Slashdot Mirror


When Good Patents Go Bad

will writes "The Washington Post has a good review of patents in the information age. The insanity of the US patent system has been chronicled on this site numerous times in the past (for example, an FTC report on patent policy, some patents for obvious applications such as Microsoft patenting local weather, and Amazon patenting inside book searching). The Washington Post article does a good job of overviewing IP issues today, why the current US patent systems fails in the information age, and gives an example of patent extortion. Excuse me while I patent my DNA."

170 of 220 comments (clear)

  1. The Washington Post's web patent by corebreech · · Score: 4, Funny
    1. Re:The Washington Post's web patent by Zog+The+Undeniable · · Score: 4, Insightful

      Seriously, that's a good example of the proper use of a patent - for ingenious hardware widgets. IP patents, on the other hand, are downright evil.

      --
      When I am king, you will be first against the wall.
    2. Re:The Washington Post's web patent by mcpkaaos · · Score: 1
      From the patent:

      What is claimed is:

      1. An apparatus for threading a web through a printing press, comprising:

      a body portion having a length and a width; and

      at least one ridge integrally formed on at least one surface of said body portion, said at least one ridge extending along the length of said body portion, wherein said at least one ridge includes intermittent gaps affording flexibility to said body portion.


      As long as you make sure that your "apparatus" has length, width, and depth, you are safe from this patent. Now, if your company exists only in 2 dimensions, you're scrood.
      --
      It goes from God, to Jerry, to me.
    3. Re:The Washington Post's web patent by ajakk · · Score: 1
      As long as you make sure that your "apparatus" has length, width, and depth, you are safe from this patent.

      BZZT! When using the predicate word "comprising" the patent limitations are closed-ended. Thus, as long as the body portion has a length and a width, you are covered. The existance of other elements, such as depth, does not effect the patent coverage.

  2. What makes a bad patent? by mgcsinc · · Score: 5, Insightful

    One aspect seems central to many of the patents which are generally accepted to be absurd or insane: they are patents on processes for selling goods or services rather than on the goods and services themselves or their means of production. There doesn't seem to be enough awareness of this discrepancy between these types of patents and ones which we consider to be reasonable. Online retailers such as Amazon, for example, may claim that they have two customer bases, book-buyers and advertisers, and that the website itself is a product for the advertisers, but in truth their real customers would seem to be the former....

    1. Re:What makes a bad patent? by Anonymous Coward · · Score: 2, Insightful
      There doesn't seem to be enough awareness of this discrepancy between these types of patents and ones which we consider to be reasonable.
      Careful with that "we"; there are many people who don't think any patents are reasonable.
    2. Re:What makes a bad patent? by mgcsinc · · Score: 1

      You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production? Find me one!

    3. Re:What makes a bad patent? by taniwha · · Score: 4, Interesting
      I've always thought that a great patent should pass the Edison test: "do you think that your patent would impress Edison?" (assuming Edison was up on modern technology etc etc).

      Or in other words - "is it a great wonderfull new idea rather than just an incremental change that would be obvious to any engineer faced with the same problem?"

      IMHO probably one of the worst problems with the current patent system is the inability of the patent examiners to judge the "obvious to a practioner of ordinary skill in the field" test. A few years back I was engaged on an x86 cloning project .... it's a patent minefield, with the spectre of Intels lawyers looming at every term .... we came up with a wonderfull (though complicated) way to get around one of Intels primary (and IMHO obvious, with prior art) patents .... only to have a patent appear from a 3rd company with exactly the same solution ... since both companies had come up with the same solution faced with the same problem boxed in by the same Intel problem patent I would argue that the solution was obvious to "ordinary computer architects" at the time ... but there's no way I can see for a patent examiner to know or understand that - and since there's no way to bring these issues up untill after the patent has been granted - which means going to court ....

      The patent minefield isn't really getting any bigger ... it'sm just that the mines keep getting closer together ...

    4. Re:What makes a bad patent? by Seby123456 · · Score: 2, Insightful

      Let's see, inventors in the third world working to try and develop new ways of purifying water or meeting other basic human needs; Open source developers (ok, I know there are problems with software patents...); I could list more, but the reasons people invent is much greater then just for financial returns.

      There is still a very large majority of people who are happy to work on things for the sense of improving others lives or simply the sense of achievment a creative act brings.

    5. Re:What makes a bad patent? by ePhil_One · · Score: 2, Insightful
      You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production?

      Not what was said. You have arbitrily added the condition "people who would like to invent something"; which is probably better stated as "people who intend to invent something"

      First, if I know I lack the resources to invent something useful, but believe I could copy it once seen in action, why wouldn't I be against patents? At that point they are an imediment to my success.

      The point of patents are as much to preserve the knowledge as it is to preserve my right to make a profit. The requirement that I explain my new foamed steel making process means that if I died trying to keep my foaming furnace from self destructing, the world doesn't need to wait for someone else to find out the secret is crushed eggshells because I was successful hiding that secret from the world to protect my profits.

      --
      You are in a maze of twisted little posts, all alike.
    6. Re:What makes a bad patent? by forevermore · · Score: 3, Interesting
      their real customers would seem to be the [book buyers]

      Don't discount the revenue of advertisers to retailers. If Amazon is anything like most grocery/department stores, they get a lot of money for product placement. When I was just out of high school, I worked for a company that was paid to go around to grocery stores, take down a bunch of product from the shelves and put it back up in a different order. Why? Because the stores don't own the layout on the shelves - certain products do (in my case, Gillette happened to own the shaving cream and deodorant shelf layouts).

      But this has nothing to do with patents.

      --
      Do you really need reason for beer? Wingman Brewers
    7. Re:What makes a bad patent? by dslbrian · · Score: 5, Interesting

      You're honestly of the impression that there is actually a sizable minority of people who would like to invent something with no guarantee to their right of exclusive production?

      I work as a EE in a company and I've been in this situation myself before. I've become so disgusted with the patent process that I've decided that I'm not filing any more patents. If I was working independently as an entrepreneur I might have a different opinion - and it is my belief that that is the real justification behind patents - to protect the entrepreneur long enough to get their product to the market.

      However the patent system today doesn't serve to protect individuals, its now nothing more than a corporate club for litigation against any would be competitors. Its used by companies that are already well established and are in no danger of not getting a product to market. I remember someone once telling me the way patent settlements are reached is that the lawyers all gather in a room and the companies put their stacks of patent papers side-by-side, the difference in height yields the settlement fee. More recently there has been a trend towards reviving old patents on things that are obvious or have been in use for decades (ie. Forgent's "jpeg" patent). Its nothing more than a money grab by parasites abusing the patent system.

      So back to the original point, yes I've invented things before - but no I don't care if the company I work for gets exclusive rights to it. You see it takes time and effort on my part to file a patent, and what do I get for my efforts - a small wad of cash, big freaking deal. Now on the other hand if I don't patent it, I get to take that knowledge and use it again, for myself or for any other company I work for. Further as soon as the circuit I worked on gets fabricated, it becomes prior art and can no longer be patented after that. Its a selfish motive on my part (no more selfish than the patent grabbing company though), but in the end my method serves myself and everyone else better (well at least the people I work with since they get direct benefits of that prior knowledge)...

    8. Re:What makes a bad patent? by Minna+Kirai · · Score: 4, Insightful
      "is it a great wonderfull new idea rather than just an incremental change that would be obvious to any engineer faced with the same problem?"

      Few of Edison's own patents meet that test. The phonograph may have been new, but the light bulb (his most famous invention, in 1879) had already been created by others as early as 1841. His own modifications were incremental. Yet of course he still got a patent.

      Other legendary inventors who did incremental changes to existing ideas (followed by the inventor who made the original, but less efficient device):
      • Sam Morse : Charles Wheatstone
      • Orville & Wilbur Wright : Samuel Langley
      • James Watt : Thomas Newcomen


      Arguably, however, patents are better given to someone who makes an incremental improvement, rather than a revolutionary one. Patents (and all of "Intellectual Property") are only meant to encourage progress. Genius, heroic inventors are quite likely to pursue their insight regardless of the prospect of patent protection- and if they succeed and earn a patent, it's likely to take a decade or more before the concept really becomes profitable. Potential competitors will be slow to recognize and accept the totally new idea.

      The phonograph and airplane, for example, both had patents granted for them, and both became huge industries (one with annual revenue in the billions, the other in the trillions). But the patents were almost expired before the business models really started to get into wide-scale profitability.

      But, an incremental improvement is more vulnerable to being rapidly duplicated. Someone prespiring away at finding the right combination of gas and filament to make the light-bulb really practical runs a true risk of someone else buying his first product and starting to sell a reproduction just 3 months later.

      A much fairer patent system would give the examiner more options than just a yes/no response. Not all inventions are inherently deserving of the same length of protection. If the government recognized this, the assignment of bad patents would be far less damaging, as only the best patents would get the long, multi-decade terms.

      Software patents especially (if they are allowed to exist at all) show last much shorter than those for physical machines. Suppose the Amazon 1-click patent had lasted for just 2-3 years. That'd be not nearly as bad as the prospect of continuing to avoid one-click ordering in 2017.
    9. Re:What makes a bad patent? by Minna+Kirai · · Score: 1

      Find me one!

      Every single inventor of anything before 1960.

      Now how about you attempt the reverse and much harder problem, and find me someone who decided he did not want to invent because he wouldn't get a patent.

    10. Re:What makes a bad patent? by Adam+J.+Richter · · Score: 2, Interesting
      If I recall correctly, the "ordinary skill in the art" criterion of United States Code, Title 35 (Patents), Part II, Chapter 10, Section 103 was enacted by congress in the Patent Act of 1952 to reduce the higher common law standards of patentability, such as in Hotckiss v. Greenwood (1851).

      Personally, I doubt that any standard of patentability is high enough, duration short enough and scope narrow enough to make a patent system worth more than the value of the competition and incremental development that it stifles. Perhaps my views are skewed by being based so much on my seeing software development "before" and "after" software patents, but I think that with the advent of computer aided design and faster communications, the development of almost everything that is currently patentable is becoming more like software development or actually becoming software development.

    11. Re:What makes a bad patent? by Quino · · Score: 1

      "He who receives an idea from me, receives instruction himself without lessening mine; as he who lights his taper at mine, receives light without darkening me... Inventions then cannot, in nature, be a subject of property."

      -- Thomas Jefferson

      "That, as we enjoy great advantages from the inventions of others, we should be glad of an opportunity to serve others by any invention of ours; and this we should do freely and generously"

      -- Benjamin Franklin

      That's two.

      I'm amazed that it seems incomprehensible to some people that not everybody's sole motivation in life is money.

    12. Re:What makes a bad patent? by Quino · · Score: 1

      As far as I know, this argument has been going on for ever, at least as far as the US is concerned.

      Several of the founding fathers were suspicious of patents, and one actually wrote (I don't remember if it was Benjamin Franklin or Thomas Jefferson) that he felt that a patent system wasn't likely to actually *do* anything towards encouraging progress (controversial satetments this day and age in the US!).

      History, in fact, seemed to suggest that issuing patents didn't actually have much of an effect on the rate of progress *at all* (comparing European countries with and without patent systems. Wish I remembered details, I think England had them, Germany didn't).

      My understanding that the "compromise" was to make sure that the rights to an invention would be "temporary" -- and this clearly has always been a goal. The only reason patents are tolerated (and yes, Thomas Jefferson writes to that effect) is because of the supposed improvements they bring about to society. If the patents lasted too long, we'd lose the only reason patents exist in the first place: to serve society at large.

      Since 20 years is enough for just about all software we use to become obsolete, I do think how software is handled is especially broken.

    13. Re:What makes a bad patent? by volpe · · Score: 1


      I've decided that I'm not filing any more patents. If I was working independently as an entrepreneur I might have a different opinion


      I see. You're willing to stand up for principle, as long as it aint your buck on the line.

    14. Re:What makes a bad patent? by Ignominious+Cow+Herd · · Score: 1

      I'm amazed that it seems incomprehensible to some people that not everybody's sole motivation in life is money.

      Or Power.

      Now, Sex, Beer and Toys...that's another matter entirely.

      --
      Lump lingered last in line for brains, and the ones she got were sorta rotten and insane.
    15. Re:What makes a bad patent? by nytes · · Score: 1

      My (very simplistic) answer to the question is that a patent should be revolutionary, not evolutionary. How's that for a sound bite? :)

      A lot of things are obvious incremental progressions of existing technology. You can show a static picture? The obvious next step is to show a moving picture and, after that, a moving picture with sound.

      Online auctions are an obvious extension of meatspace auctions; compter-brokered stock trading is an obvious extension of human brokered trading, etc.

      This brings us right back to the existing problem: in order to judge whether something is evolutionary requires a great deal of knowledge of the relevant fields of study. This is exactly what's hanging USPTO up.

      --
      -- I have monkeys in my pants.
    16. Re:What makes a bad patent? by pardonne · · Score: 1

      > A much fairer patent system would give the
      > examiner more options than just a yes/no response.

      They already have more options. Examiners evaluate
      the claims in the patent document. They can accept portion of the claims and reject the remaining. Hence they can effectively say something like "%30 yes".

      Pardonne

    17. Re:What makes a bad patent? by westlake · · Score: 1

      Langley's aircraft sank like a stone into the Potamic, nearly drowning it's pilot. He had not solved the problem of control in three dimensions and had not built a practical marine catapult.

    18. Re:What makes a bad patent? by dslbrian · · Score: 1

      I see. You're willing to stand up for principle, as long as it aint your buck on the line.

      You probably made this remark as some sort of attempt at sarcasm, but in a sense it is correct even though you don't know why - the real point, which you've obviously missed, depends on the entrepreneurial nature and motivation behind the invention. The real issue is what happens with that invented knowledge after its patented. If my "buck" IS on the line, then you can damn well bet I'm going to work on doing something with it.

      However all the companies I've worked for (and all that I know of) don't view it that way. To them patents are like currency - its something you put in the bank until you can cash in on it. If that means it sits there idle, being worthless for 17 to 20 years then thats just too bad. If someone else does something with it - something worthwhile - and unknowingly steps on it, then guess what - its payday - time to litigate and cash in. The fact that the company owning the patent didn't have to do any real work to cash in is icing on the cake...

      So I end up at my original point - I don't file the patent. Now it belongs to no one. As soon as it (presumably a circuit in my case) gets diced and spit out of the fab, its prior art - then it officially belongs to no one. I can take it and use it over and over. I can give it to everybody I know. They can't patent it either. I've done what our current patent system will never do, I've acutally spread useful knowledge (especially if I do something immensely more useful with it like publishing it in a journal).

  3. A list of some other ridiculous patents... by tcopeland · · Score: 4, Interesting

    ...can be found on Pieter Spronck's aptly named ridiculous patents page. "Scoring based upon goals achieved and subjective elements" - very nice.

    1. Re:A list of some other ridiculous patents... by jvervloet · · Score: 1

      Here is an example how a video store web page violates 19 patents.

  4. Another reason for ridiculous patents by Brahmastra · · Score: 5, Interesting

    It's not just that it's easy to get ridiculous patents through the Patent office. There are incentives in most companies for employees filing patents such as cash, stock options, etc. This not only inspires some people to come up with good ideas, but it also inspires a lot of people to come up with crap just so that they can get some $$$ (yeah I'm one of them too).

    1. Re:Another reason for ridiculous patents by huckda · · Score: 1

      wow...can I come work for your company?! I've got some great ideas and could use the mere bonus material...don't even need a regular salary =)

      --
      "Just Smile and Nod." --Huck
    2. Re:Another reason for ridiculous patents by Anonymous Coward · · Score: 1, Interesting

      Proferssor Jonathan Vos Post here, (long a slashdotter but forgot my password). I've helped several inventors submit patent application, and it is always astonishing, when you search through related patents, to see what nonsense has slipped through before. My wife and I have also earned over a tenth of a megabuck doing prior art searches for patent law firms, as much that gets patented was openly published someplace obscure, first. Fortunately, new Supreme Court decisions reaffirm that you can't patent a human being. But dude, this is the source code... But maybe a chimpanzee? See: http://sciencedaily.com/releases/2003/12/031211075 002.htm

    3. Re:Another reason for ridiculous patents by willtsmith · · Score: 5, Informative

      We need to have financial incentives in place for people who defeat patents with prior art searches. Basically, you would put bounties on killing patents as a way of clearing the roles of nonsense patents. This would be the IP euivalent of selling-short (betting on stocks going down).

      A challenge phase needs to be put in place so that our patent killers (as well as competitors) have a chance to savage a patent with prior art claims before it officially goes on the rolls.

      Finally, we need new categories of IP that try to make things a little more clear. Copyright and Patent no longer covers the range of intellectual property out there.

      Patent - Applies only to physical machines. Applies specifically to a problem and the machine that solves it.

      Copyright - A written and performed work of art. Computer programs do NOT apply.

      Software (4 years)- A very specific process for creating something new. Data structures may be involved, but only in conjunction with a related algorithm. Alternative methodoligies for using the same data formats (reverse engineering) is specifically allowed.

      Method/Application Patents (4 years) - Protect a novel way of doing something. This may apply to a business method or a software application.

      Pharma (15 years) - A chemical composition for curing a specific ailment or modifying a biological process. All Pharma patents must be vetted. That is, the research must be done showing that it actually does what it CLAIMS it does.

      Pharma Use (non-exclusive 10 years) - A set of research that proves an additional use for an Pharma substance. This could apply to something as mundane as aspirin. A court could grant intellectual property rights proportional to the scope of a new use for that substance which would increase it's use. For example, proving that Aspirin helps prevent heart attacks increases the use of Aspirin.

      This one sounds weird, but it encourages people to do more research on existing substances. Pharma research is EXPENSIVE. This research should be rewarded since it adds to the level of human knowledge and increases the use of EXISTING products making the whole process more effecient.

      The IP would work as a royalty granted by IP courts levied on producers of that substance.

      Research patents (non-exclusive 10 years) - Like Pharma patents, this would expensive basic research. It would be a royalty applied to products which profit from knowledge derived from expensive research.

      The most obvious IP in this area would be human and animal genome. It's not an invention, it's an expensive process of discovery. Additional types of IP could relate to materials science, and even advanced physics (like the guys slowing light down, quantum entanglement methods (advanced communications)).

      Engineered Organisms - A company that engineers an organism would have rights to re-produce and sell that organism. Any one else with access to that organism could breed it, but not for profit.

      Re-production of the organism using unique methodologies would be allowable and would constitute a unique organism IP. Though, other IPs may apply.

      New IP categories. The IP office would have staff and processes devoted to exploring new categories of IP and their associated rights, and fees. They could write legislation and submit it to congress for consideration and ultimate approval.

      --
      -------- -------- Support Wesley Clark for president!!!
    4. Re:Another reason for ridiculous patents by maximilln · · Score: 5, Interesting

      -----
      Pharma (15 years) - A chemical composition for curing a specific ailment or modifying a biological process. All Pharma patents must be vetted.
      -----
      Background...

      -----
      That is, the research must be done showing that it actually does what it CLAIMS it does
      -----
      Have you heard of angiogenesis inhibitors? They are chemical compounds which battle cancer by preventing tumours from growing additional blood vessels. If the tumour cannot grow more blood vessels then it, theoretically, will starve itself into remission.

      I was at a project meeting one time where the department head was singing the praises of the latest round of developmental angiogenesis inhibitors. He was pointing specifically to data from mouse models which showed that, after the compound had been introduced to a mouse with a tumour, the tumour decreased in size and entered remission as opposed to mice who had been given a placebo. The size of the tumour was determined by cutting it out of the mouse and using a balance to determine its mass.

      To verify that the compound was doing what it was supposed to be doing I asked if anyone checked the vasculature in the tumour. Were the veins and arteries smaller or thinner? Was there evidence that the tumour decreased in size due to reduced vasculature? Was there any evidence that the compound was working as an "angiogenesis inhibitor" and not by another mechanism? The department head looked like a fish out of water for five seconds and then began a 30 second rant about how I was an incompetent fool that needed to go to graduate school before I understood anything about biochemistry.

      Needless to say the company was still pursuing filing a patent for the new "angiogenesis inhibitors" when I left. It never ends.

      --
      +++ATHZ 99:5:80
    5. Re:Another reason for ridiculous patents by theodicey · · Score: 1
      ...And I've never seen a technologist react the same way to poorly informed questions.

      What he meant was that the chemical structure of the new angiogenesis inhibitors resembled that of known angiogenesis inhibitors. And that it was hopeless to explain exactly how to you, since you admit to having zero biochemical knowledge.

      Arrogant, yes. Fraudulent, unlikely.

    6. Re:Another reason for ridiculous patents by maximilln · · Score: 1

      -----
      What he meant was that the chemical structure of the new angiogenesis inhibitors resembled that of known angiogenesis inhibitors. And that it was hopeless to explain exactly how to you, since you admit to having zero biochemical knowledge
      -----
      That's not what he meant at all.

      The structure of the angiogenesis inhibitors in question did not resemble the structure of other known angiogenesis inhibitors. They would not be strong patentable candidates if they did as their structure would overlap with patents held by other companies. Additionally the structures of compounds which are used to treat one disease often resemble the structures of compounds used to treat an entirely different disease. That you think of pharmaceuticals in terms of structural classes being directly associated with diseases shows that you are terribly behind the times or know little to nothing above a layman's level in the field. Let me remind you that the basic backbone structure of cholesterol is modified to produce compounds which interact with nearly every biochemical pathway in all seven systems of the body. Marketing departments oversimplify their advertising to cater to the least common denominator of physicians who have forgotten nearly all of their chemistry and biochemistry. Furthermore I never admitted that I have no biochemical knowledge. That was the belittling accusation (representative of the manner in which I was treated over the course of four years) made by the department head in order to assert his authority with brute force. To the contrary I have quite a bit of biochemical knowledge and am fluent in methods of de novo molecular design to target biochemical pathways.

      This is a question of specificity and it was never addressed but rather beaten down with the highly questionable argument of "might makes right". The question was not poorly informed. The research methods were knowingly extrapolated to produce results outside of the scope of the experimental model. The postulate was that the compounds in question would inhibit angiogenesis. The compounds in question do cause cessation of proliferation of endothelial cells in purified cell culture. The compounds in question do cause the mass of a tumor in a mouse model to decrease. There is no factual link, however, to prove that the tumors decreased in size due to a lack of endothelial proliferation. That conclusion was assumed from purified cell culture. To give perspective: these same compounds cause many other cell types to display apoptotic, necrotic, or stasis behavior. The action was not specific to cells involved with the formation of vasculature.

      The patent, as submitted by the company, will state that these compounds act by inhibiting the growth of vasculature in tumor models. The supporting evidence, however, will have nothing to do with the growth of endothelial cells inside of a tumor. The supporting evidence will be gleaned entirely from purified cell cultures. When the tumors themselves are examined the only observation made will be the mass of the tumor. The observations will have little to do with the pathology of the tissues.

      --
      +++ATHZ 99:5:80
    7. Re:Another reason for ridiculous patents by Zork+the+Almighty · · Score: 1

      We need to have financial incentives in place for people who defeat patents with prior art searches.

      A challenge phase needs to be put in place so that our patent killers (as well as competitors) have a chance to savage a patent with prior art claims before it officially goes on the rolls.


      There's no way you can do both.

      --

      In Soviet America the banks rob you!
  5. The lawyers will win. by grub · · Score: 5, Interesting


    This is going to be a giant windfall for the lawyers in all this as there will have to be an overhaul of the patent laws and system.

    Here's a prediction too: after the "fecal matter hits the rotary cooling device" in all this patent fiasco you'll see an increase in the number of people going to law school. Mainly for IP law, too. Don't laugh, remember how the non-geek masses took computer science in the 90's because that's where the money was?

    --
    Trolling is a art,
    1. Re:The lawyers will win. by penguinoid · · Score: 3, Funny

      Good, then they'll start outsourcing lawyers. Can't wait for the next version of Buggy Law+.

      --
      Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
    2. Re:The lawyers will win. by Walterk · · Score: 1

      Hmmmm.. Thinking... EUREKA! I will patent my idea of fecal matter hitting a rotary gaseous matter acceleration device! Brilliant!

    3. Re:The lawyers will win. by CaptnMArk · · Score: 1

      Quick, somebody patent all the laws.

    4. Re:The lawyers will win. by teamhasnoi · · Score: 1
      I know someone who just finished school to be a copyright/patent lawyer. He *immediately* was offered a 3 figure salary, and is now working and living in New York City.

      If only the lawyer-maiming business was so lucrative.

      Why is it when a bug is found in software it's fixed (with notable exceptions), but when bad laws are written, they're left to afflict everyone?

      It's time to Open Source law, and require politicians to be picked randomly with a term limit of 2 years.

    5. Re:The lawyers will win. by Anonymous Coward · · Score: 2, Funny

      He *immediately* was offered a 3 figure salary

      3 figure? Was he from India?

    6. Re:The lawyers will win. by alwayslurking · · Score: 2, Insightful

      3 figure salary? He must have had a lot of trouble finding NYC property he could afford.... What do you mean by "Open Source" in this context? Laws are discussed and documented in public in democracies. Like software, most people just don't care about the details :-( I like the random politician idea, right up to the point where it just puts the power in civil servants' hands instead. They would be the persistent experts, so they would have influence out of all proportion to the random punters. Now, a randomly selected upper-house that occupies the current position of the Senate or the Lords in the UK, that sounds like a plan.

    7. Re:The lawyers will win. by maximilln · · Score: 1

      -----
      Why is it when a bug is found in software it's fixed (with notable exceptions), but when bad laws are written, they're left to afflict everyone?
      -----
      Laws make money by invoking fines or providing clients for the incarceration system. Freedom makes no money.

      Capitalism is great. Government regulated capitalism is communism. If the government passes additional regulations on social behavior then it's socialism. If the government tells you that it's for your own protection and good then it's facism. It's all about making money by skewing the laws in favor of those writing them.

      --
      +++ATHZ 99:5:80
    8. Re:The lawyers will win. by Short+Circuit · · Score: 1

      Bugs in laws are usually written in there, to benefit someone with a lot of lobbying power.

    9. Re:The lawyers will win. by Lemmeoutada+Collecti · · Score: 1

      Good for you. I will take the patent for causing homo sapiens fecal matter to impact with a rotory gaseous acceleration device using the internet to provide initial causation. Also the process for doing the aforementioned in one click. And perhaps the process for creating (once again using the internet for research purposes) the requisite rotary device. Gotta include the Internet!

      You gave me too many ideas... too much caffeiene in my bloodstream...

      Patent the process for using the Internet as a communications medium to convey contraversial information and induce in humans an uncontrolled release of fecal matter (to be reffered to as a sh*t fit)...

      Must calm down...

      --

      You can have it fast, accurate, or pretty. Pick any 2.
    10. Re:The lawyers will win. by rssrss · · Score: 1

      According to Information Week, its already happening:
      Legal research and other back-office work carried out at law firms may be among the next set of white-collar jobs to move offshore in big numbers. According to a recent study by researchers at the University of California at Berkeley, legal assistants and paralegals working in India on behalf of U.S. law firms earn, on average, between $6 and $8 per hour. That's about one-third of what their counterparts in the United States are paid.

      Some of the largest law firms in the country are looking to take advantage of that discrepancy. John Halvey, who heads the technology finance and outsourcing group at New York-based Milbank, Tweed, Hadley & McCoy, says the 137-year-old firm is considering moving some back-office functions to India. In doing so, Halvey said at an offshore-outsourcing conference Monday in New York, the firm would simply be mirroring the behavior of its international business clients. "I can't think of a recent deal we did that didn't have an offshore component," Halvey said.

      --
      In the land of the blind, the one-eyed man is king.
  6. All I can say is... by Zog+The+Undeniable · · Score: 4, Insightful

    Tim Berners-Lee must be kicking himself for not patenting the WWW. Or are there actually some decent altruistic people out there who want to make the world a better place?

    --
    When I am king, you will be first against the wall.
    1. Re:All I can say is... by Anonymous Coward · · Score: 5, Insightful
      Or are there actually some decent altruistic people out there who want to make the world a better place?

      Yes, there are.
    2. Re:All I can say is... by tigertiger · · Score: 1

      He couldn't - hyperlinking had been patented (slashdot article) by British Telecom in 1976.

    3. Re:All I can say is... by mojoNYC · · Score: 1

      ...another fine example of patent BS--Douglas Englebart first described hyperlinks in his seminal work in the 1960s...makes you wonder how hard they really look for prior art--i found a link to confirm my facts about DE on google in about 2 seconds...

    4. Re:All I can say is... by misterpies · · Score: 1


      >>Douglas Englebart first described hyperlinks in his seminal work in the 1960s...makes you wonder how hard they really look for prior art--i found a link to confirm my facts about DE on google in about 2 seconds...

      Well go back to 1976 and try to run a google search then.

      --
      The author of this post asserts his moral rights.
    5. Re:All I can say is... by elwinc · · Score: 3, Interesting
      Perhaps Berners-Lee read Don Lancaster's Patent Horror Stories (pdf) or some of the other stuff in his Patent Avoidance Library. Don makes a pretty good case that the patent system is at best misunderstood and frequently inimical to the small inventor.

      --
      --- Often in error; never in doubt!
    6. Re:All I can say is... by One+Louder · · Score: 2, Informative
      If the WWW had been encumbered by patents, it might not have gained world-wide acceptance, and the patent would subsequently have had no value whatsoever.

      It's a classic Catch-22 situation - attempting to capture the value destroys the value.

  7. Re:Patents by October_30th · · Score: 2, Funny
    That's goatse(tm) to you, my friend.

    I trademarked goatse while you were distracted.

    --
    The owls are not what they seem
  8. I patent.... by sirsampson · · Score: 4, Funny

    Posting without reading the article and without spell checking.

    What's the story about? :)

    1. Re:I patent.... by Anonymous Coward · · Score: 4, Funny

      You cannot !! Slashdot editors will claim "prior art" for that.

  9. I just have one question for the writer. by saskboy · · Score: 3, Informative

    Excuse me while I patent my DNA."

    Would that be YOUR DNA, or your clones'?

    --
    Saskboy's blog is good. 9 out of 10 dentists agree.
    1. Re:I just have one question for the writer. by peragrin · · Score: 4, Funny
      a better question is whether or not his parents have already patent their DNA, if so does that consitute prior art. They can easily claim to have had it longer, and it is a derviative work, of merging to to prior arts.

      --
      i thought once I was found, but it was only a dream.
    2. Re:I just have one question for the writer. by lordholm · · Score: 1

      As far as I know, DNA is not patentable (in Europe at least). However, what is patentable are the means to find and identify the genes and the technical inovations in order to do that.

      If another company / scientist invent another way to identify the gene they can do that.

      Basically, the "patentable gene" is a MYTH invented by some far left groups. And I don't mean left as in American leftists, who are usually called liberals. I mean it in the European way; that is, the now day "democratic communists". These people are typically against ownership of any kind and I've debated with several of these. They are typically as "confused" as the neo-nazis are (oups Godwins law); one guy I debated with about using the Euro in Sweden actually denied the crimes against humanity committed by Stalin, Pol-Pot and Mao.

      No sane person would allow patenting of genes, but it is another thing to allow patenting of the methods and gadgets needed to find these genes. It cost huge amounts of to develop these methods, and in the end, someone must pay for this.

      (Sorry for the ranting, it's just bad that a misconception such as patentable genes exist)

      --
      "Civis Europaeus sum!"
    3. Re:I just have one question for the writer. by LordLucless · · Score: 1

      This is a terrible idea; it's hard enough for geeks to get girls in the first place without having them sign a licensing agreement before the transfer of your IP can take place.

      --
      Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
    4. Re:I just have one question for the writer. by saskboy · · Score: 1

      Heard inside geek's appartment: ..."I'll just slip the condom on while you sign this waiver here, here, and here."

      --
      Saskboy's blog is good. 9 out of 10 dentists agree.
  10. Comment removed by account_deleted · · Score: 4, Insightful

    Comment removed based on user account deletion

  11. Re:Patents by stanmann · · Score: 1, Funny

    You Trademarked my patent... I'll have to sue.

    --
    Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
  12. My views by frodo+from+middle+ea · · Score: 3, Insightful
    Patents are not inheritantly bad.

    Some ingenious ideas , need to be patented so that the inventor can reap the benefits of his hardwork. But inventions which leave us saying "f@#king DUH!", should seriously be quentioned.

    What USofA needs is a better patent challanging system. and by challanging a patent I don't mean claim ownership of that patent, I mean demonstrate the use of that idea so commonly in public domain, that no one actually deserves the patent.

    --
    for the last time people, I am "frodo from middle eaRTH", not "middle eaST".
    1. Re:My views by Brahmastra · · Score: 4, Insightful

      I agree with you.. But on the other hand, there are ideas that leave us saying "DUH!" but until someone actually came up with that idea, no one saw it.

    2. Re:My views by frodo+from+middle+ea · · Score: 1
      Yes that is true, but just because someone didn't see it that way, doesn't mean, no one was doing the very same thing some other way.

      Sadly the patent wordings most of the time are so vague or catch-all, that the inventor gets credit for more that he deserves.

      This is especially true for software patents

      --
      for the last time people, I am "frodo from middle eaRTH", not "middle eaST".
    3. Re:My views by maximilln · · Score: 1

      Since when are patent auditors "skilled in the art"? I suppose you believe that all system administrators are intimately familiar with all aspects of their system as opposed to walking robots with certifications and social connections.

      --
      +++ATHZ 99:5:80
    4. Re:My views by maximilln · · Score: 1

      I'm not convinced by poster child arguments.

      Most patent auditors have little or no technical experience with the patent that they are auditing. They are not required to replicate experiments or scientifically evaluate the supporting arguments. As long as there is enough contact back and forth with the patent lawyers pushing the application then all they really do is rubber stamp the bottom line.

      A patent on a concrete life preserver will only prevent other people from manufaturing the product. It will not guarantee that a concrete life preserver will save lives.

      --
      +++ATHZ 99:5:80
  13. One problem with many patents.. by overbyj · · Score: 5, Interesting

    is that they are fishing expeditions. IANAPL (...patent lawyer) and I don't pretend to understand the intricacies of computer-related patents, but there is a fundamental flaw i the patenting world.

    For example, as a chemist, I search the patent literature trying to find out what chemical reactions have been reported. It is a well-known fact that you have to take the chemical patent literature with a huge grain of salt (no pun intended!) because many times, the reaciton simply doesn't work the way it is reported to work. The chemical patent literature is not a peer-reviewed process like scientific journals are. It is significantly harder to get an article published in the chemical literature than to patent that material.

    I guess what I am getting at, is that there is rampant patenting taking place with few significant things to show for it. Chemists patent anything and everything they can in the off-chance that someone will use it in an industrial process. They are just total fishing expeditions. I know that there will certainly be people out there to correct me with their own opinion, but in my opinion, it just points to a flawed patent system.

    --
    No trees were harmed in the composition of this; however, numerous electrons were inconvenienced.
    1. Re:One problem with many patents.. by The+Jon · · Score: 1

      Companies also patent reactions which are half way towards a product or reactions which are nowhere near being used for a product. I used to work for a photgraphic media company, and played catch up with the big boys by investigating their patents. Most were dead ends or blocking patents which served little use.

      --
      umop apisdn aw pow f,uop aseald :umop aw pow 'dn aw pow
    2. Re:One problem with many patents.. by maximilln · · Score: 1

      -----
      It is a well-known fact that you have to take the chemical patent literature with a huge grain of salt (no pun intended!) because many times, the reaciton simply doesn't work the way it is reported to work
      -----
      Would you be willing to write this down in official testimony to an attorney for me? I worked for an old German manager at a large pharmaceutical company in Chicago. He would give me procedures from patents or from minor journals and then tell me to make it work. Often I would not be using the same reactants as the published procedure but similar reactants with analogous reactive centers. If the reaction protocol would not work he had absolutely no problem with calling me an incompetent fool (to my face) and writing me up as such in my annual performance reviews. HR was no help. They know nothing of chemistry and, from their vantage point of ignorance, the word of a PhD with 14 years of experience ("this should work!") was much better than the explanation of the FNG ("the substrates are different, it's not the same reaction, and he knows it.") After four years of this kind of professional harassment I quit my job but was in a state of psychological mayhem. I landed in eight months of unemployment and find myself unable to secure another career. HR departments at large pharma companies will frequently fax along copies of the last performance review as references. There was no way for me to fend off the blackballing of this self-important German schmuck.

      What does this have to do with bad patents? At the core the patent office is like the HR department at a large company. They have almost no understanding of the technical material involved and, as long as the paperwork is filled out correctly and the credentials are acceptable, then the patent auditor does little more than cross the Ts and dot the Is.

      --
      +++ATHZ 99:5:80
    3. Re:One problem with many patents.. by srmalloy · · Score: 1
      I guess what I am getting at, is that there is rampant patenting taking place with few significant things to show for it. Chemists patent anything and everything they can in the off-chance that someone will use it in an industrial process.

      One idea that could be a step toward a fix for this problem -- and it's not just with chemistry patents -- is to require that a company holding a patent actually be using that patent in a product. It's not an ironclad solution, nor does it solve all of the problems with patents, but it does eliminate the 'patent it just in case we can get someone to pay to license it some time in the future' attitude, as well as eliminating companies that exist only as licensing houses for a stable of patents, producing nothing themselves.
    4. Re:One problem with many patents.. by maximilln · · Score: 1

      -----
      is to require that a company holding a patent actually be using that patent in a product
      -----
      The upside: Many more jobs are created to keep people using systems which do nothing but secure the holding on a patent.

      The downside: The cost of legitimate goods and services is raised to cover the business cost of maintaining the unneeded processes.

      The parallels: Governments work this way. They sell overpriced goods and services ("who will build roads?") in order to mask the money that politicians and businessment shove into their own pockets. Banks do the same. Insurance companies do the same.

      Patents are big business. The cost of pharmaceuticals (and other useful products) is not so high because of the outright cost of research. The cost of products is high because you're paying the premium to provide high-paying busywork jobs for the executives' sons, daughters, neices and nephews--especially in lucrative positions in the legal departments hunting down anyone who may be infringing on their useless patents.

      --
      +++ATHZ 99:5:80
    5. Re:One problem with many patents.. by blakestah · · Score: 2, Interesting

      One idea that could be a step toward a fix for this problem -- and it's not just with chemistry patents -- is to require that a company holding a patent actually be using that patent in a product.

      No, I don't think this is the solution. First of all, individuals hold patents, not companies. And, secondly, often the idea for the invention requires investment for implementation.

      But I think requiring a working implementation within some liberal period, say, 3 years, after the patent is granted would be useful. With this in mind, 99.5% of all patents would be thrown out in 3 years, and the patent minefield would be cleared.

      Of course, that still leaves the silly but implemented patents like 1-click shopping. Changes in length of time for protection are probably enough for that. The protection time should be granted based on the field - business and software methods should have a shorter period of protection than industrial machines.

      With this in place, the only patents cranking on for 20 years will be non-obvious, implemented, material inventions, a far cry from the current state of the patent office.

    6. Re:One problem with many patents.. by Strych9 · · Score: 1

      In the area of computer patents we here all know that the level and pace of computer reltaed technology moves at a much faster pace than the 'industrial' technology at the turn of the century. Therefore if patents were to be granted it would have to be for an appropriate pro-rated time 10%? 20%? of 20 years?

      As well one may argue that patents protect the investment of reserach. That is something that one cannot overlook. However I purpose changing patents to more of a registry where the owner of that patent does not say get taxed on sales of a product pro-rated to the amount of the "patent object" within the product. Any copy cat would not have that benefit. Therefore for drug companies it would be 100% untaxable sales profit for drugs that they invent, while the copy cats would not have that ability, and would be harder pressed to compete directly. At least then there would be some incentive to PRODUCE and COMPETE with the knowledge being open to the public which is the whoel point in the first place.

  14. Patent on patents? by kveton · · Score: 1, Redundant

    Seems like you could extort a great deal out of the US Patent Office if you owned the patent on patents.

    Yeah, yeah ... not likely but its a friggin' joke ... gimme a break.

  15. Bitter Protest against Patents (n copyrights some) by argoff · · Score: 4, Insightful

    There seems to be this attitude that the suffering of slaves prior to 1850 was something that only happened back then. That it has nothing to do with now, that we are more civilized, more modern, more mature, and more sophisticated. With it comes the arrogance that what happened then, means nothing now, that what happened there has no value here, that the great torment and suffering back then can safely be ignored now as we blow off history and all the values that go with it in terms of understanding, freedom, markets, property rights, and the information age.

    Surely anyone who claimed that there is no incentive go grow cotton without "niggers" on the plantation would be considered a barbaric. But if someone claims that there is no incentive to create intellectual and knowledge works without copyrights and patents, then society calls them enlightened. If someone had said that the great wealth of America rested on slavery as a property right and the plantation system, they were a foolish idiot. But if someone says that the great wealth of societies in the information age rests on "Intellectual Property", then they are called wise. Anyone who says that slavery was about property rights and not control, is a liar. However, if they say that copyrights and patents are not about control, but "Intellectual Property" then they are considered trustworthy. How about - if you don't like slavery - don't own slaves, and if you don't like copyrights no one forces you to buy those creations. How about - if you don't believe in slavery, you must be an anarchist, if you don't believe in copyrights and patents you must be communist. How about - you are a thief if you free slaves from the plantation, you are a thief when you copy someones "Intellectual Property".

    So why are we spoon-feed these poor logical explanations over and over again? Because, like the rapist who drugs his victim and gently penetrates her, rather than beat her and tear into her where all the scars, blood, and bruises can be seen. Like the assassin who befriends and mis-places his victims heart medications, rather than pull out a rifle and pop a bullet in the head. Copyrights and patents are the pinnacle of quiet violence. So seemingly innocent, so seemingly civilized and friendly, so hard to see and identify any direct evil, any direct consequence. After all, what could be less harmless then providing an incentive to artists and inventors, right? But do they really promote art - or just promote works that have the most hype rather than the most meaning and educational value? Do they really help inventors, or do they hinder collaboration and sharing in a way that would put a police state to shame?

    Perhaps the old lady has none to blame when her patented diabetes medication is too expensive to afford anymore. Who can the workers blame when the proprietary technology they bet their career on becomes obsolete and it becomes ever harder to relearn from scratch as they get older. Who can a child in Africa blame when they are dying of AIDS, and there are no generics to treat it! Who do we blame when researchers seeking a cure for cancer encounter massive obstacles to sharing there individual research for fear that their peers will get one up on them, get a key patent, and lock them out! Who do our nations students blame when tabloids are pennies on the dollar, but textbooks dollars on the page! Who do we blame for Hollywood culture being such a failure, and so strongly influencing society in their own failed image.

    As people die because patented medicines are too costly and alternatives too sparse, and the needy go without, not because of genuine shortage, but because artificial human made restrictions. Our government who is the enemy of overt violence, has become the friend of quiet violence. Our government who has organized world wars to protect our freedoms, now promotes a world order that will take them away. The democracy that has allowed us to fight for our rights with votes and politics rather than violence and bloodshed has now become

  16. information patents: life as info by gobbo · · Score: 4, Interesting
    If you're concerned about the dangers of rampant patenting, especially by the 'Life Sciences' sector, check out the research by the ETC group.

    They started as an agriculture research and advocacy group (RAFI) and morphed into ETC about the time they started discovering how broad the patenting system's enclosure of life forms and genetic structures was getting. It's an issue with huge implications, since ideas, biological structures, and living beings are being patented in sometimes outrageous ways.

    1. Re:information patents: life as info by Savage-Rabbit · · Score: 1

      So I just violated somebody's patent rights, displayed complete disregard for intellectual property by illegally replicating patented DNA sequences and in so doing brought the economy of the free world a step closer to collapse? And all this by getting my wife pregnant....

      uuuh ..... ooops ......

      Define:
      v. procreated, procreating, procreates
      v. tr.
      To beget and conceive (offspring).

      To produce or create; originate.

      --
      Only to idiots, are orders laws.
      -- Henning von Tresckow
  17. Gillettes new razor 37 has patents by Anonymous Coward · · Score: 4, Funny

    I've refused to buy any more Gillette products after their latest advert in the UK informed me in a boastful manner that their latest razor has 37(or was it 47? ) patents. For crying out loud, its a razor.

    1. Re:Gillettes new razor 37 has patents by phorm · · Score: 1

      Any link to the patent? If somebody made a razor which uses a frickin'-lazer-beam or something similar I'd say it could be patented. Same for those electric razors which secrete foam (at least for the foam secretion idea).

      I still think the best solution is to limit how long patents - particularly IT patents - have to live. A few years of profit on innovation are fine, but a lifetime is absurd.

    2. Re:Gillettes new razor 37 has patents by stanmann · · Score: 1

      Patents only last 10 years or so...

      --
      Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
    3. Re:Gillettes new razor 37 has patents by irc.goatse.cx+troll · · Score: 1

      I think what the original poster intended was for that 10 years to drop significantly. Think about computers 10 years ago, and how much we still use:
      x86, tcp/ip, some random ibm patents contrast this to how much has failed. Generally after about 4 years any neat idea isnt profitable, even 2 years would be fine.

      I personally would like to see software patents have a choice of:

      submit full working sourcetree, source is released with the patent expiration after 5 years.
      No source, Patent expires after 8 months.

      --
      Pain lasts, kid. Its how you know you're alive. Sometimes I think this growing up thing is just pain management-TheMaxx
    4. Re:Gillettes new razor 37 has patents by TDiddy · · Score: 2, Informative

      Here's a link to the Patent Office web site where I put in a query for the term "razor" in any patent with Gillette as the assignee: Gillette Razor Patents I am one of the 13 patent examiners who would ever examine a patent for a razor (among other things), so I am all too familiar with slogging through a bunch of crap to find decent prior art. As far as the 37 patent on the Mach 3, a bunch of those are design patents and another bunch are older technology that may apply to the Mach 3 tangentially at best. As for a patent examiner's take on the present state of affairs here at the USPTO, I'll just say that things are pretty messed up, and it looks like it is only gonna get worse. Then again, Rogan just "stepped down," so who knows what's gonna happen.

  18. Copyright it, not Patent your DNA by Dareth · · Score: 4, Funny

    Copyright your DNA. If you copyright your DNA then you can sue your spouse/partner for copyright infringement if they get pregnant or get you pregnant!

    Sure to insure domestic tranquility.

    --

    I only look human.
    My mother is a halfling and my dad is an ogre, so that makes me an Ogreling
    1. Re:Copyright it, not Patent your DNA by mellon · · Score: 1

      Naw, that's not a derivative work - it's fair use. Admittedly, the percentage of use of the work is high, but if you look into the precedents, I think you'll see that, at least in common law, 50% is considered customary.

      So you'd only really have a case in a situation where more than 50% of the copyrighted genes were used - e.g., a double Y chromosome or something. Even then, I think you'd have trouble getting any sympathy from a jury. Of course, with good representation, anything is possible, I guess.

  19. Re:Bitter Protest against Patents (n copyrights so by BillFarber · · Score: 2, Funny

    And here I thought the 60s were dead.

  20. America's Goofiest Patents by GillBates0 · · Score: 4, Interesting
    Google's your friend: Totally Absurd Inventions

    Categorized and arranged alphabetically in all their royal glory.

    My favorite: The Blind Spot Toy:
    USA patent 4,477,3358 / Issued 1994
    It is never too early to start your Christmas holiday shopping. Why not be original this year and avoid the toys that everyone seems to be buying? Why not give the gift that keeps on giving, the "Apparatus for Aligning Image with Blind Spot of the Eye"!! Patented in 1975, this toy allows the user to locate their blind spot! In order to play this amazingly fun game, strap the toy tightly on the top of your head.

    Close your left eye and focus on the dangling tab with your right eye, then switch eyes. Voila! The dangling tab has disappeared into your blind spot. Not only will this invention provide endless hours of fun and good times for everyone (especially at parties), but anyone wearing this apparatus will unquestionably become irresistible to the opposite sex. Enjoy!

    --
    An Indian-American Hindu committed to non-violent thought/speech/action alarmed by the global explosion of radical Islam
  21. Rerun by tds67 · · Score: 5, Funny
    When Good Patents Go Bad

    This is a rerun. I saw this on Fox a couple of weeks ago.

    1. Re:Rerun by orkysoft · · Score: 1

      Yeah, it wasn't as good as The World's Blankiest Blank...

      --

      I suffer from attention surplus disorder.
  22. Good Review? by timiscool999 · · Score: 2, Interesting

    " good review of patents in the information age"

    Is it good because it agrees with the Slashdot point of view?

    Just ask IBM, Microsoft, Amazon, what they think of patents. I doubt they'll like this article very much.

    I can already see it...-12, troll.

  23. Public domain incompetence by Hoi+Polloi · · Score: 1

    Obviously there is no patent on poorly written laws.

    --
    It is by the juice of the coffee bean that thoughts acquire speed, the teeth acquire stains. The stains become a warning
    1. Re:Public domain incompetence by penguinoid · · Score: 1

      Nor a patent on poorly written patent applications.

      --
      Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
  24. Pertinent link : bustpatents.com by Lord+Satri · · Score: 2, Informative
  25. Get it out of the way..... by BubbaTheBarbarian · · Score: 1, Funny

    I for one welcome our new IP overlords!!!

    SCO is suing for damages based on suing for patents. Seems they have a patent on the patent and claim all other patents are derivative works...

    Also, suing for use of a patent when you don't have a patent is a business model patent that they have had since acquiring the rights to said patent from a French/American farmer in 1957...

  26. Arn't we allready there? by yoshi_mon · · Score: 3, Informative

    Last time I heard our law schools were turning out 1 potental lawyer for every 4 americans.

    So are more lawyer really the anwser?

    --

    Really, I know what I'm doing...Ohhhh, look at the shiny buttons!
    1. Re:Arn't we allready there? by cybergrue · · Score: 1
      Where are you getting your numbers from? Last time I checked, only about 1 in 5 people in the US had a University degree. I do know that about half the lawyers in the world are in the US though. This was one of the things that I disagreed with when I read Rifkins
      • The end of Work
      . Rifkin contended that large ammount of people would not be able to move into the knowledge industries, however, now about 1 in 5 people in the western world have University degrees, up significantly from a 15 years ago. Too bad a lot of these people are involved in intellectual make work projects and not contributing to the advancement of the Human condidtion.

      Why am I starting to agree with Shakespear's advice on what to do with Lawyers?

    2. Re:Arn't we allready there? by yoshi_mon · · Score: 1

      Well when you consider the # of lawyers that are allready currently in practice with the # of those that have the potental, ie pass the bar, you can arrive at that staggering number.

      I guess I pulled a bit of a /. trick by making my post seem more than what it was, but again when you understand how many lawyers we have allready, think politics alone, and how many the law schools who eat a very good number of collage grads (And while that number may be low as you point out, think about how many BS students then go on to law school. I know personally the law school on my campus was very large, and very very nice.) you can start to see how lawyers have become the prefered profession of those who don't excel at math and or chemistry and want to still try to make a lot of money.

      --

      Really, I know what I'm doing...Ohhhh, look at the shiny buttons!
  27. the patent system is so totally out of hand... by AllynM · · Score: 1

    ...that i believe people will simply start ignoring it altogether. for example, i'm building a twin engine vw scirocco. i am coming up with my own engine management, suspension (active) control, and just about everything else (its a personal eduaction project). you might figure some patents may be in order depending on just what comes from the project, and i know it would be incredibly easy to be granted such patents (especially nowdays)... however, i find the current system such a load of crap that i believe filing for patents may do more harm than good, especially once people begin to place no regard on the protection that the patents once stood for. with people filing for totally obvious stuff like how to swing on a swing, how can you possibly expect anyone to take the system seriously?

    --
    this sig was brought to you by the letter /.
    1. Re:the patent system is so totally out of hand... by Lehk228 · · Score: 1

      You should PUBLISH any developments you make in order to ensure that others cannot patent them

      --
      Snowden and Manning are heroes.
  28. Re:Bitter Protest against Patents (n copyrights so by captainkibble · · Score: 1

    How very well put. It even managed to rise above my rampant cynicism, for a while.

    --
    Warning! This post may contain a pun!
  29. Re:Patent by mrsev · · Score: 1

    sorry but there is prior art on this headline

  30. It could always be worse by Anonymous Coward · · Score: 3, Funny

    I'm waiting for someone to patent "A technique of stretching the rectum to a dangerously distended size with the purpose of photographing it in such a manner that it can be displayed on a network of computers in order to spread the photographs to unsuspecting users."

    1. Re:It could always be worse by stanmann · · Score: 1

      already pattentedAnd trademarked too...

      --
      Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
  31. DNA Patents by WWWAvenger · · Score: 2, Funny

    Patenting your own DNA? That's ludicrious! That's like a robot patenting it's own firmware.

    "Thanks for being my prior art, Dad. Happy Birthday."

  32. Re:Bitter Protest against Patents (n copyrights so by argoff · · Score: 1

    I was about to slam you for plagiarising (from here) when I noticed that you're the same person. Makes a change.

    he he he, guilty as charged. Last time when i posted my "bitter protest against copyrights" on slashdot, the owner of the site like it so much that he asked if he could post it there. So This time I posted my bitter protest against patents there first.

    ps: if you agree with this protest, you'll probably like that one too.

  33. Generic... by mgcsinc · · Score: 2, Interesting

    Generic post highlighting the fact that patents are really tested post-issuance by courts and not pre-issuance by the Patent Office...

  34. Software patents extremely grey area by 192939495969798999 · · Score: 2, Insightful

    Here is the trouble I have. Suppose I come up with a piece of software that can perfectly transcribe english from speech to text - accents and all, right out of the box. Shouldn't that be worth a patent?
    How about the guy with the patent on the blinking cursor? Great ideas, right? So, where does the line get drawn? Obviously, patenting something already in use is bad, but what about really obvious things that no one bothered to do yet?
    For years, Ford had to pay a different company for a patent on the internal combustion engine. They literally had to wait for the patent to run out!

    --
    stuff |
    1. Re:Software patents extremely grey area by Oscillatory · · Score: 1

      Well .. the patent you want wouldn't be on the idea of speech to text that works well but on some piece of the technology that allows you to actually do it. There are lots of patents out there on parts of the problem, but also clearly lots more improvements are needed.

      It seems to me that the grey area has to do with patents that are just barely non-obvious (like one-click shopping). Details of complex technology are often quite far from obvious and make a lot more sense to patent. Even when they're software.

  35. Prior Art by Liselle · · Score: 1
    Bigger companies find themselves prey to clever entrepreneurs like the original owners of Acacia's digital media patents, who skillfully anticipate the direction of certain technologies and then quietly wait for someone else to commercialize a related product. If they guess right, they can demand lucrative licensing fees.

    Intel's Grove derides such patent holders for showing little interest in producing goods with their inventions in favor of demanding licensing fees from others. "We call them trolls," he said.
    You think Slashdot could call prior art on trolls?
    --
    Auto-reply to ACs: "Truly, you have a dizzying intellect."
  36. Why VisiCalc wasn't patented by tigertiger · · Score: 5, Interesting
    There is an interesting article by Dan Bricklin, one of the inventors of VisiCalc (the first spreadsheet programs), on why they didn't patent VisiCalc. It's simple - patenting software was only possible after 1981. Think what the industry would look like if people had been able to patent spreadsheets (VisiCalc), full-screen word processing (WordStar and many others before), and windowing systems (Xerox PARC and Apple Lisa).

    The bad news is that Bricklin thinks software patents are bad, but since they are here, you have to try to patent as much as possible. I guess soon we will have to take out patent-infringement insurance with premiums as high as our salaries.

  37. From the Desk of Dr. Evil by thepuma · · Score: 2, Funny
    Does this mean that I can patent my design for Sharks with Frikken Laser Beams Attached to their Frikken Heads? I believe that I have prior art on this.

    How about my design for Dolphins with Frikken Laser Beams Attached to Their Fins?

    D. Evil

    --

    Free your ecomony and enact the FairTax

  38. They are for the Killbots by StringBlade · · Score: 1
    Zapp Brannigan: You see, killbots have a preset kill limit. Knowing their weakness, I sent wave after wave of my own [lawyers] at them until they reached their limit and shut down.

    with apologies to Matt Groening and Futurama

    --
    ...and that's the way the cookie crumbles.
  39. Patenting DNA? by ThosLives · · Score: 2, Insightful
    I have to say - WTF? Who do I write to about this? What the heck are they patenting? The article doesn't really say much.

    If they are patenting "hey I figured out what strand GCACTCTGATCTGTCTATATGTGT does" it's garbage.

    If, however, they figured out what sequence of nucleotides happens to build a molecular machine that does X (where X is something new) then a patent might be arguable. The *might* comes from the fact that I think they should patent the molecular machine, not the method of making it. After all, DNA is kind of like a programming language - it's a tool set for building molecular machines. You can't patent blueprints or schematics, so why would you be able to patent DNA? (I can't recall if blueprints are copyrightable though - I know that typically blueprints, etc. have a disclaimer that says "you can't build this without permission from the company that generated it" because the value is in *using* the blueprint, not having it. Usually. I'm sure there are caveats.

    Well, that helped me calm down a little...

    --
    "There are a dozen opinions on a matter until you know the truth. Then there is only one." - CS Lewis (paraprhase)
    1. Re:Patenting DNA? by NihilSmurf · · Score: 1

      Only your parents should be able to get IP protection (patent/trademark/copyright) over your DNA, since they created it, not you. And even then, it should be considered a derived work.

  40. One Click Local Weather reports by Camel+Pilot · · Score: 3, Informative

    I recently modified the shopping cart on my wife's hot sauce store to give a discount if the client is identified as Mozilla or Linux O/S. A friendly feature to encourage the use of alternative browsers (and desktop operating systems). This is the first cart with such a "feature" I know of.

    After I finished, it was a _tough_ one night hack, the thought occurred to me that some folks have patented less (ie One click shopping, local weather etc.). It demonstrated to me the need to be change the patents laws to prevent the locking up of obvious or trival application of emerging technology.

    1. Re:One Click Local Weather reports by Camel+Pilot · · Score: 2, Interesting

      No! I am not punishing anyone. The discount actually comes out of my pocket not the windows user. Look at it this way Open Source developers tend use Mozilla (or other gecko based clients) and linux as a desktop. This is my way or rewarding those folks since I run our store almost exclusively on Open Source software (UPS Worldship and stamps.com requires me to run Windows for some machines :(

      I have not had the time to dial in all open source browsers, but will as time permits.

      When a store spams you with a "coupon" (a very common practice) does that "punish" all those who do not have the coupon?

    2. Re:One Click Local Weather reports by thebatlab · · Score: 1

      I see your point (though I wasn't trying to flamebait as the mods think, I'm just cranky in the morning ;)) but at the same time I think it's a bit different from a regular coupon. If I get a coupon, there are generally no restrictions on the ability to use that coupon other than dates and purchase amounts. I've never got a coupon that said "Void if you use a Hummer to get to the store" which seems to be what your mozilla discount is implying. How the customer gets to the store, online or not, shouldn't be a factor in being rewarded I don't think.

    3. Re:One Click Local Weather reports by Camel+Pilot · · Score: 2, Insightful

      Hey if they can afford a Hummer then they certainly should not get a discount :)

      My overall point is "ya sure it is a gimmick" but some similar gimmicks have been patented and they should not.

    4. Re:One Click Local Weather reports by dtmos · · Score: 1

      While you're working on your wife's site, you might want to remove the unneeded apostrophe in the boilerplate: "Sam McGees specializes in premium quality hot sauces, hot salsa's . . .".

  41. At least USPTO admits it... by syphax · · Score: 3, Funny
    "We're focused on making sure that we're kicking out the best quality patents,"
    -- Jon W. Dudas, deputy director of the patent office

    This may explain why so many bad ones get granted?

    --
    Simple Unexpected Concrete Credible Emotional Stories
  42. Holy shit by sirReal.83. · · Score: 1

    Extremely well-written and thoughtful column. You lay everything out very well, and make surprisingly sound analogies. I was trying to find holes in the IP/HP (human property) argument, but I failed. Please, do America a favor and submit this to relevant community news sites, newspapers, magazines, corporations, even politicians.

    Sorry, I didn't know I was capable of such blatant brown-nosing... lemme pull my nose out of your ass. :)

    1. Re:Holy shit by argoff · · Score: 1

      I was trying to find holes in the IP/HP (human property) argument, but I failed...

      The reasoning behind that is very simple. It's because it has nothing to do with property - it is about controll and violence. Perhaps they use different terminology, perhaps different labels, perhaps different details and techniques, but the logic and rational is the same as has been pushed for 1000's of years by tyrants, dictators, and the greedy. Once you see it, the facts speak for themselves.

  43. Cool. You can patent everything today! by frozenray · · Score: 1

    Apropos "whacky" patents:

    Just wait until my patent application for "inducing sexual stimulation in human males by repeated stroking of the male reproductive organ using either (or both) of the subject's own hands" is approved.

    Keep in mind that in order to contest my patent you'd have to claim prior (ahem) "art" in front of a (possibly female) judge.

    And if you say that you can't patent stuff like that, then why did these patent applications get approved, eh? (Link courtesy of another slashdotter.)

    --
    "There are already a million monkeys on a million typewriters, and Usenet is NOTHING like Shakespeare." - Blair Houghton
    1. Re:Cool. You can patent everything today! by scharkalvin · · Score: 1

      I can show prior art by dragging in PeeWee Herman.

  44. Acacia by One+Louder · · Score: 4, Insightful
    The porn guys raised the alarm on Acacia quite a long time ago but were actively ignored by the mainstream because they were "porn". Now Acacia has a few wins (and money) under its belt and is starting to go after the mainstream video streamers.

    It was a very clever strategy on the part of Acacia - first go after the porn folks (nobody would come to their defense), then the university and online education folks (no money to fight), then the broadcasters (already under siege by the trade associations), then the toolmakers. They probably could have been nipped in the bud if people had paid attention early on.

    At this point, it's important to drag the big players into the fight - folks who are being sued by Acacia need to subsequently sue the tool vendors (Microsoft, Real, Apple, Macromedia) for selling them allegedly unlicensed patented technology.

  45. A better trick by freeweed · · Score: 1

    Patent your DNA. Clone yourself a few thousand times, and wait until your clones are ubiquitous and highly successful.

    Then, just as the patent is going to run out, start suing for unauthorized use of your GIF^H^H^H DNA format.

    --
    Endless arguments over trivial contradictions in books written by ignorant savages to explain thunder in the dark.
  46. EU patent law campaign by levell · · Score: 4, Informative
    This might be interesting if you are currently writing to your local MP (or equivalent for EU countries other than the UK) as the FFII are imploring you to do if you don't want the EU to pass bad software patent law. It might be an idea to mention this article in your letter as it gives an easily readable summary of what if wrong with the American system that is written by a "respected" source.

    Let's hope we get the law as the EU parliament framed it....

    --
    Struggling to find a day everyone can make? WhenShallWe.com
  47. Re:Bitter Protest against Patents (n copyrights so by Anonymous Coward · · Score: 3, Insightful

    I find your analogy between there being no incentive without slaves and no incentive without copyright to be poorly thought out (or perhapse just poorly articulated).

    A more apt analogy for cotton with regards to copyright would be:

    "There would be no incentive to grow cotton if no one would _buy_ cotton, because they could get it for free. "

    I know that it isnt possible to get cotton for free, but you have to understand that it IS possible with regards to most copyrighted works.

    Your slavery argument when applied to copyright is more accurately:

    "If the _cost_ of creating copyrighted material went up significantly, there would be no incentive to create copyrighted material."

    As you can see, both these statements are clearly incorrect, and I would say that your analogy bends the truth to make a point that isnt there. Your peice is clearly well written, but you should work on your analogies. :)

  48. Microsoft Patents Ones and Zeros by mojoNYC · · Score: 2, Funny
    http://www.theonion.com/onion3311/microsoftpatents .html

    all the way from back in 1998, and still the all-time funniest parody on patent madness...

  49. Re:Bitter Protest against Patents (n copyrights so by argoff · · Score: 1


    Copyrights are not about intangable works any more then slavery was about cotton. They are both about controlling people's behavior in a way that was economically benecifial to the people doing the controlling. That's why the anaology worked so well even though the nature of the property was so different.

  50. Anti - Patents? by mhotas · · Score: 5, Interesting

    There ought to be such a thing as antipatents. These would work like regular patents, in that they would be registered, and somebody gets to claim credit, but also disavow ownership. So whatever the idea is, it's explicitly in the public domain, and whoever claimed it first gets some positive attention. Kind of like the GPL, but not just for code.

    1. Re:Anti - Patents? by CyberSlugGump · · Score: 1

      Maybe someone can find a better link, but it seems the "prior art" is the current mechanism for "anti-patents"

      Why did its inventor, an English chemist named John Walker, never patent the match?

    2. Re:Anti - Patents? by burns210 · · Score: 1

      would be cool. but the problem is giving patents to obvious things, or things that shouldn't be patented or non original work that gets patented(because it hasn't applied for a patent, which is prior art is check with)... Open patents could be abused just as easily as closed patents... the problem is still gonna be that a patent is too easily given to the wrong people.

  51. Is that one patent for each blade? by blighter · · Score: 1

    The new Gillette Mach 37. 37 blades mean a closer shave than ever before. Blades one through seven draw the hair out and cleanly slice it away. Blade 12 may cause bleeding...

    with apologies to snl.

  52. I can fix their problem .... by Grizzlysmit · · Score: 1

    Just rescind all software and Internet patents, pass a law that abolishes them. done.

    --
    in my life God comes first.... but Linux is pretty high after that :-D
    Francis Smit
  53. Re:Bitter Protest against Patents (n copyrights so by carn1fex · · Score: 2, Interesting

    interesting points! but my english professor would have burts laughing and spilled red ink all over this flowery soliloquy of abraham lincoln. "like the rapist who drugs his victim and gently penetrates her"??- jesus man, this mellodrama should impress no one but torch waving farmers at the bandstand in 1840.

    --

    ---------

    No matter how thin you slice it, its still baloney.

  54. Re:Bitter Protest against Patents (n copyrights so by willtsmith · · Score: 1

    That sounds like ...

    "No one will produce Open Source because they can get it for free."

    Right????

    --
    -------- -------- Support Wesley Clark for president!!!
  55. arguments for by ProfBooty · · Score: 2, Interesting

    getting a patent or filing a patent, can at least provide some tangible property/proof of a concept, that can enable a startup or small firm to get investors, thus building their business. Its the business standpoint that most people here on slashdot don't consider.

    People may complain about abuse, but isn't it better that via the patent system, people disclose their inventions instead of hiding behind trade secrets, thus allowing others to improve upon the inital invention? I would expect that people here would be happy about that since, thanks to the DCMA, reverse engineering is now of questionable legality?

    At lot of what people on slashdot say is "obvious" may not be really obvious. One has to look and decide if it was obvious at the time of invention, otherwise it is impermissible hindsight, which is not valid reasons for combining references.

    --
    Bring back the old version of slashdot.
    1. Re:arguments for by Halo1 · · Score: 2, Insightful
      getting a patent or filing a patent, can at least provide some tangible property/proof of a concept, that can enable a startup or small firm to get investors, thus building their business. Its the business standpoint that most people here on slashdot don't consider
      If there are no software patents, investors cannot require them. It's really as simple as that. Software patents are the .com hype all over again: companies are not supposed to have a good product, good customer relationship management or even visionary management. No, they have to have something called "intellectual property" (be it in the form of patents or anything else).

      How long till that bubble bursts as well? Unless you're a company like Eolas, you don't build a business on software patents. They also don't really help, except if you are attacked by someone else for infringement on their patents (which again is not possible if there are no swpats in the first place). For a business to be succeed, it needs actual products, customers, etc, not some pieces of paper that let it appropriate some general principles when implemented on a computer.

      People may complain about abuse, but isn't it better that via the patent system, people disclose their inventions instead of hiding behind trade secrets, thus allowing others to improve upon the initial invention?
      There are several problems with this argument when applied to software patents, as nicely highlighted in the recent FTC study (the link is a summary to the swpat-related stuff, a link to the full study is available at the top of that page as well).

      First of all, a lot of software patents are simply business methods implemented in a computer program. By their very nature, if such business methods are put to use, they become public (since you use them to interact with the public).

      Secondly, most companies forbid their employees from reading any patents, for the fear that it will result in them being sued for willful infringement (making them risk tripple damages and attorneys fees)! Besides, in general the developers can put very little of the patents to use because of all the legalese and the absence of source code.

      As someone in the FTC study says "there's too much information and it's no longer meaningful".

      --
      Donate free food here
  56. No. What makes a GOOD patent? by brett_sinclair · · Score: 2, Insightful

    It is (obviously) not hard to find bad examples of software patents. But are there any good ones?

    In my view, there should be only one rule: "Would X have been invented without the 20 years of protection from competition provided by patent law?"

    There is absolutely no reason for society to allow patents for inventions that don't pass this simple test.

    1. Re:No. What makes a GOOD patent? by axxackall · · Score: 1
      The problem is that society doesn't decide about patterns per se. It's responibility of that part of society which benefits form it. It's called corporations. US govt is for corporations and by corporations. No chance to have a law system protecting small inventors here. Same for small developers. As for today, in USA there is no way to develop anything any usefull without either violating some patents or paying some royalties. But if a big company can afford doing both by hiring an army of emploers and keeping tons of patents to answer back if being threatened, then a small company cannot do neither of it.

      This society is organized wrong in general. It's a bug that cannot be fixed by the society itself - the part of the society that can fix it doesn't have a motivation for doing so, the rest of society has no capability of fixing anything.

      --

      Less is more !
  57. Re:Bitter Protest against Patents (n copyrights so by Swanktastic · · Score: 2, Insightful

    I think your essay does a real disservice to the argument against copyrights and patents.

    The comparison to slavery pisses me off and it should everyone here. To put copyright/patent legislation on the same level of importance with human slavery is utterly immoral and academically incorrect. Not only does it reek of propaganda (in your next article, you might as well claim that Hitler would have supported patents), but they have zero to do with each other. From a purely economic perspective, slavery was about the confiscation of someone's income from one race to another. If anything, destroying copyrights would be about YOU confiscating income from ME. I may just as well claim that copyright destruction is the enslavement by the public of the creator of wisdom. There you go, now you're the slave master. How does it feel? Your argument based on slavery trivializes a significant human tragedy in order to make a terrible, invalid point.

    95% of the substance of the essay is the narcissistic ramblings of a writer in love with his own wordage. I would hope folks here would be more intelligent consumers of information than to be persuaded by a piece of garbage wrapped up with a nice ribbon. This type of rhetoric does nothing more than alienate the 98% of folks who are sitting on the fence regarding this issue.

  58. Re:Bitter Protest against Patents (n copyrights so by argoff · · Score: 1


    You know what, in this essay my real focus was on patents and not copyrights. But I'm strongly against copyrights too, and couldn't help mixing it in there alittle. ( type in bitter protest against copyrights into a search engine for one more focused on that ) Perhaps I shoud reweite, for copyrights the analogy is overkill I must admit, but not for patents. Children in Africa dying of AIDS while US pharmacuticals sue them to block generics, old people suffering and dying because of the effects of patents on medical research and cost and use. I don't regret it a bit.

    Authority is not an end in itself, BTW, but individual liberty and truth are. That's why I love free markets but hate most 'intellectual property' controlls.

  59. Business guys by Anonymous Coward · · Score: 2, Interesting

    I've been in similar situations and the thing about patents is the drive is usually from the business guys. Mostly, it's from people with little or no technical knowledge, therefore they try to patent everything. I've been asked in the past about patents and ordered to write up patents. Business guys don't care if it's obvious. They only care about whether or not they can make money from it. In fact the patents that are more obvious are the ones they are most eager to file. Their thinking is, if it's obvious, some one will end up implementing it. Therefore who ever owns the patent has a huge advantage, especially if their own implementation sucks. Non-trivial, non-obvious patents are the ones that usually have lower priority.

  60. My Patent by Doc+Squidly · · Score: 1

    I have just patented AIR. You may all start paying me for breathing it.

    I deny responsibility for the quality of air you breath
    I cannot be held accountable for damages cause insufficient amounts of breathable air
    Patent 2003, All Rights Reserved

    --
    I think I think, therefore I think I am.
  61. Re:Bitter Protest against Patents (n copyrights so by Anonymous Coward · · Score: 1, Interesting

    A good question to ask is: Is it possible to have free markets without authorities? I would say that Copyright and Patent law is needed... but anti-trust law is needed too! and also: Is it possible to have liberty without authorities. This is kind of an oxymoron, but I doubt freedom is possible without control of that freedom. In fact I would argue that freedom is almost impossible, as it is destroyed by both anarchy and control. Its too bad really, but it seems more and more like a phantom dream. and amusingly: What is truth without authority? Absurity? I don't really have any concrete answers to these questions, but I would be interested to hear your views.

  62. Patents and copyright by Anonymous Coward · · Score: 2, Interesting

    I think the whole problem is that we are allowing patents on IP already protected by copyright.

    The two protections were designed to be used for different purposes. copyright for IP, patents for inventions.

    When you allow both types of protection to be applied to one piece of work, the result is strangulation of innovation.

    We need to decide if software should be copyrighted, or patented. It can't be both. It isn't fair to the human race and isn't in anyone's best interest except the software companies (sometimes), which incidentally simultaneously have the most to lose, and the most to gain at the same time.

    Paradox is not good for the legal system, or the protection of IP.

    l8,
    AC

  63. A good review on why software patents are bad by Anonymous Coward · · Score: 1, Informative

    Found this in Lawrence Lessig's blog discussions:

    Software Patents in Action

    - an ominous coward

  64. Totally agree by melted · · Score: 1

    The idea makes sense, but who's going to pay for antipatents? Patenting something is costly. Anti-patenting (and paying lawyers when you anti-patent is challenged in court) may be even more costly. One of the main purposes of patents is to make innovation profitable to stimulate innovation. Sure patents are wildly abused, but this was the initial idea behind them. What would be the idea behind anti-patents that would make the government want to implement this legal mechanism?

  65. It all started... by liv33vil · · Score: 1

    ...when RCA patented the electronmagnetic radiation frequencies used for Television.

  66. Re:Acacia & prior art? by jamiefaye · · Score: 1

    Does anyone know what Acacia is claiming?

    I know I developed several prototype streaming media systems at Apple in 1986-1987 that used Appletalk, and one of my coworkers did a TCP/IP port of one of these experiments. I don't how widely shown this stuff was. Farallon did a screen sharing system that is still available called Timbuktu that did streaming/multicasting too.

    I also did some object-oriented streaming media stuff at Kalieda Labs, but that was the early 90s & MPEG was already on the radar.

    -- Jamie

  67. Good Patents ??? by Grizzlysmit · · Score: 1

    Hmmmm the more I think about it the more I question the existence of good patents!!

    --
    in my life God comes first.... but Linux is pretty high after that :-D
    Francis Smit
  68. There really isn't a justification for Software... by i)ave · · Score: 2, Insightful

    ...patents. Before I get flamed, let me say that the article eludes to this, but doesn't quite make the case.
    The whole purpose of the patent system was designed to provide an incentive(payment) for a company to willingly incrue the costs associated with the research and design of a new product. That incentive came in the form of a patent (guaranteed monopoly for 20 years) to recover the associated costs that went into research and design.
    In software, although there are certainly costs incrued in the full-fledged development of a product from start-to-finish... aren't our current copyright laws sufficient protection on completed works? Even though some console games can cost millions to produce, are those millions really associated with research and design, or are they associated with actual coding, graphic art, music soundtracks, etc... ?
    My argument is that there is no need for patents on software, since there is no detrimental impact on companies who innovate. In hardware, a company might spend a billion$ trying to develop a product before it can ever come to market -- that's a detrimental impact on that company's bottom line, and they should have a 20 year monopoly. If that company was not to receive that monopoly, in most cases, they would not have a necessary incentive to spend a billion$ on R&D.
    Contrast that with software innovation... Does anyone REALLY BELIEVE that without software/internet patents, Amazon wouldn't have developed 1-click-shopping??? Of course they would have, because it didn't cost them anything extra to develop and it pays instant rewards in increased sales. Do you think for a second that we wouldn't have browser plug-ins without patents? Do you think for a second that we wouldn't have turbotax, halo, amazon, ebay, slashdot without patents? Of course we would! The question is what do we NOT have because of software patents. What companies are being shut-down, stifled, put out of business -- what REAL innovations are being stamped out because they might "infringe" on something as asinine as 1-click-shopping?
    Everyone agrees that without industrial patents, we wouldn't have 1/10th the innovation in aerospace, electronics, mining, or environmental science... but without software/internet patents we'd have even MORE innovation than we have today.

    --
    -- I'd give my right arm to be ambidextrous
  69. I'm sure... by corren · · Score: 1

    Al Gore would claim prior art...

  70. Disagree by rumblin'rabbit · · Score: 2, Interesting
    A few points...

    You've chosen a trivial example (one-click shopping) which probably should never have been awarded a patent in the first place due to its obviousness.

    Second, I don't like that term "software patent". You don't patent software, you patent algorithms and methodologies which can be implemented in software. Many of the algorithms, however, could conceivably be implemented through something other than through the running of a software program.

    The economics of developing new algorithms are no different than developing a new automobile transmission. It entail risk, it costs money, it requires ingenuity and effort, and the results of your labour can easily be ripped off by others who had and did none of these things.

    The real problem with "software patents" is the quality of the patents. Many should either never have been allowed, or have been cut back in scope.

  71. The really scarey part by WindBourne · · Score: 3, Interesting

    It is not that patents are being granted here in the US to large companies who make large contributions to Politicians. Rather, it is the fact the we are pushing this insane approach to patents on other countries and they are actually considering it.
    We have created a monster and that should be obvious to all. Yet other nations and regions are considering it. What a nightmare.

    --
    I prefer the "u" in honour as it seems to be missing these days.
  72. I applied for a patent on... by Baron+of+Greymatter · · Score: 1

    ...a process that combines computer programs with human waste products.

    In other words, a patent on sh!tty software. I want $1 in royalties on everything Microsoft has ever sold.

    --
    Microsoft's VP of Customer Service is Helen Waite. If you are having problems with their products go to Helen Waite.
  73. Re:Bitter Protest against Patents (n copyrights so by argoff · · Score: 1

    Well, IMHO, in an idea situation authority would derive from an institutions, systems, or individuals ability to protect and secure liberties.

    Now, it seems like there might be a new paradigm, authority derives from the technology - or the ability to implement it and use it effectively.

    It seems as history goes on, individuals are comming to have less authority over one another, but more over themselves. Hopefully IMHO, this trend continues.

  74. IP/slavery meme by Thinkit3 · · Score: 1

    Wonder who discovered this. Oh well--I think it's a good one. That and "information wants to be free!"

    --
    -Libertarian secular transhumanist
    1. Re:IP/slavery meme by argoff · · Score: 3, Interesting


      Actually there is a story behind this. It was at a time when i was doing alot of thinking about copyrights, but every time i thought about the problems with copyrights - some of the logic - it sounded like somthing i had herd before. I finally came up with an essay comparing it with slavery and sent it to RMS. Believe it or not, he replied, and said somthing like I should be carefull because the suffering caused by slavery was far more atricious than what is suffered by copytights. Like more often than not, he was right.

      So anyhow I was chewing on that for awhile, and long behold a week later I stumbled upon an article in the berkley daily planet writen by a pharmacutical exec trying to justify some AIDS patent lawsiuts against africans. The arguments that they had no incentive without patents, and that they were generous to Africans sure sounded like there was no incentive to grow cotton, and we are kind to our slaves on the plantation. From my history lessons.

      The meaning of the 1850s today, the quiet violence, the nature of rights, the historical perspective, all those have stories too - but i just dont have time to elaborate here.

  75. argoff, look at my history. by Thinkit3 · · Score: 1

    I'm for complete abolishment of patents and copyrights as well. I've read a lot of slashdot and don't remember many others that truly are about abolishment and not some other compromise. Might want to checkout out infoanarchy.org , although it's kinda dead. Oh, mod me up if you can.

    --
    -Libertarian secular transhumanist
  76. Whoah! by CrystalFalcon · · Score: 1

    Mind if I copy this into my blog? I'll be happy to provide more detailed credit than "argoff, Slashdot" if you like.

    1. Re:Whoah! by argoff · · Score: 1

      yes. please do.
      thanks.

  77. Re:Bitter Protest against Patents (n copyrights so by jared_hanson · · Score: 1

    You raise some interesting points, and, unfortunatly, I do not have the time to comment on all of them. As such, I'd like to raise issue with your comparison of slavery to information copying.

    Slavery was and is bad because it denies a person of their inherant and/or implied worth. By forcing someone to do what you say, you deny them the opportunity to pursue their own desires. This done with no compensation only expounds the problem. In your particular analogy, slaves were forced to pick cotton without proper compensation.

    Now, on to copyrights. For clarity's sake, I will use the example of a musician who has released an album. Now, you go to your local record store and buy said album. Let's say you go home and rip this album and upload it to some file sharing service. By so distributing said album for free, you are denying (in variable regards) the right of the artist to compensate from his/her work. Thus, you are more like the slave owner rather than the slave.

    The distinction to be made is who is doing the work and who is being compensated for the work. In any fair system, the person doing the work should be the person compensated. In slavery's case, the two were oposite.

    The analogy falls apart when looking at information distribution. It also adds in some complexities which make the analogy to slavery inappropriate. The person doing the work is the artist, and it should be that person who choses how they are compensated. Be it sign a record contract, give out the CD for free and hope for concert ticket sales, whatever. A fair, unbarbaric society, lets the person doing the work choose their compensation. You are denying the artist this right by distributing his music, so long as the artist originally chose to sell the music.

    Now, I have no issue with those who give away their music. I think that is wonderful. But, it was their descision to do so in the first place. If an artist chooses to sell music, it is not my position to deny him/her that right. Denying people their rights is what made slavery wrong. However, if I were to say I wanted to be whipped and work for nothing, that would be my perrogative. You taking advantage of my descision would not make you a slave owner, because you have to denied me my choice. However, as I am the one chosing, I can walk away at any time.

    In conclusion, the fair society lets the those doing the work determine appropriate compensation. And, if you look at the reality of the situation, that is exactly what we do. You have copyrights and patents if you want to distribute your work and receive compensation. There is also the public domain, if you want to freely give away what you have created. Saying that there should be one and only one way to make your works available denies a person of their right to chose which is appropriate for them.

    Anyway, this is just my initial freeflowing thoughts. Some time I will take the time and write out a thought out, well organized opinion. However, I find your position intriguing and would like to hear your response.

    --
    -- Fighting mediocrity one bad post at a time.
  78. Acacia and digital audio/video downloads by FightThePatent · · Score: 1

    Anyone have some insight into downloading audio/video files from a BBS prior to May 1990, feel free to contact me. A sampling of potential prior art by me and and some volunteer prior art searchers at: http://www.fightthepatent.com/v2/PriorArtFound.htm l More info about Acacia Research, SightSound, and USA Video at: http://www.FightThePatent.com

  79. Stupid Question? by webhat · · Score: 2, Interesting

    If a company has a test that looks for a certain DNA sequence which I have, is my body then considered prior art?

    --
    'I am become Shiva, destroyer of worlds'
  80. Agreed; I just declined to get one by Anonymous Coward · · Score: 1, Interesting

    A few months ago, I invented a very clever little circuit. It solves a whole lot of problems with non-ideal component behaviour at the cost of one extra resistor than the more usual and obvious circuits.

    I had researched my problem extensively before coming up with that solution, and in hindsight, I was pretty amazed that nobody had written it up before.

    Then it dawned on me... useful, novel, non-obvious... patentable!

    But... I'm not planning on working here 20 years hence. And I might like to use my little circuit again. It would be really annoying, the next time I have a similar problem, to have to invent yet ANOTHER way to solve it when I already KNOW a good solution.

    That, and it's so simple that I suspect it has been invented before and just somehow never made it into the resources I researched.

    So I'm keeping my mouth shut on the issue until the opportunity to file patents expires.

  81. Put the Lime in the Coconut by rssrss · · Score: 2, Interesting

    Put the Lime in the Coconut

    From the Scientific American web site: an article describing the following patent:

    Method of Treating Chest Pain, Patent 6,457,474, Carl E. Hanson of St. Paul, Minn. This inventor has patented lime juice to replace nitroglycerin as a treatment for chest pain such as angina pectoris. Making the patented invention requires only modest skill. "Limeade in non-concentrated form," according to the document, "was prepared by opening a can of the Minute Maid brand Premium All Natural Frozen Concentrate for Limeade, removing the contents and placing it in a pitcher, adding approximately 52 fluid ounces (about 4.5 cans) of tap water to the frozen concentrate and stirring.

    "The pitcher was placed in the refrigerator so that the contents would cool. I drank approximately 2 to 3 glasses of limeade daily and did not notice the reoccurrence of chest pain." The lime juice can also be administered intravenously or by the angina sufferer's placing the frozen concentrate directly into his or her mouth. "The present invention is advantageous in that a patient can easily determine if the medicine is properly ingested. Lime juice has a very noticeable taste that disappears after it leaves the mouth. Since the juice is regularly stored in the refrigerator or freezer, it can be quickly located by the patient, particularly at nighttime where the refrigerator light plays a helpful role."

    Scientific American was not kidding. You could look it up. The patent was issued on October 1, 2002.

    The gales of laughter must have reached the Patent Office, because the Director ordered the patent to be re-examined, which I assume means that it will be revoked. It is now apparent that you can file a patent on a ham sandwich and the Patent Office will issue it.

    --
    In the land of the blind, the one-eyed man is king.
  82. Your DNA by Cipher9 · · Score: 1

    You seem to be using a DNA code which was pattented by me.
    Please pay me $1.000.000 for a license, or stop using that code :o)

  83. Re:Bitter Protest against Patents (n copyrights so by don_oles · · Score: 1

    Very good. But let's dig further. Theere's no such a thing as "right". There is a "possibility" and "ablity", and "agreement". The "right" is just a way to know you will not be punished by the stronger one (goverment or master of slaves) for doing something. And today all goes as centuries ago: the stronger, richer ones make money and use them to make the lawys that allow them to make money.

    And don't forget what the Crishna said: you have never been the only cause of what you have done.

  84. Re:There really isn't a justification for Software by pavon · · Score: 1

    There was another motivation in creating patents. In lue of patents companies which did research would treat their findings as trade secrets and would never share the results. So patents are a trade-off - you provide the scientific comunity with the results of your work and in return you get a legal monopoly to its comercial applications. The implication being that while the market may be held back by patents science should be able to progress. This isn't exactly the case in our current system, because by and large scientists are also employees.