Slashdot Mirror


Hilary Rosen Defeated at Oxford Union

yogi writes "Oxford University Students' Union had a debate last Thursday, titled This House believes that 'the free music mentality is a threat to the future of music.'. Ordinarily, not too exciting, but since it is the Oxford Union, they get Hilary Rosen to speak. She lost the debate, and had to have pictures like this taken. Read the writeup at NTK, or a more detailed one here. I especially like the bit where she asked all the file downloaders whether it made them buy more music."

37 of 359 comments (clear)

  1. Debate is getting old by traskjd · · Score: 4, Insightful

    Does anyone else start getting sick of this? The debate is getting so old and the only people saying free music is damaging is some of the artists and the RIAA. I guess it will end up being like open source vs. closed source - and I bet the artists who embrace allowing online downloads will be more sucessful in the end (of course when I make that comparison I also mean that the artist is signed up with a label because they need some form of money - but yet some artists still support downloading their music for free because they have read the research). Hope that all makes sense. What do you think?

    1. Re:Debate is getting old by cposs · · Score: 3, Insightful

      Yeah, I'm sick of the debate, and maybe it is getting a bit old. However, until the naysayers realize that they are wrong, articles like this one will continue to be newsworthy and will continue to aggitate the majority of the audience here at /. The fact that people do things because of a misinformed view will always get people riled up, espeically when the actors are integral parts in an industry.

    2. Re:Debate is getting old by Pike65 · · Score: 5, Insightful

      When you say "everyone" you mean the online community. My grandparents wouldn't have a clue what the hell peer-to-peer was, but they still buy and listen to music and that makes their opinion as valid as anyone elses, as far as I'm concerned.

      --
      "If being a geek means being passionate about something, then I pity those who aren't geeks." - Pike65
  2. but she looks sad! by Anonymous Coward · · Score: 3, Insightful

    Just look at that binder she's holding - full of arguments and facts about why the evil music pirates are devastating the economy, yet she still gets beaten by a couple of punk college kids.

    She deserves a pat on the back, for at least trying to defend the glorious RIAA's noble quest against piracy (also known as "fair use")

  3. Now only if... by sterno · · Score: 5, Insightful

    It'd be nice if we could have this sort of debate and result happen someplace it really matters like Congress :)

    --
    This sig has been temporarily disconnected or is no longer in service
    1. Re:Now only if... by someonehasmyname · · Score: 2, Insightful

      WTF? How does this get modded insightful?!

      Oh wait, maybe this will be understandable:

      WTF? h0W d0ez THi$ g3T m0dd3d In$IGHtFuL?!

      --
      Common sense is not so common.
  4. I still don't get it... by MacAndrew · · Score: 5, Insightful

    ...why the debate is framed as free music v. the music industry. We can decide to dislike both sides, and still get free music -- by encouraging musicians to self-publish either samples or entire albums as freeware or shareware. For those without internet connections and CD burners, music stores could offer a write-your-own-CD services (and I think I've seen this in prototype?).

    Up to now the recording studios have been like the cartoon syndicates -- a necessary evil because they control the production, distribution, and promotion of music, with staggering overhead. Why does a 25 CD cost $18, anyway, about what it cost when invented 20 years ago? How many non-geek consumers know about this profit margin, and how loudly would they complain if they did?

    1. Re:I still don't get it... by Anonvmous+Coward · · Score: 4, Insightful

      "...why the debate is framed as free music v. the music industry."

      I never really thought it was about music being 'free' anyway. My MP3 searches were about finding new music, not about getting it for free. I saw it as a way of finding stuff I thought I'd like. Paying for it is not an issue. I mean think about it: Buy a CD, open it, and it's yours. You can't take it back if it's not satisfactory.

      So yeah, I'm gonna download songs from the album first before I buy the CD because I'm not paying $15 for 1 (one) song I liked from the radio. How many of you have been burned by that?

  5. Re:Misleading title by dattaway · · Score: 3, Insightful

    I wouldn't throw the party just yet. This was just her round of boot camp training before she goes in front of the lawmakers with her big guns.

  6. Re:Courage or stupidity ? by traskjd · · Score: 2, Insightful

    I would say good on her. Not often the corporates even turn up to things like this even when they say they will. Doesn't mean I like what they are doing but I have a little more respect.

  7. Re:A good quote by Stalyn · · Score: 4, Insightful

    The more we have third party, the closer we get to fairer, European-style representation.

    Do we really want that and is it indeed fairer?

    --
    The best education consists in immunizing people against systematic attempts at education. - Paul Feyerabend
  8. Absence of hard, verified data by GuyMannDude · · Score: 5, Insightful

    I agree. It's getting to the point that EVERYONE has chosen sides and the resulting debate has a decidedly religious flavor (ie, no one will ever switch sides from this point on).

    Interesting analogy. I have to agree with you: there is so much conflicting data that everyone seems to have made up their minds on the basis of their gut feeling. I imagine there isn't any way of resolving this.

    However, I would think that we (the pro-filesharing crowd) could use this ambiguity to our advantage. The **AA wants to limit a powerful technology and impose some dubious laws. And they don't have any iron-clad statistics to back them up. It seems that the burden of proof should be on the **AA to show that filesharing definitely hurts sales. If they cannot show this -- and I don't think they can -- then all their technology-limiting plans should be rejected by the lawmakers. I'm not so naive that I believe this is going to happen, I'm just stating that in a perfect world this non-provable postulate that filesharing hurts sales should be a victory to us. There will always be people who have a "gut feeling" that this is responsible for the financial woes of the music and movie industries, but that shouldn't be enough to enact laws!

    GMD

  9. Re:what was the "different and confusing" set? by GuyMannDude · · Score: 5, Insightful

    I call BS on this. What was the "different and confusing" set she asked for? I have a feeling it was the interesting part of this exchange...

    Yeah, I agree. I, too, would be very interested in seeing what Rosen's follow-up questions were. Can anyone point us to an unbiased, accurate record of what happened? Maybe even a transcript? It's clear that the articles that were submitted to slashdot aren't trying to evenly present what happened that night.

    GMD

  10. Re:what was the "different and confusing" set? by zaffir · · Score: 5, Insightful

    I'd also say that this was a stacked audience. Let's see, you have a bunch of college students that use p2p on a regular basis, many of whom were spreading anti-RIAA propaganda (not that that is bad). And you have the head of the RIAA that is trying to keep them from doing the things they want... come on. The proposition has NO CHANCE when polling an audience like that. I'm actually surprised Rosen asked that question.

    --
    "Upon attaching the waterblock to my penis, I began to notice that I know nothing about computers." -- JRockway
  11. Re:what was the "different and confusing" set? by Danse · · Score: 2, Insightful

    Well, since these are the people that Rosen and the RIAA are concerned with persuading, it makes sense that these are the people that she would want to be speaking to. Do you think they should have had some soccer moms and middle managers thrown in for good measure or something?

    --
    It's not enough to bash in heads, you've got to bash in minds. - Captain Hammer
  12. Should read Rosen defeated in popularity contest by tyrann98 · · Score: 4, Insightful

    Reassuringly, the motion that "This House believes that the free music mentality is a threat to the future of music" was resoundingly defeated by a hefty 256 "Noes" to 72 "Ayes"

    This is more of a popularity contest than a true debate. The RIAA's position is never going to be popular with an illegal file-swapping crowd filled with university students.

    Regardless, The RIAA has every right to pursue its goals (i.e., profit) using legitimate business practices.

    The RIAA is perfectly allowed to sell music using any method they want. It does not matter if downloaders purchase more CDs due to free advertising. If you believe that start a new record company with free music from your site. Nobody has a right to force a new distribution method on someone else. I prefer the BSD license, but I don't go out and illegally change GPL software to BSD. People have the right to use any license they choose. Similiarly, artists have the right to release free music if they want. They are not forced to sign a contract with anyone. Plus, the distribution method of choice - the Internet - is perfected suited for free music.

  13. Perhaps a calculated move by GuyMannDude · · Score: 5, Insightful

    to go to a university only to face a crowd of filesharing student can either be pictured as stupidity or courage, so let's at least give her that: she was coureagous. She ran into the wolves house!

    Disclaimer: because of the poor write-ups posted, I don't have a good idea of what actually happened at this debate and how fair it was. With that in mind, consider the following theory: Hillary figures she can 'win' no matter how the debate turns out. She has a chance to talk to the crowd that are the biggest filesharers. This is her chance to hopefully convince them that what they're doing is wrong. With a little luck, she'll be able to convince someone in the audience who happens to be in a position of power regarding the computer facilities of the school. She figures if the debate is 'fair' that she's got a reasonable chance to getting her message across. She won't be able to convince those whose minds are already made up, but perhaps she can bring a few students back from the Dark Side.

    Now consider the case of an 'unfair' debate. If the debate is 'not fair', perhaps some students will realize that and sympathize with her. But even if she isn't able to convince anyone in the crowd that her position is right and the whole debate ends up being a crazy show, she can then take a videotape or transcript of the 'unfair' debate with her to other people (like politicians) and use that to convince swing-voters that the pro-filesharing crowd is just a bunch of hooligans. She willingly goes into the lions' den to gain sympathy from others when she shows them her 'scars'. "I tried to explain my position and look how they treated me? They're animals!"

    This is just a theory. But to characterize her action as either courage or stupidity leaves out another very real possibility: calculating.

    GMD

  14. Who voted to determine the outcome? by geekee · · Score: 2, Insightful

    Asking whether she won or lost is like sending a republican to debate at a democratic convention and having the democrats vote on who won. Give me a break. Although she's bringing up the practical aspects of what p2p does to their business, this isn't even the issue. The issue is whether it is legal for people to share copyrighted without the permission of the copyright holder. The answer is no. It's very simple. Even Janis Ian agrees that you need the permission of the copyright holder. The RIAA has the right to do business anyway they choose. Your only right is to refuse to do business with them if you don't like what they offer. You do NOT have the right to violate copyright just because you don't like the way they do business. It's as unethical as stealing cable, photocopying books, etc.

    --
    Vote for Pedro
  15. commercialism by g4dget · · Score: 5, Insightful

    This House believes that 'the free music mentality is a threat to the future of music

    Well, "this house" believes that it is rampant commercialism that is actually a threat to the future of music.

  16. of course she lost by Anonymous Coward · · Score: 5, Insightful

    She was in a room full of people who buy and listen to music.

    This is definitely NOT the place for an RIAA exec to be. They should be with other executives and the occasional politician. That way they can avoid the whole issue of customers and business models, and focus on what's really important: new legislation.

  17. The bigger question by KFury · · Score: 4, Insightful

    Considering how online-centric we are now, how valid is it to ask about dirtworld CD sales without finding out what kind of behavior consumers would have, if it were easy to buy the music they like online, for digital download, with price-parity with CDs, adjusted for savings in fabrication and delivery costs.

    They're asking us to pay for a distribution system we don't need, and that's what offends me as I'm struggling to tear off the stupid sticker holding my new CD's jewelcase together before I put the disc into the reader to be encoded to the only format I use anyhow.

  18. Re:Finally the great question is answered... by seen2much · · Score: 3, Insightful

    Look at the price of a videotape versus DVD. I can understand that right now DVD do cost more to produce but in 5-10 years the opposite will be true. But do you think DVDs will drop in price to the same level as videotape. I seriously doubt that. And the extra features added do not add that much to a DVD experience, much as I like them. I forsee the greed of the MPAA by keeping the price as high as it is.

    --


    "Beware the squirrels"
  19. Re:Should read Rosen defeated in popularity contes by Methuseus · · Score: 2, Insightful

    I have one problem with your comments. It sounds like you are saying that we don't have the right to try to convince the RIAA that they are harming the industry rather than helping it. And saying "illegal file-swapping crowd filled with university students" is wrong because pretty much everyone that was there said they buy more music because of the file sharing. Talk to some RIAA execs for a bit about the subject. Not one of the ones that has been coached; a real one that is deeply entrenched in the Association and shares their values. You'll get the impression that they don't care about the artists unless they make mega-billions. And even then they only care about the money from the artist. I've gone a bit long on this. I'm not sure exactly what you meant by your comments, but implying that someone can't tell a draconic, corrupt corporation to kiss their ass will really piss lots of people off.

    --
    Two things are infinite: the universe and human stupidity, though I'm not yet sure about the universe. - A Einstein
  20. Re:Off topic but... by Anonymous Coward · · Score: 1, Insightful

    >This all reminds me of my old boss; 70+ yr old Jewish man from NYC who used Napster to download old speeches (Winston Churchill was his favorite) and such other things that were hard to find anywhere locally (library etc).

    That brings up one of the major failures of the RIAA. Thehy don't understand their own business.

    With CD technology, you can make a master, and pretty much make copies on demand. So your entire inventory can continually expand. Nothing need go out of print.

    The market for Churchill's speeches might be small. But it is above non-zero. So keep the entire CD Collection in print. [ IIRC, it was around 40 CDs. ]

    Or in the music I'm interested in [ Xhosa & Zulu musicals ] once the CD has been cut, keep the thing in print, so that one can order it through their local / online CD outlet.

  21. Re:Should read Rosen defeated in popularity contes by FauxPasIII · · Score: 5, Insightful

    >> Regardless, The RIAA has every right to pursue its goals (i.e., profit) using legitimate business practices

    Bribing Congressmen to pass a rampantly unpopular law that criminalizes fair use copying rights does not fall under the heading of "legitimate business practices". Neither does deploying technological measures to make it impossible to exercise said rights.

    I'm disgusted by how many so-called libertarians are so quick to jump to the defense of the RIAA when it's obvious they have no interest whatsoever in playing by the rules of the fair market. The market has sent a pretty unequivocal message that they want the middle man out of the loop, so the middle man tries alternately to make it either illegal or impossible not to play by their rules. Bleh.

    --
    25% Funny, 25% Insightful, 25% Informative, 25% Troll
  22. Greed by nr · · Score: 2, Insightful

    Why wont prices on CDs and DVDs go down?

    Well the answer to that question is spelled greed, for record industry its never enough, they always want more. The same goes for some of the artists, why earn only $1 milion for a album then you can earn $10 milions. So theres no reson to cut CD prices from $20 to $5 even if they easily could do. They will continue to rip off the consumers as the only thing they do care about is the money flow and increasing profits. At a certain point the consumer will stop and say ENOUGH!. Greed will kill RIAA and the big record companies, P2P and CD burning is the sword that will cut the head of the beast.

  23. Irrelevancy by quantax · · Score: 5, Insightful

    It is good that these types of debates go on, but at this point how does this even matter? We all know Rosen is not going to be like, "Oh, I was wrong after all, music should be free for all." And nor is the opposite party going to say, "Damn, we are horrible people for stealing those poor people's livelyhoods from them."

    No one is going to change their position. On top of that, this nice little debate is more or less useless. None of those students are congress people, and Berman is has shown his resolve. Nothing has changed in that exchange; we are still hurtling towards an unknown conclusion which this debate does nothing to address or even pretends to address. In the end, the students went and drank some beers and the 'big-wigs' went back home to their legal documents. This is an intellectual excersize and shows zero results other than some transcriptions and a couple webpages. We would be better off sending mailings to our representatives than listening to some nice, feel-good debate that made Rosen look foolish for a couple minutes.

    --
    "What can a thoughtful man hope for mankind on Earth, given the experience of the past million years? Nothing." -Bokonon
  24. Re:Should read Rosen defeated in popularity contes by drinkypoo · · Score: 5, Insightful
    Similiarly, artists have the right to release free music if they want. They are not forced to sign a contract with anyone.

    We all know that this is literally true. No one is forcing these people to sign contracts. I wish some of them would have been forced not to sign contracts, in fact. I'd have held the gun on Don Henley. If I'd have been alive then.

    I'd have held two guns on Rod Stewart.

    But on the other hand, if you want to be a music superstar, you have to sign a contract with a major label. Otherwise you don't get put on MTV/VH1, you don't get put on Clearchannel, you don't get put in the major record chains across the country who are penalized (by withholding of ad material and certain albums, or pushed-back release dates) for stocking music which doesn't come from a member of the RIAA.

    So sure, no one is forced to, but you cannot "win" the game (assuming you are measuring success monetarily... at least it's a numeric metric) without signing with a major label.

    --
    "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
  25. Re:Should read Rosen defeated in popularity contes by King_TJ · · Score: 4, Insightful

    As another Libertarian, I agree wholeheartedly with you.

    In fact, I often find myself at odds with other Libertarian-leaning individuals on the whole copyright/piracy debate.

    Certainly, Thomas Jefferson himself was not a fan of the ideas of patenting ideas or extending terms of copyright out to great lengths of time.

    "It has been pretended by some, (and in England especially,) that inventors have a natural and exclusive right to their inventions, and not merely for their own lives, but inheritable to their heirs. But while it is a moot question whether the origin of any kind of property is derived from nature at all, it would be singular to admit a natural and even an hereditary right to inventors." - Jefferson

    "He who receives an idea from me, receives instructions himself without lessening mine; as he who lights his taper at mine, receives light without darkening me." - Jefferson on Copyright

  26. Re:Jack Valenti by Akilesh+Rajan · · Score: 2, Insightful

    Sorry, but I don't think there are currently many good economic reasons for people to buy music/movies/software if they can easily download or copy such items for free.

    "So I can have the full-resolution "original" at hand on durable, read-only media that can't get accidentally erased by a Windows crash."

    People already trade uncompressed music. This will become even more common in the future as bandwidth gets cheaper. You can burn the uncompressed music on a CD-R in 3 minutes on a new recorder on media that costs $0.50 or less.

    "It also gives me someone to bitch at if the disc turns out to have a real, physical defect (as opposed to an artificial defect, like copy protection)."

    No need to bitch if you can simply download another copy.

    "So I can have the manual."

    Instead of spending even $50 for the software, spend $30 for a third-party manual that is likely miles better than the included copy.

    "So I can have original, trusted media from which to reinstall when Windows trashes the disk/trashes the registry/runs the latest virus/etc."

    You could always burn your downloaded copy when you first obtain it and know it's healthy.

    "So I can have someone to bitch at if the software itself trashes my work."

    Possibly the most legitimate reason. But depending on the cost and nature of the software, and how responsive the company is, this often simply isn't worth it.

    "Being a software engineer myself, to show my appreciation for work well done."

    Good for you, but I don't think that this is a strong enough motivation for most people to buy what they could easily obtain otherwise.

    I don't think that the model of buying music and mp3s album-by-album or song-by-song is a viable long-term model. It should be replaced with a service that promises bandwidth, continuity of access, legitimacy, selection, and convenience. The new music services like listen.com are moving in the right direction, but the selection and quality are still lacking, and the price is too high.

  27. Why is it so hard to understand? by scoove · · Score: 5, Insightful

    Keep you hand up if you buy more music because of it"

    Hmmm... heard Funker Vogt on shoutcast a few weeks ago.

    Enjoyed it. Downloaded a few tracks via gnutella. Yup, this definitely is a group I like.

    Went to Best Buy. WTF? No Funker Vogt. Went to CD Warehouse. Nope. Never even heard of them, let alone my fav Apoptygma Bezerk, VNV Nation, Front Line Assembly, etc. "Sure we have industrial..." as the salescritter points at the rap section (ugh... where do they hire these people from?).

    So Ms. Rosen, how am I supposed to be a complying RIAA citizen when you won't even sell me the music?

    As usual, it was off to cdnow.com, buy one of everything Funker Vogt, and wait for the UPS guy.

    Conclusion:

    1. I'm waiving money in your face but you won't sell product to me.
    2. You can't seem to figure out how to distribute music worth a damn.
    3. You keep signing a few worthless artists and pumping their music (while we still don't buy it), rather than understanding the market changed on you.
    4. You and the radio broadcasters sign deals trying to limit airplay to the same crap you signed, but now the radio broadcasters can't find listeners and had to destroy Internet broadcasting before it destroyed them.

    So, maybe there's another problem that explains why your sales numbers suck?

    *scoove*

  28. This is good... by di0s · · Score: 2, Insightful

    But still nobody representing the artists themselves...

  29. Take Hilary to lunch by primenerd · · Score: 3, Insightful

    This may sound a little odd, but I feel sorry for Miss Rosen. She is, after all, merely trying to do her job of defending the recording industry and its business model. I think it would be fascinating to sit down with her over lunch and listen to her side of the debate without so much of the hype that seems to accompany this topic. I do not think she would convince me to see the world her way, but it would be an interesting way to spend my lunch hour. Who knows, she might just be a very nice person outside of the Internet music nastiness we are all familiar with.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  30. Re:A good quote by Baki · · Score: 3, Insightful
    Yes, it is fairer. Is it fair that (in a district system such as the U.S. has) one person gets to represent all people in his area, even if only 60% voted for him? No, if 60% voted, about 60% of influence should go to him, 40% to other(s). The last presedential election (a few votes making the difference between one person or the other) shows this clearly. In 'european style', like in Germany, Switzerland, Netherlands etc. such things are irrelevant, since no person with much power is directly elected, only the individual members of parliament (chosen in proportion). These members proportially representing the people then see what combination of parties can cooperate and thus form a majority goverment.

    Thus, a representative system is better. The parliament reflects the division of political forces/thoughts in society. Because of this you get less concentration of power at a single or at two parties (b.t.w. the UK does not have a 'european' system either).

    Another practical advantage is that you do never get one party governments, but usually 2-4 parties make up the government (Switzerland, for example, has had the same 4 parties in the government for 50 years). These must find compromises amoungst them, which leads to less 'fast' but to more stable lawmaking and government.

    In 'extreme' systems such as the U.S. chances are that the next government reverses the policies of the former. Instead of gradual evolution you get large changes that nullify what happened before. This is inefficient and shortsighted.

    Note: France and the U.K. don't have a representative/proportional system either, this because of a coarse district system which always shifts balance of power to one party. Also in France, the president is directly elected, and he (like in the U.S.) is a person with real power.

    In contrast, the german president is only a ceremonial figure who is elected by parlaiment. The dutch king/queen is not elected either and also is only ceremonial. In such system, no single person holding very much power exists, and such persons are never directly elected.

  31. Not anything like lawmakers by zenyu · · Score: 2, Insightful
    If Rosen had given $100,000 to those student union members voting for her, and $2,000,000 to those vocally supporting her position then it would be something like a congressional debate. Without bribery you might as well get rid of the so called "representatives" and have a democracy.

    I know there are going to be those that rally for proportional representation, but you still have bribery targets in that type of system. It would be easy to switch to democracy now that we have technology like television, radio and telephone. And it would be bribery immune, or at least require that the funding for the bribes would be not be off the backs of at least half of the 30%* of the population that votes in Senate elections. 15% is a lot better than the 4.8% support you need in the USA to elect a majority Senate now. The house seats are effectively unelected in all but a dozen cases, no point in even thinking that's an elected body. But while you could elect representatives with proportional representation, all would still accept bribes, 40 million people are much harder to bribe effectively than 51 Senators (or less if you actually have anyone agreeing with you before they see the check.)
    * 30% guestimated, all other figures calculated from 30% times known figures.

    The hemp the constitution is written on is wasted. Keep the bill of rights, strengthen it, and then start over on the rest. We don't need a Senate to preserve slavery anymore, and the House is an outdated concept, elect some people to debate each side in an issue before bills are proposed, but god forbid don't let those scoundrels vote!

    The DMCA would not have passed the Senate 99-0 in a democracy, hell none of it would have passed except the safe harbor for ISPs.

    The guy who didn't vote, Gregg, is trying to pass a law making encryption illegal unless you give the secret key to everyone first. I can't believe such an idiotic walking turd wouldn't have voted against free thought if he were there that day. The internet cencorship bill(CDA) passed 84-16, a little better you think? But then that one was blatantly unconstitutional, in any fair system passing such laws should not only be illegal but punished with jail terms or fines. 99-0 on the DMCA! An issue where the informed public is somewhere much much nearer to 0-99. Passed without debates or amendments allowed...

    Without considering the bribery, err donations and gifts, you'd think a cat at a keyboard passes the Turing test better. But these are not severely mentally challenged men but simply career criminals that just happen to run our government.

  32. What the Music Industry Needs... by GospelHead821 · · Score: 3, Insightful

    They need to understand that modern consumers, many of whom are now college students, are less and less frequently buying music by artist or genre. It is becoming far more common for consumers to acquire merely the songs that they like. Since the music industry refuses to accept this mentality, filesharing is the most effective way for consumers to acquire only the music they want. Until the music industry realizes that there is a lot of profit to be had in giving consumers exactly what they want, they're going to continue to suffer whatever losses they suffer now. Music distributors must have the authority and means to give consumers exactly the songs they want. If consumers can cheaply rip-mix-burn, there is nothing preventing music producers from doing so even more cheaply. If they do not make these changes now, when the university students become adult consumers, the music industry is really going to feel the pain they've been complaining about all this time. There's no reason why they should not take steps to prevent such discomfort, especially since doing so would probably increase their profit margin, since it would draw in people who currently avoid commercial music, for the inability to avoid the 6 bad songs that come with the 3 you like.

    --
    Virtue finds and chooses the mean.
    Aristotle, Ethica Nichomachea
  33. Why did she go? / Background info. by Aguazul · · Score: 5, Insightful

    I'd also say that this was a stacked audience. Let's see, you have a bunch of college students that use p2p on a regular basis, many of whom were spreading anti-RIAA propaganda

    I followed the discussions and preparations in the CDR, although I didn't go myself. I have to say that we were not at all sure that the debate could be won. Oxford is a very strange place, and Oxford Union is stranger -- a private members-only debating society which perhaps could be described as a little bit elitist.

    As to why Hilary Rosen chose to go to an debate with students -- it is because of the prestige of debating in one of the oldest debating societies in the world. You have to dress up (black tie for men), you go to a special dinner with weird and ancient customs (if you've never been to an Oxford college, you have no idea!), and so on and so on. Take a look around the Oxford Union site.

    Also, with a place like Oxford Union, this isn't some shallow debate. Rather it prides itself on getting to the bottom of the issue, with lots of intelligent minds on the job. If the RIAA's case stood on logical grounds, she would likely have won the debate. That is why this is a significant result! The truth of the matter is that even with all the conservatism of Oxford, Hilary and friends couldn't make their arguments stick.