Slashdot Mirror
When Good Patents Go Bad
will writes "The Washington Post has a good
review of patents in the information age. The insanity of the US
patent system has been chronicled on this site numerous times in the
past (for example, an
FTC report on patent policy, some patents for obvious applications
such as Microsoft
patenting local weather, and Amazon patenting inside
book searching). The Washington Post article does a good job
of overviewing IP issues today, why the current US patent systems
fails in the information age, and gives an example of patent
extortion. Excuse me while I patent
my DNA."
Here.
Is this truly the only Earth I can live on?
One aspect seems central to many of the patents which are generally accepted to be absurd or insane: they are patents on processes for selling goods or services rather than on the goods and services themselves or their means of production. There doesn't seem to be enough awareness of this discrepancy between these types of patents and ones which we consider to be reasonable. Online retailers such as Amazon, for example, may claim that they have two customer bases, book-buyers and advertisers, and that the website itself is a product for the advertisers, but in truth their real customers would seem to be the former....
...can be found on Pieter Spronck's aptly named ridiculous patents page. "Scoring based upon goals achieved and subjective elements" - very nice.
The Army reading list
It's not just that it's easy to get ridiculous patents through the Patent office. There are incentives in most companies for employees filing patents such as cash, stock options, etc. This not only inspires some people to come up with good ideas, but it also inspires a lot of people to come up with crap just so that they can get some $$$ (yeah I'm one of them too).
This is going to be a giant windfall for the lawyers in all this as there will have to be an overhaul of the patent laws and system.
Here's a prediction too: after the "fecal matter hits the rotary cooling device" in all this patent fiasco you'll see an increase in the number of people going to law school. Mainly for IP law, too. Don't laugh, remember how the non-geek masses took computer science in the 90's because that's where the money was?
Trolling is a art,
Tim Berners-Lee must be kicking himself for not patenting the WWW. Or are there actually some decent altruistic people out there who want to make the world a better place?
When I am king, you will be first against the wall.
I trademarked goatse while you were distracted.
The owls are not what they seem
Posting without reading the article and without spell checking.
:)
What's the story about?
Excuse me while I patent my DNA."
Would that be YOUR DNA, or your clones'?
Saskboy's blog is good. 9 out of 10 dentists agree.
Comment removed based on user account deletion
Some ingenious ideas , need to be patented so that the inventor can reap the benefits of his hardwork. But inventions which leave us saying "f@#king DUH!", should seriously be quentioned.
What USofA needs is a better patent challanging system. and by challanging a patent I don't mean claim ownership of that patent, I mean demonstrate the use of that idea so commonly in public domain, that no one actually deserves the patent.
for the last time people, I am "frodo from middle eaRTH", not "middle eaST".
is that they are fishing expeditions. IANAPL (...patent lawyer) and I don't pretend to understand the intricacies of computer-related patents, but there is a fundamental flaw i the patenting world.
For example, as a chemist, I search the patent literature trying to find out what chemical reactions have been reported. It is a well-known fact that you have to take the chemical patent literature with a huge grain of salt (no pun intended!) because many times, the reaciton simply doesn't work the way it is reported to work. The chemical patent literature is not a peer-reviewed process like scientific journals are. It is significantly harder to get an article published in the chemical literature than to patent that material.
I guess what I am getting at, is that there is rampant patenting taking place with few significant things to show for it. Chemists patent anything and everything they can in the off-chance that someone will use it in an industrial process. They are just total fishing expeditions. I know that there will certainly be people out there to correct me with their own opinion, but in my opinion, it just points to a flawed patent system.
No trees were harmed in the composition of this; however, numerous electrons were inconvenienced.
There seems to be this attitude that the suffering of slaves prior to 1850 was something that only happened back then. That it has nothing to do with now, that we are more civilized, more modern, more mature, and more sophisticated. With it comes the arrogance that what happened then, means nothing now, that what happened there has no value here, that the great torment and suffering back then can safely be ignored now as we blow off history and all the values that go with it in terms of understanding, freedom, markets, property rights, and the information age.
Surely anyone who claimed that there is no incentive go grow cotton without "niggers" on the plantation would be considered a barbaric. But if someone claims that there is no incentive to create intellectual and knowledge works without copyrights and patents, then society calls them enlightened. If someone had said that the great wealth of America rested on slavery as a property right and the plantation system, they were a foolish idiot. But if someone says that the great wealth of societies in the information age rests on "Intellectual Property", then they are called wise. Anyone who says that slavery was about property rights and not control, is a liar. However, if they say that copyrights and patents are not about control, but "Intellectual Property" then they are considered trustworthy. How about - if you don't like slavery - don't own slaves, and if you don't like copyrights no one forces you to buy those creations. How about - if you don't believe in slavery, you must be an anarchist, if you don't believe in copyrights and patents you must be communist. How about - you are a thief if you free slaves from the plantation, you are a thief when you copy someones "Intellectual Property".
So why are we spoon-feed these poor logical explanations over and over again? Because, like the rapist who drugs his victim and gently penetrates her, rather than beat her and tear into her where all the scars, blood, and bruises can be seen. Like the assassin who befriends and mis-places his victims heart medications, rather than pull out a rifle and pop a bullet in the head. Copyrights and patents are the pinnacle of quiet violence. So seemingly innocent, so seemingly civilized and friendly, so hard to see and identify any direct evil, any direct consequence. After all, what could be less harmless then providing an incentive to artists and inventors, right? But do they really promote art - or just promote works that have the most hype rather than the most meaning and educational value? Do they really help inventors, or do they hinder collaboration and sharing in a way that would put a police state to shame?
Perhaps the old lady has none to blame when her patented diabetes medication is too expensive to afford anymore. Who can the workers blame when the proprietary technology they bet their career on becomes obsolete and it becomes ever harder to relearn from scratch as they get older. Who can a child in Africa blame when they are dying of AIDS, and there are no generics to treat it! Who do we blame when researchers seeking a cure for cancer encounter massive obstacles to sharing there individual research for fear that their peers will get one up on them, get a key patent, and lock them out! Who do our nations students blame when tabloids are pennies on the dollar, but textbooks dollars on the page! Who do we blame for Hollywood culture being such a failure, and so strongly influencing society in their own failed image.
As people die because patented medicines are too costly and alternatives too sparse, and the needy go without, not because of genuine shortage, but because artificial human made restrictions. Our government who is the enemy of overt violence, has become the friend of quiet violence. Our government who has organized world wars to protect our freedoms, now promotes a world order that will take them away. The democracy that has allowed us to fight for our rights with votes and politics rather than violence and bloodshed has now become
They started as an agriculture research and advocacy group (RAFI) and morphed into ETC about the time they started discovering how broad the patenting system's enclosure of life forms and genetic structures was getting. It's an issue with huge implications, since ideas, biological structures, and living beings are being patented in sometimes outrageous ways.
Damn those pesky terrorists
I've refused to buy any more Gillette products after their latest advert in the UK informed me in a boastful manner that their latest razor has 37(or was it 47? ) patents. For crying out loud, its a razor.
Copyright your DNA. If you copyright your DNA then you can sue your spouse/partner for copyright infringement if they get pregnant or get you pregnant!
Sure to insure domestic tranquility.
I only look human.
My mother is a halfling and my dad is an ogre, so that makes me an Ogreling
And here I thought the 60s were dead.
Categorized and arranged alphabetically in all their royal glory.
My favorite: The Blind Spot Toy:
USA patent 4,477,3358 / Issued 1994
It is never too early to start your Christmas holiday shopping. Why not be original this year and avoid the toys that everyone seems to be buying? Why not give the gift that keeps on giving, the "Apparatus for Aligning Image with Blind Spot of the Eye"!! Patented in 1975, this toy allows the user to locate their blind spot! In order to play this amazingly fun game, strap the toy tightly on the top of your head.
Close your left eye and focus on the dangling tab with your right eye, then switch eyes. Voila! The dangling tab has disappeared into your blind spot. Not only will this invention provide endless hours of fun and good times for everyone (especially at parties), but anyone wearing this apparatus will unquestionably become irresistible to the opposite sex. Enjoy!
An Indian-American Hindu committed to non-violent thought/speech/action alarmed by the global explosion of radical Islam
This is a rerun. I saw this on Fox a couple of weeks ago.
" good review of patents in the information age"
Is it good because it agrees with the Slashdot point of view?
Just ask IBM, Microsoft, Amazon, what they think of patents. I doubt they'll like this article very much.
I can already see it...-12, troll.
www.bustpatents.com
Animoog.org
Last time I heard our law schools were turning out 1 potental lawyer for every 4 americans.
So are more lawyer really the anwser?
Really, I know what I'm doing...Ohhhh, look at the shiny buttons!
I'm waiting for someone to patent "A technique of stretching the rectum to a dangerously distended size with the purpose of photographing it in such a manner that it can be displayed on a network of computers in order to spread the photographs to unsuspecting users."
Patenting your own DNA? That's ludicrious! That's like a robot patenting it's own firmware.
"Thanks for being my prior art, Dad. Happy Birthday."
Generic post highlighting the fact that patents are really tested post-issuance by courts and not pre-issuance by the Patent Office...
Here is the trouble I have. Suppose I come up with a piece of software that can perfectly transcribe english from speech to text - accents and all, right out of the box. Shouldn't that be worth a patent?
How about the guy with the patent on the blinking cursor? Great ideas, right? So, where does the line get drawn? Obviously, patenting something already in use is bad, but what about really obvious things that no one bothered to do yet?
For years, Ford had to pay a different company for a patent on the internal combustion engine. They literally had to wait for the patent to run out!
stuff |
The bad news is that Bricklin thinks software patents are bad, but since they are here, you have to try to patent as much as possible. I guess soon we will have to take out patent-infringement insurance with premiums as high as our salaries.
How about my design for Dolphins with Frikken Laser Beams Attached to Their Fins?
D. Evil
Free your ecomony and enact the FairTax
If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.
If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After all, DNA is kind of like a programming language - it's a tool set for building molecular machines. You can't patent blueprints or schematics, so why would you be able to patent DNA? (I can't recall if blueprints are copyrightable though - I know that typically blueprints, etc. have a disclaimer that says "you can't build this without permission from the company that generated it" because the value is in *using* the blueprint, not having it. Usually. I'm sure there are caveats.
Well, that helped me calm down a little...
"There are a dozen opinions on a matter until you know the truth. Then there is only one." - CS Lewis (paraprhase)
I recently modified the shopping cart on my wife's hot sauce store to give a discount if the client is identified as Mozilla or Linux O/S. A friendly feature to encourage the use of alternative browsers (and desktop operating systems). This is the first cart with such a "feature" I know of.
After I finished, it was a _tough_ one night hack, the thought occurred to me that some folks have patented less (ie One click shopping, local weather etc.). It demonstrated to me the need to be change the patents laws to prevent the locking up of obvious or trival application of emerging technology.
This may explain why so many bad ones get granted?
Simple Unexpected Concrete Credible Emotional Stories
It was a very clever strategy on the part of Acacia - first go after the porn folks (nobody would come to their defense), then the university and online education folks (no money to fight), then the broadcasters (already under siege by the trade associations), then the toolmakers. They probably could have been nipped in the bud if people had paid attention early on.
At this point, it's important to drag the big players into the fight - folks who are being sued by Acacia need to subsequently sue the tool vendors (Microsoft, Real, Apple, Macromedia) for selling them allegedly unlicensed patented technology.
Let's hope we get the law as the EU parliament framed it....
Struggling to find a day everyone can make? WhenShallWe.com
I find your analogy between there being no incentive without slaves and no incentive without copyright to be poorly thought out (or perhapse just poorly articulated).
:)
A more apt analogy for cotton with regards to copyright would be:
"There would be no incentive to grow cotton if no one would _buy_ cotton, because they could get it for free. "
I know that it isnt possible to get cotton for free, but you have to understand that it IS possible with regards to most copyrighted works.
Your slavery argument when applied to copyright is more accurately:
"If the _cost_ of creating copyrighted material went up significantly, there would be no incentive to create copyrighted material."
As you can see, both these statements are clearly incorrect, and I would say that your analogy bends the truth to make a point that isnt there. Your peice is clearly well written, but you should work on your analogies.
all the way from back in 1998, and still the all-time funniest parody on patent madness...
There ought to be such a thing as antipatents. These would work like regular patents, in that they would be registered, and somebody gets to claim credit, but also disavow ownership. So whatever the idea is, it's explicitly in the public domain, and whoever claimed it first gets some positive attention. Kind of like the GPL, but not just for code.
interesting points! but my english professor would have burts laughing and spilled red ink all over this flowery soliloquy of abraham lincoln. "like the rapist who drugs his victim and gently penetrates her"??- jesus man, this mellodrama should impress no one but torch waving farmers at the bandstand in 1840.
---------
No matter how thin you slice it, its still baloney.
getting a patent or filing a patent, can at least provide some tangible property/proof of a concept, that can enable a startup or small firm to get investors, thus building their business. Its the business standpoint that most people here on slashdot don't consider.
People may complain about abuse, but isn't it better that via the patent system, people disclose their inventions instead of hiding behind trade secrets, thus allowing others to improve upon the inital invention? I would expect that people here would be happy about that since, thanks to the DCMA, reverse engineering is now of questionable legality?
At lot of what people on slashdot say is "obvious" may not be really obvious. One has to look and decide if it was obvious at the time of invention, otherwise it is impermissible hindsight, which is not valid reasons for combining references.
Bring back the old version of slashdot.
It is (obviously) not hard to find bad examples of software patents. But are there any good ones?
In my view, there should be only one rule: "Would X have been invented without the 20 years of protection from competition provided by patent law?"
There is absolutely no reason for society to allow patents for inventions that don't pass this simple test.
I think your essay does a real disservice to the argument against copyrights and patents.
The comparison to slavery pisses me off and it should everyone here. To put copyright/patent legislation on the same level of importance with human slavery is utterly immoral and academically incorrect. Not only does it reek of propaganda (in your next article, you might as well claim that Hitler would have supported patents), but they have zero to do with each other. From a purely economic perspective, slavery was about the confiscation of someone's income from one race to another. If anything, destroying copyrights would be about YOU confiscating income from ME. I may just as well claim that copyright destruction is the enslavement by the public of the creator of wisdom. There you go, now you're the slave master. How does it feel? Your argument based on slavery trivializes a significant human tragedy in order to make a terrible, invalid point.
95% of the substance of the essay is the narcissistic ramblings of a writer in love with his own wordage. I would hope folks here would be more intelligent consumers of information than to be persuaded by a piece of garbage wrapped up with a nice ribbon. This type of rhetoric does nothing more than alienate the 98% of folks who are sitting on the fence regarding this issue.
I've been in similar situations and the thing about patents is the drive is usually from the business guys. Mostly, it's from people with little or no technical knowledge, therefore they try to patent everything. I've been asked in the past about patents and ordered to write up patents. Business guys don't care if it's obvious. They only care about whether or not they can make money from it. In fact the patents that are more obvious are the ones they are most eager to file. Their thinking is, if it's obvious, some one will end up implementing it. Therefore who ever owns the patent has a huge advantage, especially if their own implementation sucks. Non-trivial, non-obvious patents are the ones that usually have lower priority.
I think the whole problem is that we are allowing patents on IP already protected by copyright.
The two protections were designed to be used for different purposes. copyright for IP, patents for inventions.
When you allow both types of protection to be applied to one piece of work, the result is strangulation of innovation.
We need to decide if software should be copyrighted, or patented. It can't be both. It isn't fair to the human race and isn't in anyone's best interest except the software companies (sometimes), which incidentally simultaneously have the most to lose, and the most to gain at the same time.
Paradox is not good for the legal system, or the protection of IP.
l8,
AC
...patents. Before I get flamed, let me say that the article eludes to this, but doesn't quite make the case.
The whole purpose of the patent system was designed to provide an incentive(payment) for a company to willingly incrue the costs associated with the research and design of a new product. That incentive came in the form of a patent (guaranteed monopoly for 20 years) to recover the associated costs that went into research and design.
In software, although there are certainly costs incrued in the full-fledged development of a product from start-to-finish... aren't our current copyright laws sufficient protection on completed works? Even though some console games can cost millions to produce, are those millions really associated with research and design, or are they associated with actual coding, graphic art, music soundtracks, etc... ?
My argument is that there is no need for patents on software, since there is no detrimental impact on companies who innovate. In hardware, a company might spend a billion$ trying to develop a product before it can ever come to market -- that's a detrimental impact on that company's bottom line, and they should have a 20 year monopoly. If that company was not to receive that monopoly, in most cases, they would not have a necessary incentive to spend a billion$ on R&D.
Contrast that with software innovation... Does anyone REALLY BELIEVE that without software/internet patents, Amazon wouldn't have developed 1-click-shopping??? Of course they would have, because it didn't cost them anything extra to develop and it pays instant rewards in increased sales. Do you think for a second that we wouldn't have browser plug-ins without patents? Do you think for a second that we wouldn't have turbotax, halo, amazon, ebay, slashdot without patents? Of course we would! The question is what do we NOT have because of software patents. What companies are being shut-down, stifled, put out of business -- what REAL innovations are being stamped out because they might "infringe" on something as asinine as 1-click-shopping?
Everyone agrees that without industrial patents, we wouldn't have 1/10th the innovation in aerospace, electronics, mining, or environmental science... but without software/internet patents we'd have even MORE innovation than we have today.
-- I'd give my right arm to be ambidextrous
You've chosen a trivial example (one-click shopping) which probably should never have been awarded a patent in the first place due to its obviousness.
Second, I don't like that term "software patent". You don't patent software, you patent algorithms and methodologies which can be implemented in software. Many of the algorithms, however, could conceivably be implemented through something other than through the running of a software program.
The economics of developing new algorithms are no different than developing a new automobile transmission. It entail risk, it costs money, it requires ingenuity and effort, and the results of your labour can easily be ripped off by others who had and did none of these things.
The real problem with "software patents" is the quality of the patents. Many should either never have been allowed, or have been cut back in scope.
It is not that patents are being granted here in the US to large companies who make large contributions to Politicians. Rather, it is the fact the we are pushing this insane approach to patents on other countries and they are actually considering it.
We have created a monster and that should be obvious to all. Yet other nations and regions are considering it. What a nightmare.
I prefer the "u" in honour as it seems to be missing these days.
If a company has a test that looks for a certain DNA sequence which I have, is my body then considered prior art?
'I am become Shiva, destroyer of worlds'
Put the Lime in the Coconut
From the Scientific American web site: an article describing the following patent:
Scientific American was not kidding. You could look it up. The patent was issued on October 1, 2002.The gales of laughter must have reached the Patent Office, because the Director ordered the patent to be re-examined, which I assume means that it will be revoked. It is now apparent that you can file a patent on a ham sandwich and the Patent Office will issue it.
In the land of the blind, the one-eyed man is king.
Actually there is a story behind this. It was at a time when i was doing alot of thinking about copyrights, but every time i thought about the problems with copyrights - some of the logic - it sounded like somthing i had herd before. I finally came up with an essay comparing it with slavery and sent it to RMS. Believe it or not, he replied, and said somthing like I should be carefull because the suffering caused by slavery was far more atricious than what is suffered by copytights. Like more often than not, he was right.
So anyhow I was chewing on that for awhile, and long behold a week later I stumbled upon an article in the berkley daily planet writen by a pharmacutical exec trying to justify some AIDS patent lawsiuts against africans. The arguments that they had no incentive without patents, and that they were generous to Africans sure sounded like there was no incentive to grow cotton, and we are kind to our slaves on the plantation. From my history lessons.
The meaning of the 1850s today, the quiet violence, the nature of rights, the historical perspective, all those have stories too - but i just dont have time to elaborate here.