Slashdot Mirror


Your Genome Scanned While You Wait

dotc writes "A Wired reporter has his DNA scanned for disease predispositions. While we all knew this was coming soon, it's still a little strange to read the first-person account."

49 of 261 comments (clear)

  1. Job Discrimination by MCMLXXVI · · Score: 5, Funny

    When will we have to make sure we leave no testable samples of DNA when going in for an interview?
    More importantly when we go on dates? :)

    1. Re:Job Discrimination by Anonymous Coward · · Score: 5, Funny

      Funny, on dates, that is usually what I'm trying to leave behind.

    2. Re:Job Discrimination by davejenkins · · Score: 4, Funny

      Uma Thurman can test my DNA anytime she wants to.

    3. Re:Job Discrimination by gosand · · Score: 3, Funny
      When will we have to make sure we leave no testable samples of DNA when going in for an interview?

      When I first read this, I thought it said "testicle samples". Which was funny, but then made the next line even funnier...

      More importantly when we go on dates? :)

      --

      My beliefs do not require that you agree with them.

  2. Gattica by Hayzeus · · Score: 5, Funny

    ...is just a few years away. On the upside, GE should render those "add three inches..." spams pretty much obsolete for my grandchildren.

    1. Re:Gattica by efatapo · · Score: 5, Informative

      Normally I wouldn't correct spelling. But it's "GATTACA". Get it? Guanine, Adenosine, Thymine, Cytosine. Those are the nucleotides that make up DNA. There's a reason for the name. Just thought I'd point that out.

    2. Re:Gattica by f97tosc · · Score: 5, Insightful

      Well, actually it is quite some ways, they have to go from checking to manipulation.

      Gattica was an intresting movie, but there were a lot of things that did not make sense. For one thing, the genetic tests were omnipresent - they alone determined what job you would get and whom you would date. They even had to take genetic tests to get into work every day, and the company would search through its facilities to make sure that nobody with inferior genes was present.

      On the other hand, the main character did not have 'improved' genes, and so he had to falsify his identity to get a job. However, he appeared to be just as competent as all the other people where he worked, perhaps more so. Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

      A different scenario is that genetic manipulation really does make people smarter and more competent. But then this could probably be identified through normal tests and interviews.

      I don't know which scenario is scarier.

      Tor

    3. Re:Gattica by Anonymous Coward · · Score: 5, Insightful

      "Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?"

      For much the same reason why corporations go to great lengths to exclude people without a 'good' education. They're social thought of as being superior people, even if they aren't. That was the gist of the movie.

    4. Re:Gattica by Triv · · Score: 5, Interesting
      Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

      Gee, I don't know - wonder why some people thing black people are inferior just because they're black (or green, or gay or whatever). That's what prejudice is - basing a judgement of someone on something arbitrary rather than experience, education level, etc.

      There was a great episode of "This American Life" called Them that talks about this, particularly the last story.

      From the show's description of this last story:
      Act III: Newfies. Reporter Chris Brookes had always thought the story was a joke. During World War II, a black sailor from the U.S. washed up nearly dead onshore in Newfoundland, and the white nurses -- never having seen a black man -- thought he was covered in oil and tried to scrub him clean. But when Brookes finally tracked the sailor down, decades later, it turned the whole thing was true. And the sailor said that sort of treatment was a lot nicer than what he'd been used to at the hands of whites down south. Brookes tells the incredible story of the sailor, Lanier Phillips, and how his experience in Newfoundland changed his life.


      Grab it. Give a listen. :)

      Triv
    5. Re:Gattica by one9nine · · Score: 4, Funny

      If your going to play the role of the obnoxious know-it-all slashdot poster, at least get it right. It's adenine, not adenosine.

    6. Re:Gattica by Shenkerian · · Score: 5, Funny

      If you're going to play the role of the obnoxious holier-than-thou slashdot poster bitch-slapping the know-it-all slashdot poster, at least get it right. It's you're, not your.

      --
      You tell me how "whilst" differs from "while," and I'll stop calling you a pretentious jackass.
  3. WHAT? Body scans?! by gpinzone · · Score: 4, Funny

    You mean I've been collecting Jude Law's blood and urine samples all these years for nothing?!

  4. The next news article by Drunken+Coward · · Score: 5, Insightful

    And of course, the next news article will be that HMO's have begun rejecting medical procedures based on the predisposition for certain diseases of certain genomes.

    --
    Have you been stalked by Seth today?
    1. Re:The next news article by foolish · · Score: 5, Interesting

      Since they've already done this for every other type of testing result in the past, that's hardly a suprise right?

      'Oh you might have a heart problem sometime in the future, even though you're treating the issues and being proactive, I'm sorry, we're going to have to increase your premium 400%'

      IIRC, UC-Berkeley employees ended up suing some of the HMOs because they were unfairly rejecting African Americans because they carried a higher risk for high blood pressure, sickle cell, etc.

      Nevermind the issues for the whole 'expression of the predisposition' and how accurate these readings are at this time.

      Diagnostics, the double/triple edged sword. Wheee!

    2. Re:The next news article by gpinzone · · Score: 4, Interesting

      On the flip side, why should I pay higher Insurance rates for your heart attack? The whole idea of insurance is to guard against the unknown. It ceases to be a useful model of healthcare reimbursement when the ability to predict health problems becomes a reality.

      Let's not hang onto an old business model of a lottery system for healthcare and come up with a new paradigm that's more fair to all.

  5. This isn't as good as it sounds by Anonymous Coward · · Score: 3, Insightful

    1) People will take predispositions too seriously. People with 'bad' genes will think they're doomed and live like it. People without any 'bad' genes will think they're bulletproof and live like it.
    2) This won't just be used for diseases. You may remember in the movie Gattica there was one of these devices being used for personality analisis. How long before (even if made illegal) employers feed this information in about employees? People run their date's information through a computer to try and predict compatibility?

    1. Re:This isn't as good as it sounds by DEBEDb · · Score: 3, Funny
      Yes, but I believe they have to disclose what they intend to do with it.


      Some companies bottle it...

      --

      Considered harmful.
  6. But by vasah20 · · Score: 3, Funny

    ... we all earned from Bart in episode 2F20 (The conclusion to "Maggie Shot Mr. Burns") that no court would ever accept DNA evidence!

  7. This is very premature technology by Adam+Rightmann · · Score: 3, Insightful

    Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

    We don't know enough about the genetic code yet (whether we should even try to learn it is another debate, you need only look at how Western Society has been damaged by the results of invetigating the poor fertility of yam-eating Mexican Indians) to do more than rough guesses that are about as accurate as asking about your families medical history.

    If you want to live longer, eat right, exercise and don't smoke. I'm sure our Pope will soon ban this useless exercise, anyhow.

    --
    A. Rightmann
    1. Re:This is very premature technology by zeoslap · · Score: 5, Insightful

      First off he's not my pope. Secondly it's far from useless, understanding who we are has been a driving force for positive change through the ages, lets not kid ourselves into thinking that knowledge is a bad thing...

    2. Re:This is very premature technology by f97tosc · · Score: 3, Informative

      Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

      And they never will, because the cancer is very dependent on certain random events (incorrect cell duplications), and heart attacks on diet and amount of exercise.

      Tor

  8. Venter by Anonymous Coward · · Score: 3, Informative

    I read that J. Craig Venter (owner of Celera, who beat the HUGO project to sequence the human genome) sells the opportunity to have your own genome sequenced for 500,000$

    1. Re:Venter by genomancer · · Score: 4, Informative

      What Celera/Ventner are selling for .5M is having your genome SEQUENCED, not scanned. The former is a base-pair level map of your entire genome. The latter is checking certain windows to see if they contain a known, small, problem causing mutation, (as well as some large checks for rearrangements and such).

      It's sort of the difference between reverse compiling the entire suorce code for an app (hard), and checking certain locations for passwords/corruption/etc.

      G

      Ps: Celera's map didn't really beat HUGO, they're both totally incomplete, with tons of errors known and unknown.

  9. Soon to be overheard... by azadrozny · · Score: 3, Funny

    ... on school playgrounds everywhere:
    "My genome is better than your genome!"

  10. Wow... by KenCrandall · · Score: 5, Insightful

    Did anyone other than me just get *TOTALLY* creeped-out by that article? Not the Gattica references, although the social implications are staggering (i.e. the Philip-Morris quote), but more of the feeling that knowing all the things about my body that *could* go wrong, and trying to treat them in advance is just something that we don't understand the ramifications of entirely?

  11. Genetic predispositioning... by UnidentifiedCoward · · Score: 5, Insightful

    is *NOT* the same as actually being diseased/sick. Just because you carry a ressive trait for diabetes or heart disease does not mean that you will suffer from either. I already know I am "predisposed to heartdisease and diabetes", my grandfather had it. I do not need a DNA scan to tell me.

    You tell some people they are predispositioned for heart disease and they are going to think it is a death warrant. Even though it is only a chance, people will throw money at it in attempt to do something about it. More importantly this will spawn a whole new branch of medicine where you sell drugs/therapy to healthy people. We are already starting to see that practice today, look at the logic behind pepcid/ac, the heartburn medication you take over the counter *before* you have heartburn.

    Just my two cents.

    1. Re:Genetic predispositioning... by bhsx · · Score: 3, Interesting

      While I agree with you to some extent, what if your grandfather brought about his own diseased heart? You would not have a predisposition to it from him (although you might from other members of your family tree that never actually suffered heart disease). You might be fooling yourself into thinking that not smoking and drinking lots of anticarcinogens is helping you, not knowing that your great-great-great-grandma had a hell of an alcoholism/adictivism kick in her gene pool that drinking all that red wine is plugging into.
      Just a thought.

      --
      put the what in the where?
  12. Needs to review his genetics by sacremon · · Score: 5, Interesting

    "For instance, you might have a CG that makes you susceptible to diabetes, and I might have a CC, which makes it far less likely I will get this disease."

    CC is not an allowed base pairing. It could be GC, AT or TA instead, but CC would be recognized as a defect and repaired.

    --
    If you can't beat them, embrace and extend them.
    1. Re:Needs to review his genetics by Dambiel · · Score: 4, Informative

      he's talking about single strand bases, not pairing

      say you have:
      TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CG CTTGAACCT

      and I have:
      TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CC CTTGAACCT

      we each have a paired strand that would match them, but the CG/CC difference could still change susceptibility to a disease

  13. One page by Klerck · · Score: 5, Informative
  14. Implications... by jaredcoleman · · Score: 3, Interesting

    DNA scanning will fan the flames of the fetus rights debate, as parents desire to alter the DNA of unborn children.

  15. Re:Genescope by Gorm+the+DBA · · Score: 5, Funny
    Not all that close, when you consider that DNA knows nothing about what's happened to you since birth in terms of did you lose an eye in a tragic carrot eating accident, or do you have a scar on your left forearm from that attack by the killer monkeys, or anything else that is nurture over nature.

  16. Re:WHAT? Body scans?! by unicron · · Score: 3, Funny

    If you had bothered to test them you would've seen he was mecha.

    --
    Finally, math books without any of that base 6 crap in them.
  17. Geography by mccalli · · Score: 3, Interesting
    I do like the section where he finds he's genetically similar to the geneticist testing him....

    We check a map of Britain on his wall, and sure enough, the Sykes family's homeland of Yorkshire is less than 200 miles south of Perth.

    Err...Britain's not really that all that big. 200 miles is considered a fair distance here. I'm from Yorkshire originally, and there's no way I would have considered Perth to be close.

    I've sinced moved further south. It's 160 miles between where I came from (Sheffield in Yorkshire) and where I moved to (Marlow in Buckinghamshire). That too is considered a fair hop, although travelling that distance is something I'm completely used to now. But some of my friends in Yorkshire thing it's a long way to go.

    All a difference of scale, really.

    Cheers,
    Ian

    1. Re:Geography by Gruneun · · Score: 5, Funny

      200 miles is considered a fair distance here.

      My guess is that most of the readers here would willingly walk that distance if it meant getting laid.

    2. Re:Geography by The_Shadows · · Score: 3, Funny

      200 miles is considered a fair distance here.

      My guess is that most of the readers here
      would willingly walk that distance if it
      meant getting laid.


      Well, I would walk 500 miles, and I would walk 500 more just to be the man who walked a thousand miles to fall down at her door.

  18. Hmm by Rogerborg · · Score: 5, Insightful

    I wonder how long before we hear: Only those with something to hide would refuse to be screened. Using encryption (for example) just pisses off government, but there's nobody with deep pockets brib^H^H^H^H lobbying them to ban it. But insuring sickly people costs insurers big money. How much would it cost them to buy laws to make screening mandatory, or at least to allow them (all of them) to insist on it if you want a policy? At the least, I expect to see policy rises for those who refuse a screening, on the basis that only those with something to hide...

    --
    If you were blocking sigs, you wouldn't have to read this.
    1. Re:Hmm by msheppard · · Score: 5, Insightful

      Flip side: What if I get screened, show up super-clean, and want to pay less for health insurance? Shouldn't I be allowed to contract with an insurance company that only insures those that are screened?

      What are insurance companies allowed to discriminate on:
      Age? Yes.
      Sex? Yes.
      Smoker? Yes.
      Race? No.
      Relegion? No.
      Occupation? Yes.
      Licensed Private Pilot? Yes.
      Credit Raiting? Yes.
      Bungee Jumper? Yes.
      Genetic Predisposition? Maybe!

      In the end it's all numbers. If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts... the insurance company should charge more to those in blue shirts. If you don't like this, go find another insurance company. It's legit to setup an insurance company that charges everyone excatly the same. If you're a 21 yr old smoker who flies ultralights, this might be the best bet for you. But if you're in perfect health and are extra careful with your self and have no predisposition, who are we to refuse this person the oppertunity to pay less. It's all gambling and knowing the odds changes the deal.

      M@

      --
      Krispy Cream is people
    2. Re:Hmm by runlvl0 · · Score: 3, Funny


      If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts...

      I always thought that it was the ones in the red shirts who died first.

      --

      Carthago delenda est!
    3. Re:Hmm by JoeBuck · · Score: 5, Insightful

      OK, let's say that the insurance companies can get prediction based on both genetics and lifestyle to the point where the money you pay them almost always exceeds the money they pay out for your health care, barring accidents, and even for accidents their lifestyle data gives them good insight into your probability of being hurt.

      This would mean that, for the majority, insurance would become vastly more expensive, to the point where it would become unaffordable. The government would have to pick it up, and effectively tax the healthy to help pay. The alternative is just to leave more and more people with no insurance at all, which will quickly drop the US life expectancy down to third world levels. So you just wind up killing the concept of private insurance altogether. This might be a good thing.

      Also notice that in countries with a single-payer system, good genetic screening is much less of a problem. Since the government system is going to pay to treat everyone anyway, knowing in advance who's susceptible to what diseases might actually reduce costs, by focusing the right treatment on the right people. So it might well be that it is this "Gattaca" stuff that finally kills the broken US health insurance system.

    4. Re:Hmm by Yokaze · · Score: 3, Insightful

      > If you don't like this, go find another insurance company.

      Such a insurance company would cost much more and would make it inhibitable for lesser fortunate people to afford such luxury.

      In a purely capitalistic society this would seem approriate.
      But, at least to me, it seems unethical.
      Why is it unethical to discriminate on basis of genetics?

      To a similar reason, why it is unethical to discriminate on the basis on race, place of birth, zodiac sign.

      First, the mantra "correlation is not cause" applies here to some extend, too. "You are black, so you will live shorter." is an example. In contrast, smokeing is unhealthy. That is a proven fact and not just a statistical correlation, like the decrease of the population of storks and a correlating decrease of the birthrate. Similar is currently true for genetic screenin.
      As explained in the article, you may well have a predisposition in one gene for a certain malice, but it is far from known, how this may affect your life, as the same person may have some unknown genes, which compensate the predisposition.

      Second, and more importantly: You can't choose your genetic make-up, where you're born and when.
      Willingly punishing someone for such things is unethical.
      At least according to my moral codex, which is the result of my upbringing. Maybe yours differ, but I thought the civilised world agreed upon this.

      --
      "Between strong and weak, between rich and poor [...], it is freedom which oppresses and the law which sets free"
  19. Am I sharing again? by sam_handelman · · Score: 5, Interesting

    DNA is the book of life. It's also the book of death.

    Hard science journalism at it's best. Sheesh.

    This, I'm told, is the first time a healthy human has ever been screened for the full gamut of genetic-disease markers.

    Yeah, RIGHT. Imagine that lab meeting: Guys, I have a plan, we've never done this before, so lets invite in a journalist and see if we can humiliate ourselves.

    Braun, 46, is both jovial and German.

    Yes, Homer, Germany is the land of chocolate.

    These disease-causing SNPs are fueling a biotech bonanza; the hope is that after finding them, the discoverers can design wonder drugs.

    The hope of many of these bottom feeders is that they can identify an SNP and exert some intellectual property over it to horn in on whomever actually can find a treatment. Anyone want me to deliver another manifesto on the evil of this approach?

    Alright - let's talk genetic diversity.
    As Braun explains it, somewhere in the past, an isolated human community lived in an area where the food was poor in iron. Those who developed a mutation that stores high levels of iron survived, and those who didn't became anemic and died, failing to reproduce.

    Good point! This is reason number one NOT to reduce the genetic diversity of the human race. All of these alleles floating around the population - which may become increasingly rare as there is selective pressure against them, and may even cause considerable suffering or death to some of those who carry them - should not be removed from our collective gene pool, at least not without considerable discussion. Why? Because WE MAY NEED THEM. A monoculture (were all organisms have the same genes) is not sustainable in a biological sense.

    This is also one of the great tragedies of our times - sub-saharan africa contains only a fraction of the human population, but it contains over a third (depending on how you measure it) of human genetic diversity. The region of the world being devastated by AIDS may contain any number of alleles which our decsendents may need in the population in order to face the challenges of the future, whatever they may be.

    "Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."

    Note that this gene doesn't make it safe to smoke - smoking still causes heart disease and so forth in these people. Still, a treatment to clone this gene into your lungs could make billions, no (clone as in move DNA around)?

    These genetic modification treatments may not be such a good idea, either. You all remember in 1999 when a research subject at Penn died from a liver treatment (search for "liver")? The upshot is - anything that delivers genes into a person can, and sooner or later will, go out of control and do things you don't expect. Killing the subject is the most likely, but frankly least frightening, of these possibilities. The real threat - and my colleagues in biotech like to play this down but I am not at all convinced by their arguments - is that vectors for DNA delivery into humans could go wild and become contagious.

    Of course, I'm opposed to animal organ transplantation for fear of introducing new human pathogens, so maybe I'm just a naysayer.

    --
    The good and new comes from no quarter where it is looked for, and is always something different from what is expected.
  20. My DNA test.. by grub · · Score: 5, Funny


    .. The last time I was at my physician he wanted a blood sample, a semen sample, a urine sample and a stool sample.

    So I gave him my underwear.

    [rimshot]

    --
    Trolling is a art,
  21. My take on this by Anixamander · · Score: 4, Insightful

    While screening is an ominous first step, prenatal screening and gene therapy are where this gets really frightening. For starters, as with any cutting edge medical technology, this will be expensive. Therefore, those who would "improve" the dna of their offspring will be the elites. As they branch out from diseases to other areas...intelligence, looks, etc., the line between the rich and the poor will only grow wider. And here in the U.S., minorities represent a greater percentage of the poor than their overall numbers, meaning any growing divide between rich and poor will also widen the racial divide. Unless society comes up with some good answers, the spells big time social problems for the future.

    --
    Do not taunt Happy Fun Ball(TM)
  22. About the Author by Nintendork · · Score: 3, Informative

    I did a google search on the author's name and found his page. This guy's got quite an impressive list of books and articles. http://literati.net/Duncan/

  23. It was so much easier.. by grub · · Score: 5, Funny


    .. back in my granddad's day when you could just discriminate based on skin colour. Now you have to be a damn scientist to hate people.

    Yes, I'm joking!

    --
    Trolling is a art,
  24. Why is everyone so negative? by f97tosc · · Score: 4, Insightful

    With the risk of getting a flamebait mod, perhaps it is worth pointing out that the technology is not all bad.

    So it is creepy to get a genetic test, but also it can be quite useful. If you have predisposition for an illness then you are much better off knowing it in advance so that you can test frequently and adapt your behavior (e.g., diet).

    And of course, if you still don't like it, you don't have to.

    Now somebody will predict that insurance companies will force everyone to do the test, I'll save you the trouble and reply right away. The scenario is unlikely, because there are quite a few legal limitations on what these companies can and cannot ask for - and the majority of registered voters are very sceptical.

    But even if it did happen, would it necessarily be so bad? Widespread testing would make the total, and therefore the average, cost of insurance lower. This is because it is easier and cheaper to treat illnesses at an early stage. Certainly those with certain predispositions would get a higher premium, but would not even that be preferable over paying a standard premium and then getting an illness that could have been averted by frequent tests and say the right diet? One could also think of taxes and subsidies supporting those that got higher premiums. Since the total medical costs would go down, it is at least theoretically possible to come up with a system where everyone is better off.

    Tor

  25. Smokers rejoyce! by DCram · · Score: 5, Funny

    my fave quote from the article.
    "One gene seems to shield smokers from lung cancer. 'That's my favorite,' says the doctor, a smoker. 'I wonder what Philip Morris would pay for that.'"
    Ah yes.. now I can blisfully tell myself that yes I must have this gene and therfore my smoking is A.O.K

    Huzzah!

    --
    If I were only smart enough to accomplish the things I dream about.. Or maybe too dumb to care.
  26. Re:Genetic immunity to HIV? by runlvl0 · · Score: 3, Funny

    What is a CCR5 "defect"?

    A defect normally implies that the system has gone array, however, in some cases defects or simply modifications from the normal genetic code, are helpful. In this case the defective CCR-5 genes contain a 32-base pair (bp) deletion. This deletion causes a shift in the reading frame which results in a severely truncated protein which is unable to reach the cell surface. With this defect AIDS progression is slowed, allowing someone to survive longer. Thus, in this case the defect is actually protective.



    So, it's a buffer overflow exploit, then?
    --

    Carthago delenda est!