Slashdot Mirror
Longest Email Disclaimer Awards
evilandi writes: "The Register have announced the results of their Longest Email Disclaimer awards (2001 Daftas). The winner was financiers UBS Warburg with 1081 words, adding nearly seven kilobytes to every email they send." Any really good examples? Post them below. Law firms seem to be the worst offenders.
Last year I had all my email blocked for "inappropriate content" until I spoke to an administrator. I called the person listed for more information and was told that "encrypted text is not allowed for security purposes." I told them it wasn't encrypted, it was compressed, it was a ZIP file! The idiot told me, "We know, we unzipped it and we couldn't read it so it's still encrypted. You'll have to send it as plain text."
I tried to explain to the idiot that the file was a code dump from a 2M EPROM chip being sent back to the manufacturer to be checked for errors and modified. THERE WAS NO PLAINTEXT! But she still wouldn't listen to me. "We have strict security policies regarding encrypted content. NO EXCEPTIONS!"
Called the manufacturer and they suggested I do a hex dump and try sending that. It also was blocked as "inappropriate content." Then tried to FTP it to the manufacturer's site but found that FTP was also blocked.
Ended up having to use Laplink to transfer the file to a borrowed laptop, sneak the laptop out of the building, take it home and Laplink it into my home machine just so I could email the file to the manufacturer. By the time the modified file was sent back to me at home I had found a program called Split that would break the file up into pieces small enough to fit on a floppy. Would have worked great except I couldn't install Split on the NT machine at work without administrator privileges. (@%#%$#$%!!!) Still had to laplink it over from a borrowed laptop.
Now I've learned my lesson and moved the development/programming system over to a machine not on the network with it's own free (Bluelight) Internet service. All of this is against company policy; no non-networked machines, no OS except NT, no modems, no open (non-passworded access) machines... Sheesh!
However, we have no problem accepting any and all viruses through Outlook (or LookOut! as we tend to call it), crippling out email 3 times in the last 2 years. Is your company being run by idiots, too?
Agreed. Legal disclaimers are a nightmare dreamed up by lawyers to keep themselves in a job. If they absolutely have to be there (and it's my view that they don't), then they should simply be a reference to the full small print:
"The invisible and the non-existent look very much alike." -- Delos B. McKown
Apart from the obesity of this particular disclaimer, has text of this nature ever been used successfully as a defense against any type of legal action, be it a civil suit or a government enforcement action? Can anyone point to any examples of disclamiers being accepted or rejected by a court?
sPh
We are dealing with a group within UBS Warburg at work at the moment, and not only do they have the huge disclaimer, but whatever mail software they use structures mails thusly:
1) Plain text section - big-ass disclaimer only
2) 1 or more arbitrarily name RTF files for the body, and possibly the message being replied to
I think it's HP OpenMail, but whatever it is, it really sucks.
"don't fall into the fallacy of believing that Perl can solve social problems. Maybe Perl 6 can, but that's a ways off"
Opinions expressed may not even be my own, let alone
those of any organisations, nations, species or
schools of thought to which I may be affiliated.
The frightening part is, I know an awful lot of librarians who would implement it. (The people who run html verifiers against their web pages and then proudly display a logo indicating they have end of paragraph tags.)
Speed of light. Conservation of mass. Bureaucracy. Some things are just constant...
Rob
The most sensible analysis (from a UK perspective) of email disclaimers is on the Stupid Email Disclaimers web site. Its contains a bit of logical (and legal) analysis, some sample disclaimers and some parodies as well.
Someone pointed it out on an email list when the Registers story first came out.
Notice in the "Most PC Disclaimer" award:
Employees must never send or store e-mails or attachments that are obscene, indecent, sexist, racist, defamatory, abusive, in breach of copyright, encrypted or otherwise inappropriate.
(emphasis mine)
Does this strike anyone else as unusually facist? They are lumping privacy into the list of "naughty" types of email. Has anyone else heard of a company that forbids using encryption?
What about SSL or SSH?
Looks like they expect everyone to have a T1. I suppose there is no such thing as a short message from this company. If you did write a short two line e-mail, I suppose the content would get lost with the legal spam added to the end of the e-mail.
Jumpstart the tartan drive.
And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot
Some facts:
McDonald's coffee was hot enough to cause second and third degree burns. McDonald's serves hundreds of thousands of cups of coffee per day. No human being is perfect.
Conclusion: an accident will occur, and someone will be severely burned.
When this happened, the woman asked McDonald's to cover part of her medical expenses. Not all of them, just part - she was willing to accept that she was partially responsible for the accident, and she wasn't asking for compensation for 'pain and suffering.' McDonalds repeatedly and disrespectfully refused.
So she sued. She got her medical bills paid, she got her 'pain and suffering', and McDonalds was penalized for giving customers a product that they KNEW their customers would hold in their laps and that they KNEW could cause severe tissue damage.
I do not feel that they were negligent in not telling people that boiling water is hot.
True. They were negligent in not telling people that they were being served boiling water. Rational people don't drink boiling water. I understand completely McD's reasons for serving ultra-hot coffee, but they need to be prepared to pay for the consequences of their actions.
While I would agree that she had a case for medical expenses, I do not feel that the US courts should serve the same purpose as the lottery.
Yup. Gotta agree with you there. ACTUAL damages should be paid; compensation for pain and suffering and emotional distress is iffy. Punitive damages are right out.
If a company has done something wrong and deserves to pay punitive damages, then those damages should go to a charity, or the local community, or the Federal treasury. But there is NO reason for a company to pay ME punitive damages. If someone robs my house and the judge sentences them to $a 50,000 fine and five years at hard labor, do I get the cash and the results of his work? Should I? Why then should civil damages be different?
Digital signatures would be useful, but not many companies use them/ they aren't as widespread as they should be.
On a different note, anyone know whether those disclaimers would stand up in court, like you can't forward it blah...blah...
Like postal mail, noone can tell me what I can or cannot do with stuff which lands in my mailbox. If its so important, then why are you stupid enough to send it to me? Anyone a lawer?
From UBS AG's (AKA UBS SA, AKA UBS Warburg) disclaimer:
So wrong, so wrong... How can information contain viruses? It cannot. It is the carrier which contains those viruses, and only certain specific carriers at that. If they really cared about not sending out those viruses, they would use a carrier which does not allow executable content. Like, say... ASCII text.
Of course, they're in the financial sector, so they're probably shackled and tied to the upgrade vortex from Redmond. Bummer, I say.
--frank[at]unternet.org
Actually, it's even worse now that flat rates are the norm. You pay what amounts to a tax on your Internet connection. It's not called out on any bill or otherwise made clear, but when an ISP has a .1-.5% load from crap like vcards, signatures, etc (I don't know the stats either, so I could be way off), they have to buy larger pipe a little bit sooner, and you pay a little bit more.
Ok, so perhaps it ammounts to a fraction of a dollar a month for the average home user. But, why should I be taxed for your footers? Just slap a URL on your messages and make the page as beefy as you like.
I've always been the champion of RFC 1855 AKA the nettiquite guidelines. And I quote:
--
A friend of mine works for an insurance company in Italy (AXA Assicurazioni), and the disclaimer is printed in Italian, English and French:
Questo messaggio è riservato; il suo contenuto non rappresenta
in nessun caso un impegno da parte di AXA Assicurazioni, AXA SIM,
od AXA REIM, ad eccezione di quanto previsto in accordi conclusi
per iscritto tra voi ed AXA Assicurazioni, AXA SIM o AXA REIM.
Qualsiasi pubblicazione, utilizzo o diffusione, anche parziale di
questo messaggio, deve essere preventivamente autorizzata. Nel
caso in cui non foste destinatari del presente messaggio,vogliate
cortesemente avvertire immediatamente il mittente.
Ce message est confidentiel; son contenu ne represente en aucun
cas un engagement de la part de AXA Assicurazioni, AXA SIM ou AXA
REIM sous reserve de tout accord conclu par ecrit entre vous et
AXA Assicurazioni, AXA SIM ou AXA REIM. Toute publication,
utilisation ou diffusion, meme partielle, doit etre autorisee
prealablement. Si vous n' etes pas destinataire de ce message,
merci d'en avertir immediatement l'expediteur.
This message is confidential; its contents do not constitute a
commitment by AXA Assicurazioni, AXA SIM or AXA REIM, except
where provided for in a written agreement between you and AXA
Assicurazioni, AXA SIM or AXA REIM. Any unauthorised disclosure,
use or dissemination, either whole or partial, is prohibited. If
you are not the intended recipient of the message, please notify
the sender immediately.
"It is more complicated than you think" (The Eighth Networking Truth from RFC 1925)
I saw this on the other site yesterday.
Best Slashdot Co
It's fun to point out spelling errors, (forumns) in posts from a grammar nazi.
Best Slashdot Co
Think of how many spams could have been sent with all that wasted bandwidth!
Reading this message assumes you've read http://...
That's funny anyway. Basically, emails disclaimers are saying "warning : maybe the content of this message has been modified by a third party" .
But well... why would the third party modify the message body but leave the disclaimer ?
That's pointless.
To send a message that has to be trusted :
But of course, spammers may use this to validate addresses they have sent fake important messages to. Fighting spammers stupidity is an endless war.
{{.sig}}
Among other things, this page has an earlier and much shorter version of the UBS warburg disclaimer. Apparently it has been growing -- run away! run away!
DO NOT LEAVE IT IS NOT REAL
This was at the end of an email sent to me from an outside firm. It's not my companies (thank god(s)) but I figured it should be added to the mix:
This electronic mail message and any attached files contain information intended
for the exclusive use of the individual or entity to whom it is addressed and
may contain information that is proprietary, privileged, confidential and/or
exempt from disclosure under applicable law. If you are not the intended
recipient, you are hereby notified that any viewing, copying, disclosure or
distribution of this information may be subject to legal restriction or
sanction. Please notify the sender, by electronic mail or telephone, of any
unintended recipients and delete the original message without making any copies
As long as we're on the subject of emails, though, I should point out that even worse than HTML mail and 7K legal mumbo-jumbo is:
embedded Flash sig files!
I kid you not:
http://www.cetan.com/flash-email/flash-email.html
There are 3 screen shots from this flash embedded email.
In Soviet Russia...michael would be rotting in Siberia!
Have you considered getting a clue yourself?
PGP/GPG Key: 0xC2F837FD.Have a nice day of course ...
- Michael T. Babcock (Yes, I blog)
</Sarcasm>
And people wonder why we need faster routers....
www.eFax.com are spammers
By reading this comment, you agree to sell your first-born to Jacob Lee of Cincinnati, OH.
This comment must be destroyed within 30 minutes of reading under full penalty of U.S. law. The editors of this site shall be held responsible if this comment is not removed at the end of the appropriate time period.
This agreement is not applicable in the states of New Jersey, Maryland, and Delerium.
All Your First Born are Belong to Us
--
Friends don't let friends misuse the subjunctive.
This is so true. I love reading the small print on products to find exactly what some stupid people have done with them. "Do not insert forcibly into body cavities","Not to be used for drying pets", etc.
My favorite disclaimer was from a local brewery who were giving out scratch cards to win a free T-shirt. It said something like:
This offer valid until we
"What I look forward to is continued immaturity followed by death."
This product is meant for educational purposes only. Any resemblance to real persons living or dead is purely coincidental. Void where prohibited. Some assembly required. List each check separately by bank number. Batteries not included. Contents may settle during shipment. Use only as directed. No other warranty expressed or implied. Do not use while operating a motor vehicle or heavy equipment. Postage will be paid by addressee. Subject to CAB approval. This is not an offer to sell securities. Apply only to affected area. May be too intense for some viewers. Do not stamp. Use other side for additional listings. For recreational use only. Do not disturb. All models over 18 years of age. If condition persists, consult your physician. No user-serviceable parts inside. Freshest if eaten before date on carton. Subject to change without notice. Times approximate. Simulated picture. No postage necessary if mailed in the United States. Please remain seated until the ride has come to a complete stop. Breaking seal constitutes acceptance of agreement. For off-road use only. As seen on TV. One size fits all. Many suitcases look alike. Contains a substantial amount of non-tobacco ingredients. Colors may fade. We have sent the forms which seem right for you. Slippery when wet. For office use only. Not affiliated with the American Red Cross. Drop in any mailbox. Edited for television. Keep cool; process promptly. Post office will not deliver without postage. List was current at time of printing. Return to sender, no forwarding order on file, unable to forward. Not responsible for direct, indirect, incidental or consequential damages resulting from any defect, error or failure to perform. At participating locations only. Not the Beatles. Penalty for private use. See label for sequence. Substantial penalty for early withdrawal. Do not write below this line. Falling rock. Lost ticket pays maximum rate. Your canceled check is your receipt. Add toner. Place stamp here. Avoid contact with skin. Sanitized for your protection. Be sure each item is properly endorsed. Sign here without admitting guilt. Slightly higher west of the Mississippi. Employees and their families are not eligible. Beware of dog. Contestants have been briefed on some questions before the show. Limited time offer, call now to ensure prompt delivery. You must be present to win. No passes accepted for this engagement. No purchase necessary. Processed at location stamped in code at top of carton. Shading within a garment may occur. Use only in a well-ventilated area. Keep away from fire or flames. Replace with same type. Approved for veterans. Booths for two or more. Check here if tax deductible. Some equipment shown is optional. Price does not include taxes. No Canadian coins. Not recommended for children. Prerecorded for this time zone. Reproduction strictly prohibited. No solicitors. No alcohol, dogs or horses. No anchovies unless otherwise specified. Restaurant package, not for resale. List at least two alternate dates. First pull up, then pull down. Call toll free number before digging. Driver does not carry cash. Some of the trademarks mentioned in this product appear for identification purposes only. Objects in mirror may be closer than they appear. Record additional transactions on back of previous stub. Unix is a registered trademark of AT&T. Do not fold, spindle or mutilate. No transfers issued until the bus comes to a complete stop. Package sold by weight, not volume. Your mileage may vary. Known as Hellman's east of the Rockies. Beware of greeks bearing gifts. Beware of gifts bearing greeks. This side up. Don't take any wooden nickels. Don't take candy from strangers. Void where prohibited. Caveat Emptor (Buyer beware) Caveat Vendor (Beware of street people). Donde esta el bano. Beware of DOS. Look both ways before crossing the street. Always wear safety belt. Always wear deodorant. Don't forget to breathe. If you park, don't drink...accidents cause people. This supersedes all previous notices. This disclaimer may not be copied without the expressed written consent of whoever I stole it from.
Ant(Dude) @ Quality Foraged Links (AQFL.net) & The Ant Farm (antfarm.ma.cx / antfarm.home.dhs.org).
Dude...you married a fruit fly (Drosophila melanogaster)! At least that's according to the BLAST search at NCBI...
Law firms seem to be the worst offenders.
Wouldn't you seize the opportunity to advertise your work in every email you send?
I hate long disclaimers...
--
This post has been prepared by the division, group, subsidiary or affiliate of ralmeida AG ("ralmeida") identified herein. In certain countries ralmeida AG is referred to as ralmeida SA, which is a translation of ralmeida AG, its registered legal name. ralmeida Warburg is a business group of ralmeida AG. This post is for distribution only under such circumstances as may be permitted by applicable law, including the following: This post has no regard to the specific investment objectives, financial situation or particular needs of any specific recipient. The post is published solely for informational purposes and is not to be construed as a solicitation or an offer to buy or sell any securities or related financial instruments. The securities described herein may not be eligible for sale in all jurisdictions or to certain categories of investors. The post is based on information obtained from sources believed to be reliable but is not guaranteed as being accurate, nor is it a complete statement or summary of the securities, marketsor developments referred to in the post. The post should not be regarded by recipients as a substitute for the exercise of their own judgement. Any opinions expressed in this post are subject to change without notice and ralmeida is not under any obligation to update or keep current the information contained herein. ralmeida and/or its directors, officers and employees may have or have had interests or long or short positions in, and may at any time make purchases and/or sales as principal or agent, or ralmeida may act or have acted as market-maker in the relevant securities or related financial instruments discussed in this post. Furthermore, ralmeida may have or have had a relationship with or may provide or has provided corporate finance, capital markets and/or other financial services to the relevant companies. Employees of ralmeida may serve or have served as officers or directors of the relevant companies. ralmeida may rely on information barriers, such as "Chinese Walls," to control the flow of information contained in one or more areas within ralmeida, into other areas, units, divisions, groups, or affiliates of ralmeida. Options, derivative products and futures are not suitable for all investors, and trading in these instruments is considered risky. Past performance is not necessarily indicative of future results. Foreign currency rates of exchange may adversely affect the value, price or income of any security or related instrument mentioned in this post. Clients wishing to effect transactions should contact their local sales representative. ralmeida accepts no liability whatsoever for any loss or damage of any kind arising out of the use of all or any part of this post. Additional information will be made available upon request. EEA: This post has been issued by ralmeida Warburg Ltd., regulated in the UK by the Securities and Futures Authority. In the UK this post is for distribution to persons who are not UK private customers. Customers should approach the analyst(s) named on the cover regarding the contents of this post. For investment advice, trade execution or any other queries, customers should contact their London representative. Switzerland: This post is being distributed in Switzerland by ralmeida AG. Italy: Should persons receiving this research in Italy require additional information or wish to effect transactions in the relevant securities, they should contact either Giubergia ralmeida Warburg SIM SpA, an associate of ralmeida SA, in Milan or ralmeida Warburg (Italia) SIM SpA, a subsidiary of ralmeida SA, in Milan or its London or Lugano Branch. South Africa: ralmeida Warburg Securities (South Africa) (Pty) Ltd. (incorporating J.D. Anderson & Co.) is a member of the JSE Securities Exchange SA. United States: This post is being distributed to US persons by either ralmeida Warburg LLC or by ralmeida PaineWebber Inc., subsidiaries of ralmeida AG; or (ii) by a division, group, subsidiary or affiliate of ralmeida AG, that is not registered as a US broker-dealer (a "non-US affiliate"), to major US institutional investors only. ralmeida Warburg LLC or ralmeida PaineWebber Inc. accepts responsibility for the content of a post prepared by another non-US affiliate when distributed to US persons by ralmeida Warburg LLC or ralmeida PaineWebber Inc. All transactions by a US person in the securities mentioned in this post must be effected through ralmeida Warburg LLC or ralmeida PaineWebber Inc., and not through a non-US affiliate. Canada: This post is being distributed by ralmeida Bunting Warburg Inc., a subsidiary of ralmeida AG and a member of the principal Canadian stock exchanges & CIPF. A statement of its financial condition and a list of its directors and senior officers will be provided upon request. Singapore: This post is being distributed in Singapore by ralmeida Warburg Pte. Ltd. Hong Kong: This post is being distributed in Hong Kong to investors who fall within section 3(1) of the Securities Ordinance (Cap 333) by ralmeida Warburg Asia Limited. Japan: This post is being distributed in Japan by ralmeida Warburg (Japan) Limited to institutional investors only. Australia: This post is being distributed in Australia by ralmeida Warburg Australia Limited in relation to fixed income securities, and ralmeida Warburg Australia Equities Limited in relation to equity securities. New Zealand: This post is being distributed in New Zealand by ralmeida Warburg New Zealand Ltd in relation to fixed income securities and ralmeida Warburg New Zealand Equities Ltd in relation to equity securities. + 2001. All rights reserved. No part of this post may be reproduced or distributed in any manner without the written permission of ralmeida. ralmeida specifically prohibits the re-distribution of this post, via the Internet or otherwise, and accepts no liability whatsoever for the actions of third parties in this respect. Visit our website at http://www.ubswarburg.com This message contains confidential information and is intended only for the individual named. If you are not the named addressee you should not disseminate, distribute or copy this e-mail. Please notify the sender immediately by e-mail if you have received this e-mail by mistake and delete this e-mail from your system. E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission. If verification is required please request a hard-copy version. This message is provided for informational purposes and should not be construed as a solicitation or offer to buy or sell any securities or related financial instruments.
--
This space left intentionally blank.
All thoughts expressed within this message are those of The Church of Scientology and in no way represent the free will of the sender of this email. The Church of Scientology doesn't approve of using nuclear weapons to attack The Church of Scientology. The Curch of Scientology reserves the right to take part of that last sentence out of context in a court of law if this email is delivered to anyone not affiliated with The Curch of Scientology. If you are not the intended recipient of this email we will sue.
Balls! If your policy needs 7kB to summarise, you need a new policy. How about this? "UNDER NO CIRCUMSTANCES WHATSOEVER shall email transactions of any sort be considered authoritative or legally binding with respect to (the company), regardless of statements to the contrary." Maybe tweak a few words, but it says pretty much all that has to be said. Hell of a lot less than 7kB, too.
"People who do stupid things with hazardous materials often die." -- Jim Davidson on alt.folklore.urban
After reviewing the first contract, I was impressed by the attorney's disclaimer, and his insight into ways in which his client could be screwed. Surely, I had not foreseen those factors. The next contract had a similarly insightful disclaimer, although it pointed out very different issues to be disclaimed.
Having now reviewed scores of these contracts over many years, I have learned several things:
- Every disclaimer was new and different from any prior disclaimer
- Each disclaimer represented a particular way in which an attorney's client had previously been screwed
- There are an infinite number of ways in which to screw somebody without violating the letter of a contract
All this gives way to an important truth about contracts: the words only stand up by the goodwill of the parties behind them, and similarly, cannot withstand the force of an able party who wants out. In the fast-paced exchange of internet communications, it amazes me that attorneys don't realize that their technical disclaimers zoom by without any real meeting of the minds, and therefore, create no basis for a meaningful contract.<bart
I suspect this is less a matter of ignorance and more a matter of possible liability for the Council under the lovely, fluffy, entirely-for-the-greater-good save-the-little-children draconian monstrosity that is the Regulation of Investigatory Powers Act. Remember that under UK (insane) law, non-disclosure of a password to any law-enforcement official who decides to ask for it, for any or no stated reason, can land someone with a 10 year prison sentence.
And forgetting a password, or having never known it in the first place, or refusing to give it as the 'encrypted file' inquestion is not yours/not encrypted/a bunch of lost clusters, is implicitly stated in the Act to be no defence at all. Which is of course perfectly sane, reasonable, mature, civilised and a total affront to sanity.
TomV
Now, that's what I call community building.
M.
Email disclaimers are a good thing, IMNSHO, but there seems to be a sort of haughtiness arms race when it comes to them, ESPECIALLY lawyers. It seems to me that they assume everyone in the world is out to steal their data, or misquote them, or misdirect their oh-so-vital documents.
Are emails, from lawyers in particular, important?
Yes.
Is everything a lawyer says a pearl of wisdom?
No
If something is so important, either MD5 hash it for veracity, or encrypt it for privacy! This seems like an archaic solution to a new problem.
I want to delete my account but Slashdot doesn't allow it.
And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot set a precedent (both in peoples minds and in a very legal sense) that ridiculous lawsuits could be won, even if there was no lasting damage.
Don't beat around the bush, say what you really think. The issue as I see it is that common sense doesn't apply anymore -- and I blame the Kennedys for starting this crap. Clinton just added fuel to the fire. Let's look at how common sense has become a rare commodity in the United States of America:
A farmer sets up a stepladder, a common tool used in homes and businesses by the millions. This is not the first time the farmer has used this tool. The purpose of using the tool was to fix a door on his barn. What the farmer failed to realize is that two legs of this common tool were on solid ground, while two legs were on a pile of manure he had built up over time. When he climbed the ladder, the manure gave way, the ladder pitched forward, and threw the farmer off. The result of his short flight was a broken leg.
The farmer then sues the ladder manufacturer for negligence! It seems there was no warning on the ladder to ensure that all four legs are sitting on a firm surface. Result: $40K settlement in favor of the farmer.
Now do you understand why so many products have so many labels that state the obvious to people with common sense?
Your tax dollars at work.
I guess the last year they have spent in court and the millions in legal fees they have paid has proven that statement correct, huh?
Kinda makes me wonder where the line is drawn before abuse becomes the companies liability and not the end users responsability.
--I assume full responsibility for my actions, except the ones that are someone else's fault.
This one's from Christian Antkow of id Software (don't sue me please, if you sue me you will feel the power of MY disclaimer ;)
:-)
Don't know why, but I like it
Here it is:
*** Disclaimer: Opinions are my own and in no way reflect those of id Software
This disclaimer does not cover misuse, accident, lightning, flood, tornado,
tsunami, volcanic eruption, earthquake, hurricanes and other Acts of God,
neglect, incorrect line voltage, improper or unauthorized use, broken antenna
or marred cabinet, missing or altered serial numbers, removal of tag,
electromagnetic radiation from nuclear blasts, sonic boom vibrations, customer
adjustments that are not covered in this list, and incidents owing to an
airplane crash, ship sinking or taking on water, motorvehicle crashing,
dropping the item, falling rocks, thieving lawyers, crazy ex-girlfriends,
leaky roof, broken glass, Y2K bug, mud slides, forest fire, or projectile
(which can include, but not be limited to, arrows, bullets, shot, BB's,
paintball, shrapnel, lasers, napalm, torpedoes, or emissions of X-rays, Alpha,
Beta and Gamma rays, knives, stones, etc.).
Two Worlds - One Sun [Spirit]
The contents of this message do not reflect the views of Maximegalon University, Sirius Cybernetics, the Vogons or Natalie Portman. Content may be considered factual in all or part within the context of an off camera utterance by George "Wooster" Bush in any or all parallel universes. All or part of this message may not be re-used without persimmon, under penalty of death, dismemberment, renoberation, a good firm spanking, a stern letter to your parents, or a poetry reading by Paula Nancy Millstone Jennings. Incidently, the attached virus, which is working its way through your hard-drive, scrambling its brains as only a Zygorthian space raider death-ray can closely simulate. Have a nice day.
-- .sig are belong to us!
All your
A feeling of having made the same mistake before: Deja Foobar
A friend of mine (ok, my ex-wife!) is a genetic engineer... her sig file read:
c gc
c ga
a tc
a gg
c gc
c ga
a tc
a gg
c gc
c ga
a tc
a gg
Jane Doe
Office: 770.555.1212
Mobile: 770.555.1213
DNA Seq :
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
...
You get the idea.
---
WWJD! WWJD! WWJD!
Sorry to follow up on my own post (and off-topic to boot), but I met Keith Henson on Monday.
:^)Visual inspection revealed no nuclear weapons.
He's doing as well as can be expected exiled to the wilderness of Toronto.
One line blog. I hear that they're called Twitters now.
I'm waiting for an ingenious lawyer to decide to use a complex disclaimer, crammed with legal jargon in every email he sends, as advertising where, he hopes to drum up business by demonstrating his extraordinary grasp of legal language. I have a feeling that must have been what the guy who drafted the UBS Warburg disclaimer was thinking. I'm suprised that I didn't find a URL ana paragraph at the bottom advertising legal services.
(laugh, it's funny)
--
--Got Lists? | Top 95 Star Wars Line
Their legal disclaimer on every page of their site makes no sense, and neither does their epic television commercials... can anyone explain them to me?
Southwark Council includes encrypted mail along with rascist, sexist, defamatory content in their list of inappropriate content. Say *what*?? The world's general ignorance of PGP and encruyption is very depressing. Someone (a C++ programmer, no less!) even asked me why my mail sig is "SHA1" ...
--
"I'm not downloaded, I'm just loaded and down"
What's your black-and-white take on lawyers working pro bono then? Vested interest, surely?
If you were blocking sigs, you wouldn't have to read this.
Congrats, I guess. My sister did her law degree there.
-----------------
www.lucernesys.comHorizon: Calendar-based personal finance
Without all of the frivolous lawsuits abounding, disclaimers would not be necessary. Frivolous lawsuits exist because judges (x-lawyers) allow lawyers to bring idiotic things to court and win. The only way to be sure that you are not open to litigation from a lawyer is to hire another lawyer to look over your correspondence (and write disclaimers). No matter what, a lawyer gets money. It is a pretty good self perpetuating scam. Maybe I should have been a lawyer.
-CrackElf
"Blake is an idealist, Jenna. He cannot afford to think." - Kerr Avon, Star One, Blakes 7