Slashdot Mirror


Your Genome Scanned While You Wait

dotc writes "A Wired reporter has his DNA scanned for disease predispositions. While we all knew this was coming soon, it's still a little strange to read the first-person account."

7 of 261 comments (clear)

  1. Venter by Anonymous Coward · · Score: 3, Informative

    I read that J. Craig Venter (owner of Celera, who beat the HUGO project to sequence the human genome) sells the opportunity to have your own genome sequenced for 500,000$

    1. Re:Venter by genomancer · · Score: 4, Informative

      What Celera/Ventner are selling for .5M is having your genome SEQUENCED, not scanned. The former is a base-pair level map of your entire genome. The latter is checking certain windows to see if they contain a known, small, problem causing mutation, (as well as some large checks for rearrangements and such).

      It's sort of the difference between reverse compiling the entire suorce code for an app (hard), and checking certain locations for passwords/corruption/etc.

      G

      Ps: Celera's map didn't really beat HUGO, they're both totally incomplete, with tons of errors known and unknown.

  2. One page by Klerck · · Score: 5, Informative
  3. Re:Gattica by efatapo · · Score: 5, Informative

    Normally I wouldn't correct spelling. But it's "GATTACA". Get it? Guanine, Adenosine, Thymine, Cytosine. Those are the nucleotides that make up DNA. There's a reason for the name. Just thought I'd point that out.

  4. Re:Needs to review his genetics by Dambiel · · Score: 4, Informative

    he's talking about single strand bases, not pairing

    say you have:
    TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CG CTTGAACCT

    and I have:
    TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CC CTTGAACCT

    we each have a paired strand that would match them, but the CG/CC difference could still change susceptibility to a disease

  5. Re:This is very premature technology by f97tosc · · Score: 3, Informative

    Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

    And they never will, because the cancer is very dependent on certain random events (incorrect cell duplications), and heart attacks on diet and amount of exercise.

    Tor

  6. About the Author by Nintendork · · Score: 3, Informative

    I did a google search on the author's name and found his page. This guy's got quite an impressive list of books and articles. http://literati.net/Duncan/