Slashdot Mirror
Antibiotic Resistant Staph Infections
LinuxGeek8 writes "There's a news update on a previous article about the first case of antibiotic resistant staph infections. The woman who has the infection is being kept up to 6 months in an isolation room. She is taking an antibiotic that is working, after many others did not.
"In the scheme of public health threats, this has to rank close to the top," David Ropeik, director of risk communication at the Harvard Center for Risk Analysis, said of antibiotic resistance."
West Nile is a virus. There are no antibiotics for viruses, only treatments and immune shots. Immune shots allow our own bodies to make antibodies against viruses, so they shouldn't be susceptible to a similar problem with viruses (although immune shots must be taken at least several weeks before exposure to the virus).
It is fairly common for many types of bacteria to swap genes. I don't think it is very common that you can observe such a concrete trait being transferred from one species to another.
It's not so much 'theft' as 'mating'. . .gene exchange is just one method by which bacteria maintain genetic diversity.
If you'd read the article as opposed to jumping at the opportunity to blame animal farming, you'd have read the vancomycin resistant staph infection (and it's presence in the Detroit area) is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's. They were attempting to avoid infections.
So just use regular soap, sterilize things with alcohol or bleach, and don't eat meat (besides the antibiotics, there's all KINDS of other nasty stuff in that stuff)
Do you really need reason for beer? Wingman Brewers
If you read the article, the resistance is attributed to theft of genetic material from another organism. So those bacteria which were most effective at stealing vancomycin resistance survived to breed, and pass on their criminal legacy.
Many health professionals hope that following this summer's discovery of vancomycin-resistant staph aureus in the metro woman's foot, Americans will be scared enough to accept limited use of antibiotics.
Not bloody likely. Though maybe if more doctors took the approach that was taken at the Olympic Village in Salt Lake City, the over-use of anti-biotics might start to decline. Not many doctors have that kind of captive audience, though.
It's not a matter of scaring people away from antibiotics, it's a matter of giving them something that actually might work, instead of just giving them something to get them out of the office...
In the creationist's mind, this is an example of "microevolution" and not "macroevolution". The latter of these two is the one that Goes Against God's Plan(TM), etc. They'll go along with staph becoming antibiotic-reistant, but not with staph mutating into an entirely different creature.
This ignores that micro and macro are in reality the same thing to educated people, of course.
The Russians have been working for years on alternatives to antibiotics. Phages are viruses that target bacteria and have been shown to be successful in targeting what would otherwise be very resistant strains. http://www.phages.org/PhageHistory.html
Isn't this just another strain of the MRSA [cdc.gov]
Sorta. You could probably call it VRSA (Vancomycin Resistant Stap... etc). It's a step up as Vanc & it's contempories are generally used to treat MRSA and there really isn't anything more powerful available. It's worrying as you get a bug that becomes almost impossible to treat (MRSA is a challenge to treat and people die but a full spectrum immune bug could be that Ace in the sleeve that the environment produces to curb the rampant expansion of humanity...)
ATBE we've pretty much come to the end of what can effectively be treated with Anitbiotics and a new approach must be found, something that has not gotten a lot of attention what with antibiotics being so effective and profitable...
It's not that I'm Anti-American - I'm Pro-Freedom
There have been rumblings in the news for over a decade that profligate use of anitbiotics in both medical care and factory farming would lead to just this sort of problem. After years of warnings, no one should be surprised by this development. DNA swapping among bacteria species is a well-known phenomenon, and I read years ago that biologists were concerned this very thing would happen.
What's the alternative? Virtually every species of bacteria has one or more virus species that have evolved to prey on it. These bacteriophage (or phage for short) can sometimes be used as treatment for bacterial infection. They were supposedly the Next Big Thing about a century ago, before antibiotics stole the show. Now there is renewed interest in this approach. There was also a recent development of a technique using only a phage-produced enzyme to fight bacterial infections.
Google "phage therapy" or "phage enzyme" for some good reading on the subject.
Viruses such as HIV can swap genes, but only if two strains infect the same cell. This is why new influenza often comes to us from China, where swine, bird and human all live in close proximity and exchange viruses.
The chief engine of genetic change in viruses is caused by antigen drift via mutation. This is due to the error-prone nature of virus replication.
However, drug resistance is found in viruses. AIDS has shown resistance to some of the early retrotranscriptase inhibitors (AZT), not due to gene-swapping, but good old fashioned natural selection.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
What differentiates "antibacterial soap" from "soap"?
One word: Triclosan.
This is an antibacterial agent commonly used in all sorts of consumer products including deodorant soaps. If it's for your body and labeled "antibacterial" check the ingredients. It probably has triclosan. While it is certainly not an antibiotic per se, bacteria can grow resistant to it, producing more virulent strains. See here for a good discussion.
A recent article (too lazy to google again) recently suggested antibacterial and regular soaps do an equally good job of cleaning you of bugs anyway.
I have actually worked in S. aureus research and it is a very scary bug. Some of the strains we had collected were resistant to 12 different antibiotics and even Arsenic. The main reason S. aureus becomes so easily resistant to new antibiotics is because it easily picks up circular strands of DNA called plasmids which carry resistance genes on them. The most likely source of the resistance gene is not cattle but other bacteria present in the hospitals. Enterococcus, a cousin of S. aureus which lives in a person's gut is highly resistant to Vancomycin and it was expected that sooner or later this will be passed to S. aureus. There have been cases of this happening in Japan a few years ago. The best place to pick up a nasty germ is in the hospital since most patiets there are on antibiotics so the only bugs around are highly resistant to a wide range of drugs.
And this is the reason we have drug-resistant bacteria
Unfortunately, the answer is, "all of the above". Overprescription, failure of patients to complete the course of treatment, use of antibiotics in animal feed as a preventative and growth inducer, inappropriate self-treatment (I'd never heard of people mixing antibiotics with heroin, but that would certainly qualify), over-the-counter sales (mostly in third-world countries, but you'd be surprised at what's available at farm stores), heavy advertising by the pharmaceutical industry to encourage more sales. Every time an antibiotic is used, there is a small but finite risk of promoting antibiotic-resistance.
VRSA (vanc. resistant s. aureus) is some scary schtuff. S. Aureus is one of the most virulent organisms we as humans get infected with; aside from the whole being sick in general, it can cause septic shock (death if you're not in a hospital at the time) and VERY rapid failure of your heart valves (called acute bacterial endocarditis). Vanc was once the last line of drugs. If it failed, we had no treatment. Since then, two more classes of ABs have been invented, and we deliberately avoid their general use so they'll be useful in just such situations; some doctors, sadly, don't use this guideline near as much as they need to. Sadly, S. Aureus is also a bacteria which is astoundingly well adapted to take up genetic change. These little buggers actually have "bacteria sex" and share their antibiotic resistance.
Here's some suggestions to help you avoid these problems:
1) Most MDR (multidrug resistant) bugs are found in hospitals (med word: nosocomial). You're relatively safe from this stuff when you're out in the community.
2) TAKE ALL OF YOUR ANTIBIOTICS AS PRESCRIBED. Taking just enough to feel better is the worst idea ever - all the bugs left have now been genetically selected for greater resistance.
3) If the doc says you don't need an antibiotic, don't push too hard - ABs can cause serious side effects and drug resistance in YOU. Remeber - a normal health human has 10x more bacteria than they do human cells - most bacteria are there to help!!!
First of all, the strain resistant to vancomycian has been known since 1993, so sensationalism aside, it's hardly news. I myself experienced this in 1996, after getting the same infection from a stream in Missouri; and I *almost* lost a toe because of it. A more powerful antibiotic, that I wish I could remember the name of, took care of it. By the time I realized it was a serious enough infection to go to the hospital, it was almost too late. (I discussed it in a usenet thread way back then, perhaps I can google it back out).
Now, to the "Antibacterial Soap"
What gives "Antibacterial" soap it's antibacterial property is mainly the molecular structure of the soap. It is lipophilic detergent, which impedes the cell membrane (of the bacterium), essentially stopping it from passing water either way (study the Fluid Mosaic Model to understand cell membranes).
I would imagine that olive oil has as much "antibacterial" properties as a grocery store "antibacterial" soap; so would a soap made from animal fat for that matter.
My understanding is that what makes Triclosan so special is, it simplifies (economizes) the manufacturing process, because it is less expensive to formulate triclosan than the alternatives with similar properties. I'm not trying to say that it doesn't kill bacteria -- it DOES kill bacteria, but the WAY it kills them is through a simple physical process.
I wonder if the patent has had any relationship to the sudden adoption of this chem in practically every personal care product on the shelf?
-fb Everything not expressly forbidden is now mandatory.
Not to push you over the edge, but the antibacterial soaps are controversial; many studies show they are little more effective than regular soap. Some contend the antibacterial ingredients can cause problems all their own.
Most bacteriocides that you'd be willing to put on your skin take a while to work, more time than you'd have the soap on. The most effective treatment is a good scrub, which physically scrapes the bacteria away -- not glamorous but effective. Most of us do a lousy job at handwashing -- it needs to be thorough and repeated during the day, as the bacteria multiply on your skin -- myself included, and I have two of those little disease vectors called "children."
Only 40% of people wash their hands exiting public restrooms, one study showed (imagine being the data-taker); the problem there being the encouragement of the fecal-oral route of disease transmission from the non-handwasher to others. I'll let you visualize what fecal-oral involves. So be a good citizen and lather up.
Oh, and the next time the press reports someone getting sick from beef tainted with E. coli, note that "coli" means colon, where these bacteria were discovered. These E. coli come from careless slaughtering practices and, stated frankly, mean that "there's manure in the meat." (quoting the muckraking author of the excellent Fast Food Nation)
It's a microbe's world after all.
And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.
"Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
Hey, great plugs for "Colloidial Silver". It's natural, right? And anything natural must be a Good Thing, right?
Yeah, kinda like Hemlock is natural.
Check out these links before you hit the natural foods store:
Rosemary Jacob's Argyria Pages -- her skin is a fetching shade of blue-grey, somewhat like the robot on Futurama.
Politician turns blue from drinking 'health' solution -- the Libertarian US Senate candidate from Montana would have had the distinction, if elected, of being the only Blue member of Congress. (I'm a Green, myself).
Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
Think about this: If I get shot in the arm
No, think about this...
Bacteria is everywhere. It's always growing, reproducing, and constantly mutating. So, if you take a sample of any given group of bacteria, it is easy to assume they won't all be of the same breed, and even those of the same breed won't all be of the same genetic line. The fact is, being simpler lifeforms they evolve and mutate faster.
Now, let's say you manufacture a chemical that will kill bacteria "X". You take a dish full of bacteria and since they're very obviously not all the same it is highly possible that a few of those millions will be immune to your neat little chemical. You pour it in and you take a count and let's say only a few dozen live. Well guess what? When they reproduce you're left with a colony of bacterium that is immune to your neat little drug. Next time it gets a good growth pattern going, your antibiotic may not be as effective.
Fortunately, our bodies fight infections on their own, so antibiotics aren't a "kill all" type of attack, but more like a "kill most and let the body take care of the rest". For this reason it is a good idea to ALWAYS take all of your prescribed antibiotics, assuming of course you actually needed them in the first place. You are basically helping your body help it's self.
This too is a gross over-simplifaction but...
"Everything you know is wrong. (And stupid.)"
Moderation Totals: Wrong=2, Stupid=3, Total=5.
If you worked in a hospital, you obviously weren't a doctor or nurse. MRSA is Methicillin Resistant Staph(ylococcus) Aureus--a bacterial strain that is resistant to one of the antibiotic 'big guns' methicillin.
There are few choices of antibiotics left to treat it (for example, vancomycin--though vancomycin resistant staph was observed recently, IIRC). A patient with MRSA is unlikely to survive the trauma of surgery coupled with a serious infection, because the drugs used to treat MRSA are often not friendly in their side effects.
~Idarubicin
The latest all natural fad being used as an anti-microbial is "Grapefruit Seed Extract" (commonly called GSE).
I discovered it when it was recommended to me for a nasty GI virus that wouldn't go away by normal starvation. Killed the sucker right off. As a nursing student I will be trying to bring this into any hospital I eventually work for.
Hopefully, and I don't see why not, it will work against antibiotic resistant bacteria and viruses.
A good overview
Here's a good summary from another site:
Grapefruit seed extract is derived from the bioflavonoids found in the seed and pulp. Its anti-germicide action has shown a growth-inhibiting effect on bacteria, fungi, parasites, and viruses in several in vitro studies. The effectiveness of grapefruit seeds was discovered accidentally by a doctor, who noticed that the seeds did not decompose in his compost file. Further examination revealed that the grapefruit seeds killed any microorganism that tried to decompose it. Laboratory studies have shown it to be effective in inhibiting bacteria such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. Grapefruit seed extract has been formulated by a number of manufacturers for various uses, including an internal bactericide, water disinfectant, skin cleanser, and first-aid spray. Grapefruit seed extract is also a treatment for house pets and livestock that may be susceptible to bacterial infections from a variety of sources.
Multiple anbitiotic resistance in bacteria is documented. I can refer you to a brief article which shows that the med community is aware of it.
* Tenover FC, Hughes JM. The challenges of emerging infectious diseases: development and spread of multiply-resistant bacterial pathogens. Journal of the American Medical Association 1996;275:300-304.
Also, we can consider this from two points of view and see why it's reasonable:
1.) bacteria can transfer genes from one to another by plasmid - a plasmid is a small circle of DNA that's not part of the bacterial genome. so one plasmid can code for resistance to antibiotic A, and another plasmid can code for resistance to antibiotic B. this modularity just from the molecular biology of bacteria makes bacteria well-equipped to deal with multiple assaults. a bacteria doesn't have to independently develop resistance, it can acquire it easily from another bacteria, mix and match etc.
2.) the nature of darwinian selection of the survivalists means that, while it is *unlikely* for any particular bacteria for develop resistance, *once* it does develop resistance, then it will likely survive and multiply under heavy antibiotic environments.
So many people take anti-biotics for everything, and don't complete their prescribed courses, that people forget the other tried and true methods of helping your body and immune system fight a cold.
1. Inhalation of steam and an antiseptic agent.
Eucalyptus oil or Tea Tree oil in water, then heated/boiled is a great way to kill off bugs in the air. Very good for throat/nasal infections. Scented burners are good value for this.
2. Acidic foods/liquids.
This includes oranges, lemons, apples, grapefruit and tomato, including juices of those. Vinegar, particularly cider and malt vinegar, can be good if used as a mouth wash/gargle or ingested (if you can). Salt is also a good thing to ingest when ill, but as always, too much is bad for you. Yes, I am advocating salt'n'vinegar potato chips here. *grin*
3. Mouth washes.
Cider and malt vinegar work well, as does salt water. Iodine throat wash (commonly found under the "Betadine" brand) is also very good, but don't swallow it. Listerine and other mouth washes (for teeth care/plaque) are also good value. And brush your teeth too.
4. Suppliments/herbal treatments.
Echinacea, and other herbal suppliments can help, though be warned that some may have bad or deadly side affects for some people. Ginger is used lots in Chinese medicine, and is apparently quite good for helping someone overcome a cold, but some people are allergic to it. Vitamin suppliments are also good if you haven't been eating right, or can't keep a lot of food down.
5. Fluids.
The kidneys are a primary place for a virus to be flushed from the human body. Don't drink too much though, as it is possible to kill yourself from taking too much fluids.
6. Regular wash/shower.
Sweat is another way for fluids to leave the body, and regular washing helps remove some viruses.
This is not a definitive list. But I'm hoping someone out there might find it useful. There are a lot of NATURAL ways to fight a cold. The goal is to help out the body. If that is by helping to remove the virus or most of the things the body fights against on a regular basis (air-born contaminants, throat bourne virii, etc), then you body will have more resources to chuck at other areas. Just think of the whole thing as a resource based game, where you are the resource. Remember though that too much of something can be bad though, so balance things out.
MRSA strains with intermediate resistance to vancomycin have been seen in many parts of the world since 1996, and patients certainly have died as as result of vancomycin treatment failure. However, these perhaps weren't so scary as the resistance mechanism was a very thick cell wall which made these strains very slow growing and not so viable in the absence of vancomycin.
What's new is that MRSA strains have now emerged with high-level vancomycin-resistance and this happened by acquistion of the vancomycin-resistance gene (vanA) from VRE. That this was possible was shown in the lab in 1992, but the first time it's been seen in patients was this year. The two reports of Vancomycin-resistant MRSA in the U.S. can be found in the CDC's newsletter:
MMWR Morb Mortal Wkly Rep 2002 Oct 11;51(40):902
MMWR Morb Mortal Wkly Rep 2002 Jul 5;51(26):565-7
How scary is it? Until recently MRSA has been almost exclusively a hospital pathogen, so it's pretty scary if you're a hospital patient with a lot of tubes sticking into you which alow the bugs to get in and cause infections, but if you're well it's not a big threat (doctors and nurses can carry MRSA, but generally they don't develop infections despite a lot of exposure). There have been reports recently of strains of MRSA that do spread well in the community, and that can cause serious infections amongst essentially healthy people. However, these have not been multiply-resistant strains, and really these are no worse than virulent strains of normal S. aureus which have been round for millions of years. The message is, if you're well, don't rush out and buy cipro (this will only helps MSRA as the bugs are resistant to it), and if you're ill, keep away from hospitals.
Just to rebut a few other comments: over-prescribing of antibiotics probably is very important for encouraging drug-resistantce, but even correct of use of antibiotics will lead to some resistance. Use of antibiotics in animal feed can't really be blamed in this case, as drugs of the same class as vancomycin (glycopeptides) have not been used in animal feed in the US, though they have in Europe. They've probably played a significant role in VRE transmission in humans in some European countries, but in the U.S. hospital prescribing of this and other antibiotics have probably been the driving force.
It's pretty rare that any human invention outdoes mother nature.
Cheers.
Not kidding...
http://news.bbc.co.uk/2/hi/health/1907065.stm
Deleted