Slashdot Mirror
Human Genome Mapping Completion TBA
rit writes: "According to this CNN article, both The Human Genome Project and Celera Genomics, Inc., two groups who have been working on mapping the human genome, are scheduled to hold news conferences Monday in which they will announce the completion of the Human Genome. This should prove interesting, and makes me wonder: what will we do next?"
Mapping that region of space where that 1 sock escapes to from the dryer.
The Blaster Master Fighting for Truth, Justice, and Evil Pie since 1979
Spend years discussing the moral aspects.
-- http://thegirlorthecar.com funny dating game for guys
what will we do next?
I'm sure we'll find something else interesting to do.
mapping the the genome of other humans.
I wonder if the people working on the Genome project use GNOME (1.2) because it's so nice..
Mike Roberto (roberto@soul.apk.net) -GAIM: MicroBerto
Berto
What abominations await my "raza" now that the human genome is in their sights?
Are you adequate?
What we do next ought to be obvious. Corporations/organizations/institutions must get together and figure out how to use this ethically. Surely, if we can cure multiple sclerosis, can't we cure [your_least_favorite_skin_color_here]ness?
That ought to be a high priority of all involved. Or if you mean, what will technology do next? Flying cars and colonies on Mars.
Let me check the timetable...
Ah yes, then we start preparing the humans for the alien colonization and takeover of Earth.
With this genome information, we can finally perfect The Black Oil!
---
pb Reply or e-mail; don't vaguely moderate.
pb Reply or e-mail; don't vaguely moderate.
Human genome done
Now move on to real challenge
Special hacker genes!
------
------
You are in a twisty little maze of open source licenses, all different.
Mapping the genome means hardly anything... Which one of those strands is to blame for cancer? Which one is to blame for chronic backpaine? How about killer migraines? Or perhaps congenital heart problems? They mapped it, big deal. Now let me see the expert who will find what each of the billions of strands mean, and try to alter those. There are some discoveries already, but hardly any which would put prostate cancer patients at ease (i.e.). Good luck :-).
'A lie if repeated often enough, becomes the truth.' - Goebbels
We haven't been back to the moon in decades. Is the human genome doomed to the same fate? Now that we've seen it, will it simply be filed away and taught to third graders?
Well. That is a bit ludicrous. Does anyone know what we actually can do with this information? Things like growing modified human clones (with, say, an eye in the back of the head) would never ever pass any kind of review board. What is the practical application of this work?
I work for one of the big pharmaco's. Over the last few months we've seen a serious acceleration in the amount of data coming in from these projects. They expect to have storage requirements of near a petabyte within 4 years as they crunch all this new data. Sun is going to love us...
I predict that as these functions are identified, genetic research companies will patent tests for specific genes (if not the genes themselves.)
As a result, actually getting the benefits of these tests - like early warnings for predicting diseases etc. - will cost way more than it otherwise would, in order to pay the license fees the patent holders will demand (kind of like how brand-name drugs cost more than generics.) People with insurance that covers such tests will be fine, but people will find it harder and harder to get insurance as companies begin raising rates based on the results of such tests.
Some European countries will pass laws preserving individual rights to privacy which will prevent such behavior from insurance companies, but in the US it will take abuse from HMO's and insurance companies before Congress passes laws providing a weaker form of protection.
Of course, my crystal ball may be on the fritz. Check back in a few years and we'll see if any of this comes true... ;)
Celera
Neither of them seems to have reported anything on the news conferences, though.
-hk
Therapy is expensive. Bubble wrap is cheap. You choose.
The map is not the territory. We'll now know where the countries are on the continent, but we need to know where every road is and what the differences are between countries.
Finally, don't forget this is just a first draft - there's still a lot of donkey work required to map out tricky regions and to verify already covered regions.
"Just once, I'd like to meet an alien menace that wasn't immune to bullets." -- The Brigadier, Dr. Who
Celera and the government funded Human Genome Project are going to announce project completion simultaneously. Surely this is political. The question is, which one of the two is the "most complete"?
This project is probably equal or greater in scale to the Manhattan project in it's potential effect on humanity. For the next 50 years, we're going to be worrying how bio-genetics will be misused while reaping the benifits of a new revolutionary technology. I wonder what will be the equivelant of "duck and cover"? Hold your breath for as long as you can?
Humanity's revolution for the next two decades to be feuled by bio-genetic discoveries, not by advances in computing power (not that one didn't catalyze the other)
When the project started a few years ago, the world was excited by the possibility of knowing what every single gene in humanity did. After all, if we understood what is is that makes a human a human, perhaps we could cure genetic disease and maybe someday improve ourselves...live for hundreds of years, whatever.
What most people fail to grasp, however, is that the Genome project is only the first and earliest step in this process. Sure, we have mapped the human genome, but we still don't know what most of them do. There could be 40 different genes that affect height, for instance, and the only way we have used in the past to figure out which genes do what is to screw around with genes in an egg and see what kind of baby comes out of it, like in fruit flies or mice where thousands of genetic experiements have been done in the past. I hope it goes without saying that this research technique is not possible in humans.
However, we still want to learn the functionality of our genes eventually because, both medically and sensationally speaking, that is the supposed eventual goal of the fruits Genome project.
Now, I pose a question to slashdot readers. I'm primarily a web application developer and don't really know how far the field of computer modelling has gone in terms of biological systems, so now that we've mapped all the genes, how much longer until we can create a system to mimic the human body closely enough to try our genetic experiements out digitally? Because until that point, I really don't see what good the Genome has done for us.
The aplications of science like this are boundless. Many people are frightened of technology such as this evolving, but we must embrace it to learn from it.
Get your own Red Swingline Stapler
Early next year you can start by gett ing your own genetic profile. Mail in a few cells and see what you're made of.
if its like any other sort of technological advance, well, if the hard work is done...ITS TIME TO SUE SOMEONE!
This announcement (assuming its accurate and the gene is actually mapped) just means that they're at the point where they've got a genetic Rosetta stone. It was a big job, it was important, but it isn't the final outcome. It's just a significant milestone.
The next step will be determining the purpose of each part the genome. This is the act of translating the genetic Rosetta stone. This is a significant milestone. It still isn't the final outcome.
Once this information is known it will be time to try and influence genetic makeup in a controlled and predictable manner, resulting in the potential for: new treatments for diseases; in utero or in ovum genetic modification; genetic enhancement; organ growth etc.
I know I'm jumping the gun a lot here, since we can't do much more sophisticated things than cloning a sheep and curing cystic fibrosis in lung tissue that is not attached to an organism, but...
It strikes me that genetics are a lot like source code, and that we've sort of reverse-engineered a template for writing this code.
So the big question is: when they start coming up with genetic enhancements to make us smarter, stronger, and more fragrant, are they going to be packaged in such a way that we can't tell what they are without doing the whole reverse engineering process over again (i.e. MicroSoft Harry), or are the specs going to be put out for all to see, so that we can all create our own personalized monkey-men (i.e. GnuMonkeyMan)?
I'm a little disturbed by my own post.
"Beware he who would deny you access to information, for in his heart he deems himself your master."
This is a fun time to be alive, and I'd love to see if there are any interesting results if one were to gzip DNA. I'm sure there are all kinds of interesting thing you could learn from just that.
Marxism is the opiate of dumbasses
OOOHH!! I know!! Fight over the patent rights!
The answer to "what will they do next?" is fairly obvious: they'll patent the human genome. Never mind the fact that it's laughably unpatentable; we all know that the USPTO is so screwed up that the patent will be granted, effectively freezing progress in this sector, potentially for decades.
--
Tired of FB/Google censorship? Visit UNCENSORED!
Merely mapping (which I don't think that they have, considering we don't even know when we stop mapping the human genome.. it's not like there is a big sign that says, "You have reached the end of the genome, thank you, now go home") doesn't achieve ANYTHING. At all, I wrote DNA analysis software to identify possible "interesting" strands as they went through the processor. The methods used to map DNA, if just stuck in there will contain A LOT of contamination and misreads, hence their so called complete map is one that would be analagous to that drawn of a third grader with a crayon. Granted, they are doing a significant amount of research and should be commended for it, but just mapping doesn't mean anything.
The thing that I really have a problem with is that Celera just dumps all their gene reads into the patent office and gets rewarded the intellectual property for said read. This is complete crap - they did not discover anything that should be worthy of a patent. Maybe we should branch off a new patent office for this type of work. The read should be forced to be open and free to use after 3 years maximum, this will stop someone who figures out the gene for cancer, obesity, intelligence, whatever from forming a monopoly screwing us out of healthy, slender, really smart people.
However, I know a lot of you think that this work would not be done if they didn't patent this work so they could sell it to pharmo's to make money. You are right, they should be able to have limited commercial rights to it. The ability to cure a plague upon humanity should be a non-commercial engagement.
Just my overly long $0.02.
nerdfarm.org
Dacels Jewelers can't be trusted.
I doubt it. That would imply that most people are actually concerned about the moral imperative. It's like the A-bomb, lets make it, try it, then decide it's wrong.
I need a TiVo for my car. Pause live traffic now.
Minority? What the hell are you talking about? I'm not in a minority! Hint: There's a world ouside your country where you would be a minority.
This technology will have to be tested on people before it can be used for the good of mankind.
Don't give me your talk about "for the good of mankind". Say it straight: "so some hotshot unitedstatesian millionaire makes a buck from the genetic deformation of third world peasants".
Instead, the technology is created by the highest bidder, who tests it on the lowest bidder. In the words of King Missile, "That's reality. That's the way it is."
Yeah, that's so convenient for unitedstatesians on top of the food chain like you. Don't be surprised if the rest of the world has a different idea.
I'd remind you that, as a group consisting largely of "computer people", we know better than anyone else that you learn twenty times more from your fuck-ups than from your successes.
You're euphemising with "fuck-up". Why don't you say what you mean: "We learn twenty times more from making Guatemalan women bear deformed children."
In conclusion, human testing is sometimes necessary, and we should force it upon the Amish.
You end up sounding like the Japanese would have said of Koreans in WWII.
Are you adequate?
How long until we see the slogan "Engineering a Better Human"? Who decides what's better? What's the criteria for good and bad genes? What is freedom and what is insanity in the case of gene manipulation? This will be a cure for cancer, and a weapon that will kill millions.
Now, what precisely is our point of disagreement, since you call me a troll?
Are you adequate?
The project was originally expected to take 15 years. That was what? 5 years ago?
:) I love this field; six months ago qualifies as ancient history.
Three months ago, I went to a seminar on Bioinformatics - and it was stated that the project would probably require another two years to complete.
Now, about that protein folding problem...
-- What you do today will cost you a day of your life.
We'll finally have the script to our bodies. Whether you believe in God or Evolution or some combination thereof, this is a landmark event. For the first time, a species will have the ability to view and eventually change its own blueprint.
My fondest hope is that our society will be able to catch up enough with technology, so we can deal with this the Right Way(tm). I think Gattaca had some very relevant messages, that need to be discussed as we move into this technology. We the public need to be very aware right now of what is happening with the patenting of genes. There is a great potential for abuse.
I'm glad that both the public project and the private sector will be announcing this together. The Human Genome Project immediately publishes their data on every night. You can be sure that Celera's downloads it every morning. It would be an affront to the scientists who did so much work in the public project if Celera tried to steal all the credit.
Be sure to check out the Charlie Rose show this week on PBS. He has been running a week long special on all this. I highly recommend it.
The more you know, the less you understand.
(We'll ignore the thorny issue of genetics-as-IP for the moment)
As I recall, large chunks (if not the majority) of our DNA is really junk information, stuff that doesn't really _do_ anything. Sorta like the bit-rot that accumulates on hard drives after a couple of years of use. That fragment over there used to be part of a tarball I deleted, that over there was part of my mail spool, and so on. Areas that once held information, but are now marked as "free blocks" and so unused.
It wouldn't suprise me to find little chunks of "how to grow a tail" or "how to put bright blue pigment in your buttocks" in human DNA.
So from the point of view of someone hoping to make money off the annotation process, you've got to hope you annotate something that's actually part of the program, instead of "how to grow gills and scales" or some such.
That strikes me as a lottery, not a business model.
BTW, can somebody in the know comment on how the annotation process works? How do you know what gene [foo] does without actually flipping it and watching the results? Do we have a good enough understanding of the inner workings of DNA that we could model it, and simulate flipping the bits?
Want to learn about race cars? Read my Book
Easy; the one from Celera. Why? Because the scientific effort didn't make any attempt to apply something like the GPL to their data. That means that Celera is ahead and always will be ahead because they can combine their privately generated data with the publically generated data to get a more complete picture. The result is the Celera will be able to make a big profit by selling data half of which was funded by government sources.
A strong license might have been able to force Celera to release data that incorporated the publically funded results under less restrictive terms. Instead they can grab all that public effort, combine it with their own work (which is admittedly pretty impressive) and sell it back to people. It hardly seems fair.
There's no point in questioning authority if you aren't going to listen to the answers.
Next up, the field I'm prowd to be working in! Bioinfomatics, people!
The nucleotide sequences don't mean anything unless you interpret them. That's where massive data analysis comes in. Protein sequences have to be isolated, the shape and folding of the proteins simulated and their interactions catalogued.
Additionally, there is gene expression data to combine with genomic data - there is no good in knowing what a gene is unless you know how much protein is being made from it. Here comes in the cDNA microarrays which measure just that. (cDNA microarrays work by figuring out how much mRNA (the template for proteins) for a given gene is in a certain type of cell, and do this for 5000 or more genes at a time)
With comprehensive parallelized databases of all the genes, with protein and expression data, we will be able to do much more with the genome than a bunch of letters.
it's life size.
(with a nod to Steven Wright)
--
+&x
It's odd to hear that *both* Celera and the HGP are announcing "completion" of the sequencing. Keep in mind that as recently as late last year, the HGP was loudly criticizing Celera for their reckless and largely PR-driven approach to human genome sequencing.
This could suggest a couple of things, IMHO:
1) Celera and the HGP have managed to reach some agreement on IP and the sharing of information between the two efforts, thus ending years of bickering, and providing a more complete map than either could accomplish alone (to date).
or
2) The HGP is racing (probably against the better judgement of its member scientists) to keep up with the steady flow of BS PR that comes out of Celera. For some reason (probably the cynic in me), I think this is the more likely case.
I've never been a fan of Celera--I've read their published data on the fruit fly genome (declared "substantially complete" BTW), and was amused to see coverage gaps big enough to drive a few hundred genes through. This concerns me a lot--once we allow corporate interests to drive science, will we see a degradation in the quality of basic research like this?
Let's try not to let fact interfere with our speculation here, OK?
I think structural genomics which is also being researched is provides useful information to complement the genome project. This is the 3D structural determination of protein domains based on the amino acid sequence of the protein. With a database of these structure-sequence relations, when a new gene is encountered, the the 3D structure can be inferred and from there drug design and all the other medical benefits people talk about are possible.
As someone doing his PhD research in bioinformatics and computational biology, I'm surprised that no one here knows that what both Celera and HGP are announcing is not the 100% complete, every base is sequenced, here's the whole thing on a 3.2 Gb disk for you. They're announcing that they've assembled most of what they have into a reasonable approximation to the true sequence, with substantial sequencing errors and misassemblies left to be worked out over the next few years. Think of it as having finally finished scanning the pages of the complete works of Shakespeare, and running a first pass OCR algorithm on it - you've got the data, you can see where the plays start and end, and even alot of information about acts and scenes, but alot of cleanup and closer examination is necessary before you post it to ebooks.org
Unleash our legion of genetically-enhanced mutant killers!
Isn't pointing out what has happened in similar historical circumsntances work in that direction?
Are you adequate?
"Get good cryptographers to look at it, see if they can find patterns"
...find a pattern that rought translates:
"Congradulations! You finally figured it out - signed, GOD"
or
"This code derived from original Andromeda strain implanted Sol+14097, Copyright Andromeda Bioengineering, Galactic Diversification and Colonization Corporation, all rights reserved."
ATATATATGGATATACTTATATGAACTCTCTCT
TATATATACCTATATGAATATACTTGAGAGAGA
try { do() || do_not(); } catch (JediException err) { yoda(err); }
Obviously what you want to do is exploit those therapies that can generate the most revenue either directly by purchase because the greatest # people want it, or indirectly because existing therapies are too expensive. So what are some candidates?
Weight loss
Body sculpting
Alcohol/substance abuse
Sex therapies
AIDS/HIV (treatment not prevention)
Multiple Sclerosis (probably the most expensive disease from an insurance co's. perspective)
Anyone who thinks that the first one thousand applications will include anything to improve the lives of the poorest 4/5ths of the world's population is simply dreaming. Hell we don't even care if they have clean water to drink which over a billion people don't.
So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.
Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?
The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation. With this sort of track record how are we going to do against diseases that are caused by multiple mutations or where different individuals with the disease have different mutations? And this isn't even considering diseases that are caused by interactions between interactions between the gene and environment/history of the individual or disease caused non-genetic inheritance.
It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.
"When you sit with a nice girl for two hours, it seems like two minutes. When you sit on a hot stove for two minutes, it
Only part of the DNA is actual genes. Genes look 99% or more similar from one animal to another, and the major difference between e.g. a human and a mouse is in the other "garbage", outside of the genes.
Also, not all genes are necessarily in use. One key to understanding which ones are "turned on" and which ones are not, might lie to understand that "garbage" outside of the genes.Compare to a software application; the genes are the data, while the stuff outside is the actual instructions which tell how to read that data.
Celera is now about 1/3 on the way to sequencing the mouse genome. Being able to compare genomes from different animals might give us some further clues to understanding ourselves./P.
You have the Genome
Return to base
our written thoughts are gifts to our future selves
Now that they have completed the Human Genome Project, they can get to work on things like the Ascetic Virtues, the Morgan Energy Bank or possibly the Space Elevator.
Though I am sure the Ascent to Transcendance is a few years off, at least in the southern U.S where some areas are still trying to ascend to the 20th Century, but anyway.....
Given a sequence of aminoacids (which is exactly what this allows us to do), you can theortically predict what a protein or an enzyme will look like and how it will behave. We have only had slight success in modelling this on computers. My analogy is that it's as difficult as rolling 2 dice and predicting how they're going to land. Sure, if you know their starting position, and account for every physical force that is exerted on them until they come to rest on the table, then yes you can predict their behavior every time! That's a bad analogy, but it's a good way to describe how the slightest error in measuring the forces and location of stuff can throw the predicted results way off. Remember every electron counts at that scale! So if you build these models well enough, you can for example synthesise a new protein to be used as a drug, based on the knowledge that such-and-such a disease is caused by this or that problem within a cell. ie if you know what the problem is, you can mathematically crunch with brute force until you find a model to fix it.
Given a sequence of aminoacids (which is exactly what this allows us to do), you can theortically predict what a protein or an enzyme will look like and how it will behave. We have only had slight success in modelling this on computers. My analogy is that it's as difficult as rolling 2 dice and predicting how they're going to land. Sure, if you know their starting position, and account for every physical force that is exerted on them until they come to rest on the table, then yes you can predict their behavior every time! That's a bad analogy, but it's a good way to describe how the slightest error in measuring the forces and location of stuff can throw the predicted results way off. Remember every electron counts at that scale! So if you build these models well enough, you can for example synthesise a new protein to be used as a drug, based on the knowledge that such-and-such a disease is caused by this or that problem within a cell.
Æther SPOON!, blah blah blah. "God, Root, What is the difference?"-userfriendly.org
--- Ãther SPOON!
a herring!
Okay, so we should either halt AI research, or halt Genome research for a while, because no one wants an AI computer cracking the genome faster than humans can, and then releasing a killer virus so the AI can more easily take over the world...
Legislation can be passed to prevent this sort of BSD-ish corporate cannibalization. Whether or not Celera invested millions into their research is irrelevant in the court of public opinion, where some enterprising senator will likely spin the issue as 'selling humanity' and nail Celera's more nefarious profit motives to the wall.
It's too easy not to do it (start up a backlash against patenting parts of people, as it were). The religious right will be all over it like a rash -- for once I happen to be pleased that they're a force.
Venter is a great guy, and an engaging public speaker, but he has many reasons to be bitter towards the established academic community of molecular genetics. And that's why I don't trust Celera to resist compromising Venter's stated principles in pursuit of profits.
Remember that what's inside of you doesn't matter because nobody can see it.
Now I can finally get that third arm I've been griping about all these years. Or maybe I really will get those eyes in the back of my head!
The heart has reasons that reason does not understand. - Jacques Bènigne Bossuet
"This should prove interesting, and makes me wonder: what will we do next?"
Die, most likely.
We're going to Disneyland!
Heh heh. Sorry... had to be done.
Information wants to be anthropomorphized.
Knowing the amino acid sequences is a big key to being able to figure out how things work. Some examples:
There's no point in questioning authority if you aren't going to listen to the answers.
I've already reserved the domain name and patents for my new site, geneticmapquest.com. All you have to do is enter a starting and destination genome, such as pig -> elephant, and the system gives you a generation-by-genration breeding and genetic modification roadmap. Of course I'm only leasing the directions to you, and any derivative work remains my property.
Yo dawg, I heard you like the Ackermann function, so OH GOD OH GOD OH GOD
Excellant reading material!!! http://user.tninet.se/~sum315r/piss/content/28.jpg ">Here is" a great link to a related story.
I can just see the headline now:
God sues GenCo for patent violation on the Human Genome. God is quoted "I created and have 'soul' rights to DNA multipulation. Reversing engineering the Human source code is against the terms of use contract you agreed to by being born. I will have to revoke the use of Human DNA from all GenCo employees, unforunately you cannot live without DNA...sorry."
Remove the spam reference to email
Reading many of the posts here I see a misconceptions that runs through them. Firstly, I am not a Biologist/Biochemist when I say this: but DNA does not define who we are, proteins make up who we are. Of course, where do proteins come from? DNA of course. It's a chicken and egg dilemma. Which came first?
Regardless, know that we have HGP completed, we can start finding what sections of our DNA make what proteins. This will allows scientists to isolate and research specific bodily fuctions. To me, someone who identifies a gene or a section of DNA really hasn't do anything until s/he (or someone else) researches the complex protein process that results from that section.
There is a reason that scientists say we are 90% similar to chimanpeez (sp?) DNA-wise. We (as humans) are about 96% similar to each other in terms of our DNA. But it is our proteins that (at fetal development) determines whether we have two arms and legs with five digits each, or fins and scales. If you think about it, there is nothing really that dissimilar between human beings and most other organisms (on a inter-cellular lever). Dogs have hemoglobin just as we do. Tulips have caroteen (sp?). I know it is hard to say humas and earthworms are that similar but the truth of the matter is we are.
So the real value of the HGP isn't necessarily the DNA but the cellular/biological processes that are governed by them.
Yeah, right.
Do we throw out all the research that the Nazis performed on the Jewish populace under their control? No, we gained a LOT of valuable medical knowledge from their research and experiments.
Good and evil are relative terms in scientific research. Humans, monkeys, rabbits, carrots...to a pure researcher, they're all merely test subjects.
There are a few things that control how much support(money) a research grant will entail, but Good/Evil is not one of them. Rather, its replaced by public opinion.
Perhaps, in itself, that is an evil philosophy.
-Veldrane
now that we have the source code to the human body, we need to : 1) figure out how to read it! (what use is source to someone who doesn't know c?) 2) reform our obsolete intellectual property laws, before (as someone posted here a while ago) we owe royalties to dupont and lilly for our children. i don't want to have to save up to pay for genetic-royalties BEFORE conceiving. or afterward. saving for college (or paying college loans) is bad enough, imagine the price they'll put on custom human genetic material??? here, if anything, is something that should be gpl'ed!
Whu tha FUCK. Fuckin html linux bullshit. Fuckin gooks overseas takin my job. Whud tha FFUUUUUCCCCCKKKK!
Oh, you meant here on Earth, in the present. Oops.
Damn I'm bored.
--
$x='S24;r)>63/* h@<5+oZ)32"5cz';$me='phroggy'x$];
$x=~y+ -xz+\0-Tx+;print$_^chop$me for split'',$x;
Hey we just might be able to sync the Star Trek timeline with reality. I think around this time in the ST world the Eugenics wars are going on right now.
> It wouldn't suprise me to find little chunks of
:)
> "how to grow a tail" or "how to put bright blue
> pigment in your buttocks" in human DNA.
Blue buttocks - oh hell yes! I could change my name to 'Smurf-Butt'. Most excellent.
Even better - it's time to haul out those interesting science fiction books of yesteryear and find out what other cool ideas we can mine, such as:
1) Distribute the function of the heart throughout the body in smaller 'modules'. Shot in the chest? Not as big a worry...
2) Faster healing
3) Ability to regrow lost limbs
4) Better senses
5) Gills for the water-freaks out there. Hell, that would truely be awesome. Guess what - lots more usable living space on the planet just opened up - it's a little wet, but that's no longer a concern, is it? LET my castle sink into the swamp! (but NO SINGING)
6) Harder bones
7) Built-in smog/cigarette smoke filters - or filters for anything toxic. Same thing for what we ingest - e. coli & other things filtered out - lead contamination filtered. Lots of possibilities here.
8) Ability to consciously control the melanin levels in your skin - lighten or tan right away!
9) TRULY change the colour of your hair and eyes.
10) Control hair growth patterns - want JUST a mustache, and only where you want it? No problemo. The final solution to shaving. Nice.
11) Grow your hair faster - or slower.
12) Body sculpting - fat loss, muscle building, etc. Of course.
13) Height/weight adjustment
14) Change the body so we metabolize *all* food - never go to the bathroom again! Time to change the exits.
15) Natural body/breath odor eaters...I remember a novel where a artificially-created 'pleasure' female was made so that it smelled like flowers when she farted. Heh. Good planning.
16) Stronger fingernails.
17) Better skin - better at resisting cold, heat, pressure, pain, etc.
18) Upgrade the information processing capabilities - make the brain work faster, make the eyes/brain bit faster so you can see more 'frames per second'. Better hearing range - have better hearing than animals! Not sure how much that might be desirable, but you'd get used to it. I remember another novel ('Telempath', I think, by Spider Robinson), where a madman releases a chemical/virus/whatever that gives humans a sense of smell equivalent or superior to dogs - most people go insane from sensory overload, and society is forever changed for those who survive. Interesting read.
19) Okay, I want cool eyes like cats. Those just look gnarly. *meow*
20) The above-mentioned tail could be quite handy! Good for picking up chicks, I bet.
21) Fangs. 'nuff said.
22) Claws. Sure. More like Spiderman 2099, less like Wolverine
23) Hey, speaking of Spidey - how'bout natural webshooters? Nice if you fall off a building or something.
24) Better control over vocal chords - everyone becomes a fantastic singer - well, everyone has the EQUIPMENT. Still gotta get some training.
25) Total control over reproduction - sex without sperm production and egg creation.
26) Colour me like a zebra! Or not. Maybe more like a white tiger.
27) Hey - maybe I could look like one of those dancers from Cats! THAT would RAWK.
28) Read another book where they re-engineer soldiers - harden the skin, better eyesight, CNS (central nervous system) implants for access to many things. Also made the penis & scrotum 'retractible'. Okay, weird, but I'd probably opt for that.
29) hey, let's make those fangs optionally poisonous while we're at it.
30) Tentacles! With suckers..."Hi, my name is Cala. Last name Mari."
31) Feathers. Or scales. Leaves? Hmm. Great camouflage possibilities here...
32) Ohhh...poisonous spines - like a porcupine! A whole new age in warfare...
33) Maybe 'Skunk Power'!
34) Okay, now wings would be interesting - even if they're just decorative. Perhaps visions of 'Angels' in the past were just visions of the future! Think about it...you could _really_ screw with the religious folks here...
35) Everyone has total recall! And I'm not talking about that bad Arnold movie, either...
36) Radiation-proof - good for interplanetary travel. Put your DNA in constant 'Diagnostic Mode' - any damage done is immediately corrected.
37) Abilities associated with idiot-savante's - lightning calculation abilities, etc.
38) Noone is ever tone-deaf. Ever.
39) Everyone hates country music. And disco.
40) Control over metabolizing alcohol - no more drunk driving with 'InstaSober(tm) Genes from RonCo'!
41) Control over sneezing, hiccupping, vomiting, etc.
42) Control your blood sugar. No more roadrage! No more Diabetes.
43) Adrenaline control. Caffeine industry is now gone. Nice knowin' ya, Starbucks. Same for the rest of the drug industries. Columbia becomes dirt-poor again. The drug cartels start investing heavily in Celera. Celera HQ is moved to Bogata.
44) No more need for computer-generated creatures in future science fiction movies. Actors can control their own forms and voices! Pixar and ILM go bankrupt.
45) Now that everyone is so smart, the world realizes that open source software is the only way to go! The Penguin enjoys new-found popularity at zoos.
46) Mermaids become reality! Mermen, too (Aquaman!)
47) Everyone now has perfect balance and coordination - sales of inline skates, surfboards, and other such products skyrocket.
48) Telco's are pressured by law to provide fiber-optic OC48 speed access to each computer - 56K modems are just too slow for the 'brain-enhanced' public of the modern era. People can read faster than 56K now!
49) 3D chess replaces regular chess in all major tournaments. Regular chess is just too easy - commonly played only in preschool.
50) Nictitating membranes. Oh yeah.
51) And Vulcan ears, too!
52) Women become much happier with new 'Nimble-Tongue'(tm) Genes for men.
53) the N.O.W. Genetic Research Centre funds 'Vaginal Teeth' genes...ouch!
54) Basketball baskets are quadrupled in height. Football fields are much bigger. Baseball bats are made out of much stronger materials (as are the baseballs, footballs, and other sports equipment).
55) Speed limits are abolished - everyone has reaction times sufficient to make them redundant. Traffic jams are mostly a thing of the past due to this, and transportation flows much easier.
56) Since people are now smarter, mass transit & renewable energy are now in much higher demand. Pollution is demanded to be reduced, plus it's easier for the smarter engineers and inventors to figure out how to do so.
57) Wars are ended. Religions are abandoned. The Taco Time 'Crisp Burrito' is finally given the praise it so richly deserves. Telecommuting changes the face of the world when it becomes the norm. Children grow up with parents as they're also educated remotely in the same dwelling where their parents work.
58) Life is so good, the 10-hour work week becomes feasible.
59) With all the new senses humans have, art and literature, movies and music, indeed ALL creative endeavours, reach new heights, putting the classical arts to shame.
60) the new 'SmartHuman' (Homo Genius?) recognizes 'Battlestar Galactica' for the brilliant show it really was. And Pops Racer finally figures out how to put a friggin' LOCK on the trunk of the Mach 5. No more stowaways. Spridle and ChimChim can now increase the sugar in their bloodstream anyway, so there's no need to try freaky plans to get candy.
61) the ISA bus and all legacy devices that attach to it, are _finally_ dropped from computers.
Okay, so the last one is a stretch. *shrug*
Little potbellied elephants, or how about giant pigs? Or both... Create potbellied elephants for pets, and giant pigs for food. I'm sure the inventor of the giant pig will get an award for solving the world hunger problem.
And here's another interesting idea - put to use the info gathered by the HGP and Celera, and work on modifying our genes to make us smarter, stronger, and more productive.
Chris 'coldacid' Charabaruk Meldstar Entertainment
The problem with the genechips (and IIRC they normally look at mRNA, not cDNA) is that there's not that strong of a relationship between transcriptional level and translational level. If you really want to know about levels of protein expression (and more importantly, differences in level of expression) you're going to have to look at the proteins themselves. Good thing that's what pays my bills. Of course then you have to realize that the level of protein expression doesn't necessarily equate with protein activity and you have to look at post-translational modifications ...
There's no point in questioning authority if you aren't going to listen to the answers.
A lot of credit should be properly accorded to the sequencers of course.
Granted, sequencing is so routine that it can be done by a bunch of monkeys (the quote's Jim Watson's, not mine so go yell at him). But that's only half the story : the hard part is getting putting together the system that allow the bunch of monkeys to sequence them. The computers, the algorithms, the $$$$, the political will, and the dedicated bunch of people who are doing admittedly tedious work (akin to copying out the Encyclopaedia Brittanica in Greek without knowing what Greek is.)
So, we should accord them the highest honours for pulling it off.
Mode (3) smart-aleck mode. Press * to return to main menu.
Genome 'Dark Horse' Comes to the Fore (BBC, 8 May 00)
Dot-Comming the Genome Race Wired, 8 May 00
For more, you can see our Biotech page.
A. Keiper
The Center for the Study of Technology and Society
Washington, D.C.
that they sequenced. When are they going to do mine? the j
.sig available on 'Need To Know' basis only!
A the head of Celera himself said in recent Congressional testimony, "There is no example of the results of any genome sequence project being published in the scientific literature prior to meeting the established quality, order and completeness standards. It would be poor science policy and a terrible precedent for the young genomics field." (My emphasis.)
Of course, there aren't all that many published genomes altogether, are there? Those established standards for quality, order and compelteness are arbitrary, and peer review is sort of an odd process in a case that has seen so much public political ballyhooing. With the fruit fly genome, several minor errors were discovered and corrected - but remember that even very high accuracy (say, 99.5% accuracy) can mean many thousands of errors in a database this vast.
So the next few years will be spent tidying up and cleaning up the data. But the key areas will be ascertained first, and those will get the most attention. And then - even as we speak - people will be busy annotating, and trying to find correspondences between gene sequences and phenotype - that's the huge task of figuring out just what this vast porridge of G, C, A and T means.
For more, see our Biotech page.
A. Keiper
The Center for the Study of Technology and Society
Washington, D.C.
...You both get dirty, but the pig likes it."
Now, if only I could diff and figure out what went wrong.
Phluid!
Now they just need to start the biggest reverse engineering project ever. I wonder if it will prove to be easier than reverse engineering microsoft file formats.
Phluid!
What we'll do when the human genome is completely mapped is being discussed almost daily among scientists. The post-genome era has become a big buzzword.
One very convincing idea goes like this:
- you have a problem that you'd like to tackle
- analyze sequence data in lioght of your problem
- filter out interesting trends/data points
- develop a high-throughput assay to test for what the sequence data implies
- analyze test data
In other words, start on the computer, end on the computer, work in the lab in between. Sort of like what we do with literature already. You can, of course, compare the genome and related sequence data to literature anyway. It simply has be be read and understood. (No that we know a lot about the latter activity, but that's another story.)
At a recent event I attended, an intersting example was given by Dr. Wei Hu, formerly of Human Genome Sciences, Inc.:
They were interested in prostate cancer and therefore looked at ESTs (expressed sequence tags) from tissue samples of various stages of prostate cancer, as well as several other unrelated tissue samples as controls. The analysis simply consisted of looking for sequence tags that consistently turn up in prostate cancer, but not elsewhere. Half a dozen or so sequences were found and most proved to be known markers for prostate tissue, especially cancerous prostate tissue, but one or two were new. This all was only a few hour's work.
Further research might then entail chasing these new markers, perhaps developing a simple and cheap assay for them, and voila, a new test for early stage prostate cancer. In practice this is of course not nearly as easy as it sounds, but you get the idea.
With the complete human genome available, one would of course compare the sequence tags against the genome to find where they are, with what other regions they are asociated, what gene they come from, etc. This would dramatically increase the information content of the simple exeperiment that was done and described.
The upshot IMHO is that biologists will dig much less in the dark, at least as far as sequence information goes. Checking the genome and other sequence databases will be just as mandatory and routine as a trip to the library is today. This in turn means that biologist will have to become much more computer-savvy, or that biologists and computer geeks need to develop closer ties.
One thing to keep in mind, though, is that the upcoming announcement is only for the mapping of the human genome, i.e. known markers will be placed along the genome in more or less regular intervals. This amounts to a lowres image plus many (most?) parts of a highres one. The actual full genome sequence is still a ways off as gaps need to be closed in difficult regions and other boring cleanup work needs to be done.
The next step is the part that is going to be a killer (and also the step that will change the world). Mapping the genome meant figuring out the order of the nitrogen bases on each chromosome (whether it was an A-T or a C-G basegroup). Now they have to figure out what does what.
What will come next is figuring out where each gene resides (for instance hair color might be chromosomes 1 and 10) and then changing only the nitrogen bases in order to change the phenotype.
What it will mean is individual-specific products. Don't like being a blonde? Take this pill and your hair will change itself. Get sunburned easily? Give the pharmacist a swap of salivia and he'll create a suntan specifically for you. Need a new heart? We'll grow one from scratch - guarenteed histologic compatibility.
Instead of the few dozen genetic tests given to newborns we will be able to test for diseases that we haven't even discovered yet.
It's a gonna be whole new world.
I like food.
I'll try to read it in the next day or two and give my opinion on what I see.
Now we have a map of what parts do what, it is time to crack the code so we can read and write DNA sequences. If we want John's DNA minus genetic defect plus red hair what do we change and how. The ability of mapping out chapters and passages in a book is not the same as reading a book or editing a book or writing a book. The First part is done. Now comes the good parts.
It's not always the US scientists going to those 3rd world contries. most of the time it is those countries themselves where if they want to survie, if they want to make better living conditions for their people, they have to sacrifice. IT becomes a case off the lesser of two evils. kill a few to save a lot, or kill none, but save no one. The Human genome project will put us on the path to curing hundreds of thousands of diseases. Yes hundreds of Thousands. There are that many geneticly related diseases, and even more that aren't geneticly related that we can still cure by understanding the way the body truely works at it's lowest level.
Upeo
I hereby declare my own genetic code open to the public. Anyone may use, modify, and distribute any base pair sequences that are part of me.
Interested parties may obtain samples by sending cute women to collect them. Due to restrictions imposed by nature, and the fact that I hate needles, samples may only be collected in halves, through all-natural means. Putting these sample halves back together again is your own problem.
(Well, I thought it was funny...)
---
- Give a man a fire and he's warm for a day, but set him on fire and he's warm for the rest of his life.
Moderator: You've made a mistake. This poster is exactly right, and isn't out trolling.
All they've got now is a big map of (A|G|C|T)*. This isn't useful by itself; we need to understand it to use it.
Consider as an example the hieroglyphics in the tombs of the Egyptian pharaohs. Sure, they contained information about those cultures, but until we found the Rosetta stone and could translate these writings, they were just a bunch of pretty pictures.
I sincerely hope that this achievement will be able to be exploited for the benefit of humanity, wiping out nasty, painful diseases, and so on, but we're not there yet. This is just one step. (A giant step, but still a step.)
-Joe
Sure, having the human genome completely mapped will help devise treatment for illnesses caused by genetic irregularity (such as Sickle-cell anemia). But genes are only one of five causes of disease:
Having the Human Genome to work with will allow researchers to develop treatments/cures to many diseases, but at what cost? At the dawn of the nuclear age, the power of the atom was seen as the solution for all the problems the world faced. Fifty five years later, we are stuck cleaning up the messy legacy that nobody wants. Today's genetic scientists will likely use the genome to devise genetic solutions for health problems, when no genetic problems exist in the first place. What happens when some scientist creates a genetic therapy treatment for Scurvy, when the only "treatment" needed was to pick up an orange at the store?
see this page for some provacative ideas on being healthy...
Learn the rules so you know how to break them properly.
www.teslabox.com
Except by the time scientific advancements reach the point your predictions _can_ come to pass, Microsoft will be no more.
So... hmm. Is a person an OS or an app?
[sorry, couldn't resist]
Irritable, left-wing and possibly humorous bumper stickers and t-shirts
Please note that "unitedstatesian" could also refer to the "United States of Mexico", the official name of our southern neighbor. Please do not confuse the readers.
:)
-Dean
Of course, the real lesson from all of this is that Byte Offset was the way God intended Memory Referencing to work. :)
The timing is interesting from several standpoints, but the immediate one that I see is this: this should bring Celeras stock price back to the upper 200's and ditch the overall investor scared feeling from when it hit the low 40's. PR = cash.
"Arrogance and Stupidity all in the same package. How efficient of you." - Londo Mollari, Babylon 5.
geez. poor plumber :)
Find a job you like and you will never work a day in your life.
This whole week PBS interviewer Charlie Rose has been doing programs on this, interviewing the important people involved. After watching these interviews I know a bit about the subject so I hope I can clear up some of the questions.
The reason that they are both announcing is mostly political/ideological. The HGP is known as the "public" project, which is funded by taxes and will be releasing the data to the public. Celera is doing their research in order to sell the data they create to scientists/students/etc. Celera's plan is to make the raw genome data more usable for people, like Bloomberg takes raw financial data and sifts through it, analyzes it, and sells the resulting information to it's customers. Also, the two projects use different methods of sequencing the genome and the HGP people don't seem to care for Celera's "shotgun" approach as opposed to their more standard approach. (I'm not familiar with the details of either approach, I just know they're different). Celera also plans on patenting it's work to sell to drug companies and the HGP people (including Watson of Watson & Crick, the guys who discovered the whole deal in the first place) aren't too thrilled with the idea of patents on genes.
One researcher interviewed on Charlie Rose compared this announcment to reaching the North Pole, nothing is really acomplished by it, we just get to say it's been done. Finishing one person's genome is a pretty big deal but it's just the raw data, it's going to take years to sift and look through what you have there to make it useful.
This is only the first step, the next couple of thousand are the exciting ones.
After genomics, the science of genomes, the next level will be *proteomics*, the study of total the protein content of a life-form, protein interactions, and their chemistry. I have seen Craig Venter speak twice this year and both times he has indicated that proteomics is where his true interests lie. Venter started out studying proteins. If you want to understand anything in life, from what makes an arm shaped like an arm, to what makes a schizophrenic, to how a virus infects you, you have to understand proteins. Proteins catalyze almost all of the chemistry that goes on inside an organism. Studying them is quite difficult (it's the subject of my dissertation), but the rewards are boundless. (Side note: RNA can also perform chemistry, e.g. ribozymes) Take AIDS. There's a protein called "HIV protease". Chemists determined the precise 3-D structure of it, modeled it on a computer, and then screened a database of compounds to see what structures would "dock" into the business end of this protein and jam up it's ability to perform it's role in HIV. They came up with candidates, made a library of variations and viola! they made one of the first anti-viral drugs. Take superoxide dismutase. (SOD). This enzyme/protein helps scavenge toxic superoxide from your cells keeping them from getting damed by metabolism and such. If you take the gene for this protein and introduce it into a fly via a virus, you can double the life span of the fly! There is no limit to the impact of all of this, but the real exciting stuff is not the genes, but the proteins that they encode. And that is why Venter is working with PE Biosystems to make new machines that are suited for studying things like protein expression patterns. It's a wild time to be a biotechnologist. I feel like a physicist at Los Alamos. I plan to celebrate on Monday, but I feel like I'm celebrating the end of the world. O'Biquody
If you like these books, check out 'The Sky Lords' (forgot the author). It's a bit sketchy on the details, as a scientist didn't write it, but it has an apocalyptic view of how gene therapy/modification could get out of hand. Genetic corporations develop the capability to alter genes. Shortly after, everything begins to change. Humanity is in an age of wonders... Bacteria that turns waste into alcohol/gasoline/whatever, the eradication of disease, etc. In comes Bill Gates (or his counterpart), 'Milo Haze', an entrepreneur who is one of the owners of these syndicates. These corporations begin fighting it out, creating life forms to kill each other, and they design things to protect themselves. Milo, for example, undergoes genetic modification to have bones made of an alloy, vision better than a cat, and the ability to control the speed of his thinking/respose time/metabolism. As a result, he can see at night, and coupled with his strengthened muscles he can run fast enough to *blur*... chop down several enemies, etc. In the meantime, those hurt the most are the general populace, with no protection from this sort of thing. Among the things mentioned are: Fungus genetically engineered to kill everything and anything that resembles a living thing. Food supply goes down the drain as whole farming areas are devastated. 'Designer Plagues' are also widespread... Viruses designed by warring corporations to just kill humans and nothing else within a matter of hours.... And I'm just getting started. There are also Sex Slave creatures... Yowza! ;) It's a good read, but unfortunately the last part of the trilogy is not (and never will be I am thinking) finished.
I just realized something... The title of the movie GATACA is made up of nucelotide abbreviations! Though, to be fair, I only caught that because I thought you'd embedded it in your made-up gene sequence (which you didn't, you just came close enough for me to catch the pattern).
I wonder how many other people caught that.
--Threed
The Slashdot Sig Virus was foiled before it could spread.
X-MEN, the wonderful mutants, of course had their genes modified. I can't wait till that stuff is true.
:)
I know, I know.. what a nerd.
You should never, never doubt what nobody is sure about.
You quitting proves that the karma kap worked. The most annoying of the whores shut up. --CmdrTaco
I herby release all my DNA under the GPL. Earths existing DNA belong to nature and humanity. It should by no means become the subject of propety trough patenting. It is a BIG diference in patenting a new toaster, and to patent genes that exist in nature, and that you havent done anything to improve. Our problems with patenting software and standards is NOTHING compared to the problems we will get tomorrow if we grant this kind of patents.. Therfore the UN should release all existing under the GPL before it is to late..
--- Martin
I don't know about you, but I have no desire to be MORE fragrant. Less is more like it.
It's rare that you're presented with a knob whose only two positions are Make History and Flee Your Glorious Destiny.
The Patent Office has been surprisingly intelligent about patents on genes. Most involved think just as you do (and most of us probably) that the PTO will just grant patents willy-nilly to genes like they seem to do for computers but they've been raising the bar much higher than usual for this stuff. Pretty much everybody is scared of some company patenting hundreds of genes just because they have the data on them so even folks like Celera (whose whole business plan is based on gene patents) are petitioning the PTO to make you present evidence that you know what you're doing and have a valid reason for the patent.
This of course doesn't address many people's idea that genes shouldn't be patented at all but that's unlikely to be the way things go down.
Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?
The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation.
That's about to change, big time!
A hack using a combination of DNA and RNA has been constructed, which zeros in on a particular site on the cell's DNA, clamps on hard (using the RNA portion of the composite molecule), and prompts the cell to make exactly the desired edit (apparently by convincing the DNA repair enzymes that there's work to do).
Not only that, but if you just put the DNA/RNA hacking molecule OUTSIDE the cell and temporarily tweak one parameter (pressure, I think it was), the cell takes up the molecule and transports it to the nucleus.
So you can edit cultured cells in the desired manner, then implant them in the patient. If the disease is, say, an enzyme deficiency, you're done.
Edit some stem cells and inject them, and they'll replace or gradually convert whole organs.
If you need to work on a lot of cells in some tissue of the patient at once, you might be able to just shoot him up with this stuff until his cells are swimming in it, then pop him into a hyperbaric chamber to get the cells to take it up. If that doesn't work, try using viral envelopes as nanotech syringes.
There's LOTS of possibilities. The revolution is almost upon us.
Bantam Dominique roosters crow a four-note song. Once you've heard it as "Happy BIRTHday" you can't NOT hear it that way
Once you've got one sample, you need to check it against others to find the variations (especially: to find the oddball stuff unique to the baseline).
But that's a LOT easier once you've got the baseline established. You can hybridize the baseline DNA strands with strands from the new target to zero in on the differences.
Meanwhile, you can work with the baseline to identify the location and function of each gene. You start examining the variants as they become available.
Bantam Dominique roosters crow a four-note song. Once you've heard it as "Happy BIRTHday" you can't NOT hear it that way
you say: > Coming soon. You have identified a protein but can't figure out what it does. Using its sequence, you will soon be able to predict its 3-D structure, which can give you clues about what it does. two things to say about this: 1. its not clear that this will happen in the near future, or ever, merely from computation. inside the cell there are editing processes, then there are chaperonins, which help the protein fold, etc. in other words, its not clear that you ever just look at the dna sequence, transcribe out the proteins, and then infer their fold and function merely from sequence. maybe some of this can be inferred. maybe not. still plenty to do in the lab, though. 2. alot of what you're talking about here has already been available for years. there are already huge databases of expressed protein/nucleic acid sequences. e.g. you suck out the messenger rna's from a cell and reverse transcribe those and then sequence them. that way you get the edited sequences right off the bat. this is what human genome sciences (HGSI) has been working on for 5 years, for example. and they already have several drugs (proteins) in human test studies. (the fourth was just added to day.) i would think that what you get from the genome map is more like: proteins not usually expressed in the cell, or those from early developmental stages; finding all the sites where transcription begins (the switches that turn on various genes and how they interact); stuff like that.
I find it quite interesting that if science can actually discover what everything is, then later can learn to control it, what happens when everybody is alike?
What I mean is this: If the culture defines the "perfect" person to be slim, tall, blonde hair, smart, etc. and gene therapy exists, the short fat people will want to be slim tall people. This is the nature of humans. To be the "best" (whatever that is). In other cultures/time periods a person who was fat was considered to be beautiful and healthy. I am not suggesting that fat people are more beautiful or healthy, only that this is the perception of society and the culture that the individuals live in.
So, once again, what happens when everyone goes down to the local tanning/gene therapy club, to get themselves "enhanced"? These people will start to become the physiologically similar. What happens when a new disease comes along that is only able to attack that particular combination? Does this wipe out most of the crowd? Does this not sound very similar to the latest VBS or MS Whatever attacks? When everything is the same, no matter how strong or wonderful it appears on the surface, there is a chance that a weakness can be found, then exploited. I run Pine under Linux. I received a copy of the "I love you" virus. What happened? Nothing. I am running Pine. My mail reader doesn't automatically run VBS.
Is there anything that you would change about yourself? What if that meant that you could end up with some disease?
Just my $0.02 or less.
---
Sig Return: 204 No Content
After things settle and the blanks get filled in, it'll be cool to see the data set become available for distributed processing, like SETI and the real-deal (see subject).
whoops...sounds like someone's violating their NDA.
I never have enough coat hangers!
Has anyone mapped/sequenced the Mitochondrial DNA?
"The simplest solution is to ignore your dead children."
Nope - substance abuse; per what insurance companies are willing to reimburse. Not what govt's are willing to do to alleviate the problem. In poor countries alcoholism and drug abuse are problems of poverty not problems of affluence.
HIV/AIDS; not prevention, treatment. So the goal is to make the therapies less expensive than is incurred now. Not in any realistic way to develop a vaccine <at least not in the good ol' US where it would get buried by the Right.>