Human Gene Count Slashed

← Back to Stories (view on slashdot.org)

Posted by samzenpus on Wednesday October 20, 2004 @03:39PM from the half-the-human-I-used-to-be dept.

jd writes "The estimate for the number of genes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genes at around 44,000 - or even as high as 100,000. Eric Lander of the Broad Institute in Cambridge, Massachusetts is quoted in the CNN story as saying that the number of genes isn't as crucial as how they are used." Read on for more, below.

jd continues: "This has the potential for making life extremely interesting for genetic engineers, given that both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out. Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code.

There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer, although if you now factor in the increased complexity of interactions, it is possible that such side-effects can be better understood and therefore prevented. The new estimates, therefore, are more than just idle curiosity but have the potential for impacting how the science is approached."

9 of 504 comments (clear)

Ah by Anonymous Coward · 2004-10-20 15:40 · Score: 5, Funny

Finally scientific proof that it's not the size that matters, it's how you use it.
enough... by micronix1 · 2004-10-20 15:45 · Score: 5, Funny

25,000 genes will be enough for everyone. - 2004
great, we've been demoted by nomadic · 2004-10-20 15:46 · Score: 4, Funny

The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family.

Damn elitist mustard, looking down on us.
1. Re:great, we've been demoted by sik0fewl · 2004-10-20 16:02 · Score: 5, Funny
  
  I, for one, welcome our new Arabidopsis overlords.
  
  --
  I remember when legal used to mean lawful, now it means some kind of loophole. - Leo Kessler
Great, more downsizing... by DLR · 2004-10-20 15:48 · Score: 5, Funny

Where'd they off-shore the genes to?

--
"Like fire and fusion, government is a dangerous servant and a terrible master."~RAH
Frightening headline by Pan+T.+Hose · 2004-10-20 16:28 · Score: 4, Funny

I've read the headline as "Human Genome Slashdotted" and I shouted: "Dear God, we're doomed!" My God, what an embarrassment... I need sleep.

--
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
Spoiler alert by vandelais · 2004-10-20 17:06 · Score: 4, Funny

gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac

--
Game: Player 'Donald J Trump' now has AI skill level 'experimental'.
1. Re:Spoiler alert by servognome · 2004-10-20 19:02 · Score: 4, Funny
  
  It's a gene sequence?
  I thought it was one of those pictures that if you stare at it right turns 3D... stupid waste of 4 hours!
  
  --
  D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
2. Re:Spoiler alert by addaon · 2004-10-20 19:14 · Score: 5, Funny
  
  He only posted a few lines of it, but it reproduced.
  
  --
  
  I've had this sig for three days.