these secret apis that office uses, you'd have to show that these secret APIs somehow help ms office - and disadvantage corel office or star office (note: star office on windows has just as much, if not more more power than star office on linux).

    For example, the api call isn't simply a utility dll function that reverses a string. (that wouldn't be impossible to do in windows if microsoft didn't supply the API).

  18. Re:Huh? on Ten Technologies That Shouldn't Have Died? · · Score: 1

    What about remote GUI login? Unix had it, and Windows never caught up (no, pc anywhere doesn't count). People still don't know that they should be able to log into their home computers wherever they are.

    Um, Citrix has been around for almost a decade. And what abuot Windows Terminal Server? A standard feature of Windows 2000 servers.
    If consumer windows has remote gui login, you'd prolly be complaining about how insecure it would be.

  19. Is it woryth giving up your privacy on Opera 5 Free... If You Want Commercials · · Score: 1

    What do you guys think of ads in your software? Is it worth giving up your privacy for a free binary, or paying fifty bucks for the binary? Personally, I'll stick to mozilla.

    Is it worth giving up your privacy to read slashdot?

    Or is slashdot going to be completely free and without ads?

  20. Re:Simply annoying... on Why Linux Lovers Jilt Java · · Score: 1

    Apart from your java code being incorrect in the first place. You should know that you can't extend java.lang.String because it is marked as final.

  21. crap on Netscape 6 Vs. 4.7x · · Score: 1

    That's bullshit.

    Set IE to startup in a new process. It is still faster.

    Any "preloading" can only account for load up speed. IE is much much faster than netscape in everything else after loading.

  22. Re:Microsoft�s effects on innovation. on MS and the DOJ Return to the Ring · · Score: 1

    Windows 2000 is NT 5.0 repackaged with again minor changes and improvements

    Windows 2000 is NT5 you dumbass. And it is hardly just NT4.0 repackaged. It is a massive upgrade.

    And what about .NET? Beta 1 is freely available for download from MSDN.

  23. Re:Nobody's making huge profits here.... YET. on Sony Playstation 2 for Over $1k [Updated -- $5K] · · Score: 1


    Free as in free to develop something with and test it by yourself or free as in develop something and distribute it at will including libraries ?



    Ofcourse it is free to distribute the libraries (especially considering the libraries come free with windows and are available for download by windows owners from microsoft.com)

  24. Re:Nobody's making huge profits here.... YET. on Sony Playstation 2 for Over $1k [Updated -- $5K] · · Score: 1

    Uh, HELLO! You have to have MS DevStudio if you want to write games for windows. Even back when Watcom and Borland were competative, they were paying royalties to MS for the windows libraries.
    Dumbass. Download the Windows Platform SDK for free. It comes with all the windows headers, libraries and source to ATL, MFC etc. All the documentation and examples you could want etc. It is completely free.

    BTW, the DirectX SDKs are also free.

  25. Re:Another link on Air-Powered Cars · · Score: 1

    In many respects the Reagan/Bush administration was to alternative power as Microsoft was to Computer Science -- they slowed the technological development down for at least 10 years or so. That is the stupidest thing I've ever heard.