Slashdot Mirror


Human Gene Count Slashed

jd writes "The estimate for the number of genes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genes at around 44,000 - or even as high as 100,000. Eric Lander of the Broad Institute in Cambridge, Massachusetts is quoted in the CNN story as saying that the number of genes isn't as crucial as how they are used." Read on for more, below.

jd continues: "This has the potential for making life extremely interesting for genetic engineers, given that both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out. Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code.

There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer, although if you now factor in the increased complexity of interactions, it is possible that such side-effects can be better understood and therefore prevented. The new estimates, therefore, are more than just idle curiosity but have the potential for impacting how the science is approached."

14 of 504 comments (clear)

  1. Re:Death of Creationist Theory? by dsanfte · · Score: 2, Insightful

    These people really don't matter. You really need to stop lending credence to their bullshit by entertaining it.

    --
    occultae nullus est respectus musicae - originally a Greek proverb
  2. People vs. Flowers by k98sven · · Score: 3, Insightful

    The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genomes at around 44,000 - or even as high as 100,000.

    AFAIK, there's a lot more research going into the human genome than into the Arabidopsis one. So one would naturally presume that the number of human genes would be known better.

    But if the estimate for the number of human genes is subject to so much variation, how can you be so sure of that for the Arabidopsis?

    Is this a meaningful comparison?

    (Not to mention that the entire premise seems to be flawed..)

  3. You know... by nwbvt · · Score: 2, Insightful
    I find it hard to take a site which claims to be scientifically literate seriously when they post an article which not once, but four times (including in the title) confuse the term 'gene' with 'genome'. Even my grandmother could probably tell the two apart. Come on guys, ever heard of the Human "Genome" Project? They were not mapping just one gene.

    How long before someone blames this on Bill Gates or George Bush?

    --
    Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
  4. Re:Death of Creationist Theory? by Anonymous Coward · · Score: 3, Insightful

    Science requires objectivity and dismissing ideas because they are offensive to your tastes is a bias. While intelligent design may not be probable, there is still a minute possibility that it could have occured. This needs to be investigated like anything else. Since it is unlikely, the priority should not be high, but the results should not be dismissed based on your political or theological views (and the results shouldn't be amplified for the same either).

  5. Programmers already know it by Magickcat · · Score: 2, Insightful

    Any good software programmer knows that good design and elegance beats bloat every time.

    --

    Si tacuisses philosophus mansisses. If you had kept quiet, you would have remained a philosopher.

  6. Woah by timothv · · Score: 2, Insightful

    Woah! More than one paragraph? Will Slashdot get rid of italics too, and start having quality articles?

  7. gene therapy and cancer by jeif1k · · Score: 2, Insightful

    There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,

    Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.

    although if you now factor in the increased complexity of interactions, it is possible that such side-efects can be better understood and therefore prevented.

    Anything is possible, I suppose. But common ways in which gene therapy could cause cancer are already understood. Doubtlessly, there are many more possibilities, but to identify them requires a specific understanding of those "interactions", something that is being worked on anyway.

  8. Gene Therapy by Camel+Pilot · · Score: 5, Insightful
    Why are we not directing our massive GNP towards scientific exploration such as studying genetic therapies to cure the rift raft of ailiments that curse mankind instead of fighting petty wars against a minor enemy "aka terrorist".

    Let look at that stats:

    Terrorist kill ~ 3000 people in 2001 and it becomes a focus of the US nation. While:

    Breast cancer kills > 40,000 / year

    Prostate cancer kills > 30,000 / year

    Diabetes kills > 70,000 / year

    The numbers world wide of course are much larger.

    Yeah OT I know but these kind of discoveries convince me our priorities are misplaced.

    1. Re:Gene Therapy by blahplusplus · · Score: 2, Insightful

      Because medicine is not that profitable, in fact you can waste your life savings just trying to stay alive. My parents shell out an ungodly amount of money for medications for their conditions every month I wonder how they even manage to pay the bills, my mother has $300+ worth of medication just for herself, my dad has even more then that. Just look at the people who pay through the nose for drugs, they can't all afford the R&D costs under a capitalistic system. So that means people get left out but *everyone* (at least in canada) wants everyone to be able to afford health care. Just look at the drug importing from Canada to the US right now.

  9. Re:Complexity for smaller? by Nutty_Irishman · · Score: 4, Insightful

    On the contrary, the complexity now increases. There are many genes that act in completely differen't roles depending on the cell type (nerve, epidermal, etc.). So a common language changes from cell type to cell type-- if one would even call it a common language. There is a large part of Bioinformatics/Computational Biology that deals with trying to determine interaction networks between genes. It's very complex, and difficult to deal with.

    With less genes we then expect to have a larger amount of downstream interactions between other genes. It might seem that with less genes then we have less to worry about, but we have already speculated for a long time that gene regulatory networks are complex.

    To use an analogy (for all you computer geeks), it's like a programmer trying to read poorly modularized code. When you have no idea what class is doing what, and how they interact with other classes (as every class has multiple roles and talks to multiple other classes) then it is difficult to understand why the program behaves the way it does. If the program had many classes that were well modularized and designed with very distinct roles, then it would be easier to understand why things work the way they do.

    With less genes and increased complexity we have an even more difficult task. It also highlights some of the reasons on why microarray analysis has not done what we expected it to do. Increasing the complexity and dependency between genes means that we probably are going to take a longer time understanding and extrapolating information from all these networks (which means more job security for me :) ).

  10. Re:Death of Creationist Theory? by jnana · · Score: 2, Insightful
    I hope you're not trying to imply that every ignored dumbshit is destined for victory.

    I don't think so. The creationists in 50 years will seem like the flat-earthers do today and witch-hunters did 50 years ago.

    Yes, there are still some flat-earthers, just as there will still be creationists in 50 years. What can I say? To misappropriate a Buddhist aphorism, where there are humans you'll find Einsteins and shit--generally a lot more shit, but there you have it.

  11. Re:Spoiler alert by larley · · Score: 2, Insightful
    Out of curiosity, where did you get this sequence from? I can see that it involved a few copy/pastes of
    atacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac
    but did you pull it from somewhere, or was it just made up? I know it's not in the Arabidopsis genome (http://www.arabidopsis.org/Blast/)
  12. Re:Death of Creationist Theory? by cruachan · · Score: 2, Insightful

    Actually it was the other way around and evolutionists won from a position in the 19th C where everyone was creationist.

    What you see now is simply the final skirmishes mopping up the resistance in intellectually backward groups like american right-wing fundies

  13. Re:Complexity for smaller? by angel'o'sphere · · Score: 2, Insightful


    On the contrary, the complexity now increases.

    I could not resist :D

    No the complexity does not increase. Its like it ever waas. We only know now, that it is not that simple as we allways thought.

    Some monthes ago, we thought it was simple. We realized things did not really work that good (gen therapy etc.) and wondered why. Now we know: oops, its not simple! And now we can look how to tackle the complexity.

    angel'o'sphere

    --
    Cost free eBook I read (by iBook/Kobo/Amazon/ObookO/Gutenberg etc.): "The Green Odyssey" by Philip Jose Farmer.