Slashdot Mirror


User: ch-chuck

ch-chuck's activity in the archive.

Stories
0
Comments
3,035
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 3,035

  1. It runs Corel's PhotoPaint nicely on How Is Wine Doing These Days? · · Score: 2

    as was recently written up here

  2. Oh, OK - but still on Microsoft's 'Freedom to Innovate' Brochure · · Score: 2

    One can still interpret AOL's actions as having to agressively fight back against devious tactics. Just like I was saying, any company that's 1) Non-Msft and 2) Makes nice "well behaved" per the published api applications doesn't stand a chance against Msft app integration with "special secret ingrediants" - all the more reason to seperate the two, so that EVERYONE can have a chance, not just the guys who make the default OS.

    (Just checked w/ someone who uses NT & AOL and yes, it's ver 3).

  3. How does splitting the company on Microsoft's 'Freedom to Innovate' Brochure · · Score: 4

    into a commons OS and an Apps division reduce their freedom to innovate? The OS division will be free to add features that the Apps division PLUS EVERY OTHER App Company can take advantage of, just as well as the Msft Apps division will be free to innovate anything they want and will have to use the same api's as anyone else. The apps division can request os services and the os division can fulfil or not. The only thing different will be that the competitive playing field will be leveled for other software companies to compete with the msft apps just like msft.

    CASE IN POINT: Even while the court was coming to a verdict, Msft released Windows 2000 - suddenly AOL is broken but MSN works great!! One of our sales force with an existing AOL account got a new notebook and we couldn't get AOL to connect, so now he's using MSN. All we consumers want is freedom of choice to pick AOL, MSN or whatever on their own merits without having the perversion of having an Msft product given special treatment because they're in cahoots. MSN should be completely free to innovate, just on their own terms and not by getting secret inside information that's not available to competitors first.

    We really need to keep the heat on these guys and not let some BS campaign twist reality, for their own good as well as ours. Only a continuence of consumer choice, as well as educating consumers to the choices they have will keep Msft on their collective toes, improve the quality of software, prevent monopolistic price gouging and make it affordable to everyone.

  4. Makes sense to me on Open Media, Take Two: The Sensemakers · · Score: 2

    There's a new occupational niche: "SenseMaker", aka "The Answer Man", "Mr. Know it All" (incl. specialized practices like "Computer Guru", "Alpha Geek" and "Tom & Ray"), direct descendant of the tribal witch Dr., Medicine Man, Shaman, Prophet, philosopher, Royal Advisor, Pope, President, what have you.

    Job Requirements: Ability to survive the total perspective vortex, take sips from the info firehose and deal with 7,835 emails/day. Also index, catalog and sort all web pages, make optimum purchasing decisions. Ability to interpret and explain abstract scientific phenomenon and technology to the bewildered uneducated masses a plus. Required to understand and interface well with personal of divers cultural backgrounds.
    The successful candidate will be well briefed on late breaking news events and have the capacity to coordinate departments and act accordingly toward maximizing stockholder value. Some public speaking required.

  5. Giant breasts on Australian Scientists Produce Giant Mutant Mice · · Score: 2

    What's next, giant women?

    now there's a scientists dream - forget those messy troublesome si or whatnot implants.

  6. Warning!!! -CLASSIFIED- TOP SECRET for eyes only on French Prosecutor Opens Echelon Probe · · Score: 1

    Ack, they'll come to some compromise and the whole thing will blow over - it always does.

  7. Re:Pirate Radio - the link on Answers From Sealand: CTO Ryan Lackey Responds · · Score: 2

    is here - but then they mention being "3 1/2 miles south of Long Beach, Long Island" - hmmmm.

  8. Lawsuit defense - haha on Answers From Sealand: CTO Ryan Lackey Responds · · Score: 3

    I know of one group that wanted to run their own unlicensed radio station, bought an old Japanese fishing trawler, outfitted it with transmitters and sailed out into international waters and started broadcasting and very soon the US coast guard shows up, arrests them and hauls the whole shebang away. The charge - broadcasting into US terriroty (of course they don't dare raid radio Moscow for doing the exact same thing). The point? In international waters it's whoever has the biggest guns and navy, if the UK or whoever wanted bad enough to shut it down they will, and need only the flimsiest legal justification for sending in the stormtroopers.

  9. Only on condition... on Pete Townshend On Lifehouse, The Net, And Pirating · · Score: 2

    that everything I know NOW remains intact! Yessir, set the wayback machine for 1973 and I'll personally ensure I'll personally ensure Msft remains an obscure hack shop. No, I won't be fooled again!

  10. Genetic Fashions - 2250 on Frankenstein Time · · Score: 2

    I can see news reports from the future already:

    "Big floppy ears are all the rage these days, ever since holo-star Reginald Queenster and his mate decided to have their latest child GM'd to order. Hospital bioengineering units are being swamped with requests for those cute big floppy ears and are scrambling to keep up with demand. "This designer kid tech sure has had a positive influence on our cash flow recently" said Malcome Roberts, Chf. Business Comptroller for the 1-valley fertilization and birthing unit. "Folks see these celebrity kids in the screens and just havta have one too! We haven't seen this level of customization since the large lips craze 30 years ago." Also, recent developments at BiTecH give parents the choice of designating features as heriditary or single-gen. "We do counsil prospective GMers carefully about the consequences of their choices, since, like giving a kid a funny name, they may grow up to resent the alterations and choose to not reproduce. But it is all about giving parents more choices" said Shila Paterson, a member of the client advisory board."

  11. National Status Symbols on IBM Constructs New Fastest Computer · · Score: 4

    These things must be the latest fashion in international peeing contests - It used to be that the US was upset that the USSR had enough missles to blow up the US 20 times over, and we USians could only blow up the USSR 15 times so we (USians) had to make and deploy more missles to acheive 'parity' and get the USSRians back to the negotiating table.

    Now-a-days, I guess the US is afraid that China will have better nuke simulators than the US so we gotta beat 'em at it, it's "Keeping up with the Chin's" all over again.

    I'd rather see the funds go toward a modern super-collider but, pfft, I only pay 1/3 of my income to taxes, I don't have any real say in how it's going to be spent.

  12. Maybe their lawyer on Microsoft Openly Provides Kerberos Interop Specs · · Score: 2

    J.K. Weston has been reassigned to an exciting new career as trainee in the phone tech support dept?

  13. Here's my version!! on Microsoft Releases C# Language Reference · · Score: 4

    On the first day, Bill and Paul created BASIC, and MITS users rejoiced and made many illegal copies.

    On the second day Bill created Micro-soft, such that when MITS tanks and Pertec buys it thinking they'd get BASIC, they didn't (nyah, nyah nyah!!)

    On the third day Bill purchased QDOS and sold it to IBM - the IBM compatible crowd granted Msft a DOS monopoly and it did fill the coffers to a great overflowing.

    On the fourth day Bill release Windows3, a grotesque abomination, yet being tied to the DOS monopoly it quickly ascended to 90% market share.

    On the fifth day Bill unleashed a horde, Windows 95 to punish the Win3 desktop users and bind and chain them to a GUI standard, and a monsterous NT to abolish Novell, the faster file server in the
    land, and to cause grevious crashing and blue screens of terror in the server room.

    On the Sixth day, Bill embraced the Internet,
    which at first arose and suprised the great Msft and threatened to make it obsolete, yet Bill fought back with the vigor of the damned and with the most agressive and grevious of bundlings tied IE to Windows, which was tied to the ancient DOS monopoly, thus fooling even the wise as to the Internet's true origins.

    On the Seventh day, waxing vastly bolder still, Bill calls forth all demons at his command to punish the MITS software pirates and the people of Earth who are like them, enslaving humanity with strange proprietary languages, capturing even the guardians of hades, confusing their minds and drawing them into labyrinths of law and insanity.

    And thus it is that the people of Earth were smitten and chained to their workstations of everlasting pain and damnation, yet suffer it greatly for it is by their own seeming choice.
    And the great demon cackled with glee.

  14. Well... on Salon's Free Software Project (Part 2) · · Score: 1

    I got thru two sections before the flash crowd turned Salon.com to mud - now all I can get are two cookies and a banner ad.

  15. 'd be really neat if they find.... on Human Genome Mapping Completion TBA · · Score: 2

    "Get good cryptographers to look at it, see if they can find patterns"

    ...find a pattern that rought translates:

    "Congradulations! You finally figured it out - signed, GOD"

    or

    "This code derived from original Andromeda strain implanted Sol+14097, Copyright Andromeda Bioengineering, Galactic Diversification and Colonization Corporation, all rights reserved."

    ATATATATGGATATACTTATATGAACTCTCTCT
    TATATATACCTATATGAATATACTTGAGAGAGA

  16. Open/Closed - it's *GONE* on Analysis: The Rise Of Open Media · · Score: 2

    he forget to pay NIC?
    White House Cyberwar?
    Throw in the Towell?

  17. And where's Matt Drudge on Analysis: The Rise Of Open Media · · Score: 2

    currently failing DNS Lookup
    ???

  18. Why would anybody want a computer that on Electronic Circuit Mimics Brain Activity · · Score: 1

    thinks more like humans? That is, a computer that repeats unreliable gossip, makes wild guesses when it doesn't know the answer, tries to cover up it's mistakes and blames the computer in the next cube, calls in sick when there's something better to do, procrastinates, has hidden agendas, is married to a plain wintel box but secretely is in love with the well endowed cluster in R&D, worries about it's retirement plan, thinks it deserves a raise and the corner office but is discriminated against by office politics...

  19. What, no Total Perspective Vortex on Douglas Adams Answers (Finally) · · Score: 2

    question? Jeez, that's what I get for leaving the questions to others.

  20. Ya- the irony is killing me :)) on Microsoft Office On OSX, *BSD, *nix? · · Score: 2

    soviet union, china, nazi germany

    Funny, these are all governments


    Ya, those of us who don't favor complete degegulation (probably includes legalizing drugs, gambling and prostitution, peddling bleached meat and autos with known defects as well) are branded with a govt political label, while the open standards which the Internet was built on and laid out in the RFC's were largely govt sponsered and came from defense dept projects!!

  21. That's the subtle question on Microsoft Office On OSX, *BSD, *nix? · · Score: 2

    So every time I want to add a new feature which the existing RFCs don't cover

    Certainly people who innovate should be allowed to collect the fruits of their labor - but there's a fine line between innovation to improve something and using a dominant position to lock out competitors. The question boils down to (to me) did Msft make proprietary changes to the open Kerberos standard to improve it (I'd love to hear exactly what those changes made better for the consumer) OR were those proprietary changes made to make other vendor's open std Kerberos products incompatible in an attempt for FORCE the consumer to switch to an all Msft shop? If the private altered standard adds no value for the consumer, but locks out competitors, Msft has a serious problem. If it does add value but, opps sorry, has the side effect of locking out competitors they can probably get away with it.

  22. Psychological Warfare on Microsoft Office On OSX, *BSD, *nix? · · Score: 2

    1st, there's sort of a contradiction in your post - you want companies to be unregulated and free to practice vendor lock-in with unpublished API's that competing vendors don't have access to, and then claim that people in the market have 'freely chosen' to use the product, as if it were on a level playing field w/o hidden tie-ins and tight integration (a plus, granted) that other application developers don't have access to! Msft may have won the desktop DOS OS market by various legal means (knighted by IBM, or chosen as 'best OS' by expert microcomputer users) but to use THAT legal monopoly to leverage OTHER products to monopoly status by changing unpublished API's and being a general ass to potential competitors is clearly NOT legal!

    Anyway, with the price of Word® hitting $280 / user we just may be forced to bite the bullet and retrain people on something else that doesn't have a hook set in their jaws for the vendor to yank on when then need more fish!

  23. Dudes, the opposite of 'logical' is... on IBM Promises Logical Volume Management For Linux · · Score: 1

    'physical', not 'illogical'. Well, ah, I guess 'physical' is pretty illogical at that now that you mention it, nevermind :))

  24. While searching for an icon - on Classified Data Missing From Los Alamos · · Score: 2

    I found this "top secret" web page at pbs. Cheesus, here's the nuclear HOWTO (plutonium not included). Ok, here's the picture gallery - you guys pick one, someone's knocking at the door.

  25. Re:Difference in security. -Seriously on Classified Data Missing From Los Alamos · · Score: 2

    Somewhere I read that somplace was so paranoid about info leaks that hard disks were actually dissolved in acid. I think it was the old removable disk paks.