Slashdot Mirror
Human Gene Count Slashed
jd continues: "This has the potential for making life extremely interesting for genetic engineers, given that both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out. Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code.
There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer, although if you now factor in the increased complexity of interactions, it is possible that such side-effects can be better understood and therefore prevented. The new estimates, therefore, are more than just idle curiosity but have the potential for impacting how the science is approached."
Finally scientific proof that it's not the size that matters, it's how you use it.
That would be incorrect. The number of genomes in the human genome is 1.
Brandon
It is the number of genes that has been revised down. The genome is the complete set of DNA and contains all the genes.
Does this level of complexity shrink a little as well as grow a little due to less genomes being in existence? I think while the interactions are common maybe when that common "language" is found then it will make things easier.
The iPod Lite Project taking orders soon.
The article poster mistook 'Genome' for 'Gene'. Organisms only have one genome as it is a collection of genes.
Go to the back of the class!
25,000 genes will be enough for everyone. - 2004
The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family.
Damn elitist mustard, looking down on us.
In late breaking news, the final count of genomes in a typical human being has been found to be exactly 1. See http://en.wikipedia.org/wiki/Genome for details.
These people really don't matter. You really need to stop lending credence to their bullshit by entertaining it.
occultae nullus est respectus musicae - originally a Greek proverb
Where'd they off-shore the genes to?
"Like fire and fusion, government is a dangerous servant and a terrible master."~RAH
The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genomes at around 44,000 - or even as high as 100,000.
AFAIK, there's a lot more research going into the human genome than into the Arabidopsis one. So one would naturally presume that the number of human genes would be known better.
But if the estimate for the number of human genes is subject to so much variation, how can you be so sure of that for the Arabidopsis?
Is this a meaningful comparison?
(Not to mention that the entire premise seems to be flawed..)
According to scientists, we gained 1000 genes compared to rodents when we diverged from them 75 millions years ago. And we 'lost' 33 genes compared to them (they have a functional copy, we have a nonfunctional pseudogene; it's still there, only not working - stop codons, etc).
The "we must have more gene than (insert stupid animal or plant here)" is funny. Our superiority complex at its best.
Read about the whole thing (with more links) on my blog (see sig)
Eureka Science News - automatically updated
How long before someone blames this on Bill Gates or George Bush?
Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
Oh wait .. just read the post.
... hehe.
Damn newbies
Funtage Factor: Purple
This items made me recall a science film we watched when I was in grade 8. It was all about chromosomes.
There was an actor playing a typical I-don't-care-about-no-science-so- long-as-my-tractor-runs-right yokel who, as the 'scientist' (read: guy in a lab coat) noted that the fruit fly has five chromosomes and humans have 23, remarked "well, that's because people are the most advanced creatures on the planet."
The look on his face was priceless when he found out that potatoes have over forty.
- - - -
KickingDragon
I was at a lecture by Evelyn Fox Keller, and she said that there has been a paradigm shift and we're moving from breaking up biology into tiny parts, to seeing the whole picture. Whether theres 100,000 or 20,000 genomes seems rather trivial.
Would not reducing the number of genes from 100,000 down to 25,000 reduce the number of possible interactions from (100,000!/2) to (25,000!/2)? Thats a factor of a number that has 357480 digits!
savagely revised
What, did they revise the number with a chainsaw?
Science requires objectivity and dismissing ideas because they are offensive to your tastes is a bias. While intelligent design may not be probable, there is still a minute possibility that it could have occured. This needs to be investigated like anything else. Since it is unlikely, the priority should not be high, but the results should not be dismissed based on your political or theological views (and the results shouldn't be amplified for the same either).
Any good software programmer knows that good design and elegance beats bloat every time.
Si tacuisses philosophus mansisses. If you had kept quiet, you would have remained a philosopher.
Woah! More than one paragraph? Will Slashdot get rid of italics too, and start having quality articles?
to how many genomes are in a single human genome. However, speaking about genes in a genome, as the article states, this "correction" only counts those genes that make some discernable protein product. The number misses the number of open reading frames (ORF) that may not encode a protein at all, but a regulatory or enzymatic RNA. Probably, the next big project in life/medical research, after the big proteomics initiatives, will be the study of non-protein encoding ORFs. This problem is very tough to crack since 1) these RNA's do not have a common sequence element like "normal" messenger RNAs, 2) may be as short as 15 base pair (LIN12(?) in C. elegans), and 3) there are MANY, MANY possible ORFs in the genome.
Are these technically genes? They are regulated. They have a function. They are transcribed. The only thing different from the standard definition of a gene is that the RNA is not translated into protein.
In addition to multiple protein products from one "gene" as the article states, regulation of the gene may also be much more complex compared to "lower" organism. For example, the gene expression profile of the malarial parasite Plasmodium falciparum suggests very limited regulation. Basically, it looks like a linear progression with very limit amount of response. So, temporal and spatial regulation makes even multiple product genes seem to like a larger cohort of genes. Take the daughterless gene in Drosophila. It is used very early in embryonic development to control sexual differentiation. However, later, the gene product is used in neuronal differentiation. So, for the fly, sex is literally on the brain.
There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,
Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.
although if you now factor in the increased complexity of interactions, it is possible that such side-efects can be better understood and therefore prevented.
Anything is possible, I suppose. But common ways in which gene therapy could cause cancer are already understood. Doubtlessly, there are many more possibilities, but to identify them requires a specific understanding of those "interactions", something that is being worked on anyway.
Only one? Ahem: Mitochondrial genome; Nuclear genome.
:)
As a mitochondrial researcher, I resent the most important organelle of the cell being overlooked or lumped in together with the nucleus here!
So I would say two genomes
PBS has excellent videos from the program Cracking the Code of Life of the teams (Human Genome Project and private company Celera) that worked on decoding the entire 3 billion sequences of the human genome. It is very worth watching to understand this article.
Let look at that stats:
Terrorist kill ~ 3000 people in 2001 and it becomes a focus of the US nation. While:
Breast cancer kills > 40,000 / year
Prostate cancer kills > 30,000 / year
Diabetes kills > 70,000 / year
The numbers world wide of course are much larger.
Yeah OT I know but these kind of discoveries convince me our priorities are misplaced.
I've read the headline as "Human Genome Slashdotted" and I shouted: "Dear God, we're doomed!" My God, what an embarrassment... I need sleep.
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
The shift from 100,000 to 20,000 predicted genes is important because it signals a fundamental change in the way genomics are viewed. Scientists have to consider non-obvious explanations for genetic phenomenon. Why do we have a small number of genes, but a high level of complexity?
The genome is ~2% gene, the rest is largely unknown. Traditionally, this has been referred to as junk DNA, good for spacing, but not much else. Growing consensus believes there is more to these regions, and efforts are underway to explain them. One of the more significant points to consider is the amount of RNA made which never codes for protiens. Biology generally does away with useless actions, but non coding RNA is rampant.
The number of genes influences how hard scientists look at other explanations for phenomenon.
My favorite theory was that it was both evolution and intelligent design. Consider an anthill. Each ant is as dumb as a rock. But in a social structure the ant colony is incredibly intelligent (gathers food, fights off foes, goes to war). I see no reason that the horde of organisms on earth couldn't have created a superintelligent collective that we don't see because we aren't looking for it. In this way, evolution occured because it was the will of the collective.
Wow, my hat's off to you sir. That's the easiest 5, Informative I've ever seen someone pull off on this Internet or any of the Internets for that matter.
If there are less genes than we thought, the little buggers must be executing their comments.
http://pcblues.com - Digits and Wood
An often unknown fact is that a single gene can code for thousands of different proteins. Protein regulation can occur in a variety of way, one of which is through "junk" DNA.
Currently little is known on the exact mechanism, which is a huge impediment to proteomics. As the phenomenon is elucidated, expect to see a lot more useful information coming out of genome projects.
Computationally predicting the 3-D structure and function of a gene is far more important than you probably realize. Reaching this point will revolutionize almost every aspect of your life, from pharmaceuticals, to nutrition, to silico-neural interfaces.
I don't think so. The creationists in 50 years will seem like the flat-earthers do today and witch-hunters did 50 years ago.
Yes, there are still some flat-earthers, just as there will still be creationists in 50 years. What can I say? To misappropriate a Buddhist aphorism, where there are humans you'll find Einsteins and shit--generally a lot more shit, but there you have it.
gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac
Game: Player 'Donald J Trump' now has AI skill level 'experimental'.
I remember reading about a researcher who wanted to study genetic algorithms. I wish I had a link handy, but googling didn't turn it up.
Anyway, this guy wants to create a genetic algorithm that results in a circuit that can detect the difference between two tones, one something like 200 HZ and the other 2 KHZ.
He uses an FPGA chip to do the testing with. After a few weeks, he has an FPGA programmed such that it reliably discerns between the two input signals.
So, how does it work? Downloading the program from the FPGA chip results in a nonsensical circuit - except that it works. Running the same program on another FPGA chip of the same model results in a total failure.
Even changing the power supply makes the circuit not work! Months of study results in a complete, total unknown. Results inconclusive.
The human genome is not built of simple, engineered pieces. Interactions will occur with the total sum of possible interactions, down to the molecular level.
It will be many, many years before our own microbiological structure is understood. As we proceed, we'll see information technology and biology merge, as, when push comes to shove, both consist of the replication of complex patterns.
I have no problem with your religion until you decide it's reason to deprive others of the truth.
Sigh... I just never learn. I know these arguments are completely fruitless in my head, but I can never seem to convince my fingers of that fact... But anyway, as a creationist myself, I would like to comment on this post. Oh, and forgive my crappy spelling, I'm a CS major not an English major ;x
> Call me old-fashioned, but I really despise when "Intelligent Design" proponents pop up in
> threads like this. "See, the number of genes to work with is so much lower than you'd expect,
> so the complexity between each gene is more complex than chance would dictate. Ergo Something
> had to have designed it."
First of all, I would like to point out that this post appears to have been posted in response to a nonexistant argument. I could be wrong, but I don't see anything in the above posts about this "proving" creationism. If I am mistaken, I apologize.
Secondly, no creationist with a brain will say anything similar to "OMG WE'RE SO COMPLEX THIS *PROVES* CREATION HAPPENED HAHAHA PWNED" This is because creationists and most intellegent evolutionists have both accepted one simple fact. As of right now, neither creation nor evolution is provable. Period. I personally believe that neither will ever be provable. I wasn't going to comment on this topic, but if I were to make a statement, I would say "This makes creationism even more -probable-."
> Please. I find that such distrust in the machinations of Nature itself shows us how narrow
> minded these "scientists" are. "I can't understand it, so God must have done it," essentially.
> This does not open the door to further research and understanding. On the contrary it closes the
> door because there is nothing more to be understood beyond "God did it".
I disagree with this. The purpose of science is not to find out how things originated, but it is to understand things. To find out how things can be used or manipulated to better mankind. That's what this whole genome thing is about, am I right? Who gives a crap about how all these genes got to be as complex as they are. The only thing genome researchers are interested in is how these genes can be manipulated to wipe out diseases, prevent birth defects, etc. That's the real goal. Thus, saying "well God must have done it" doesn't mean anything. Whether or not God directly created the human genome has no effect on our mission to actually -understand- them.
> Nature is a truly amazing thing. Evolution, Physics, Gravitation, the Stars, the Cells,
> everything is absolutely beautiful. Why the need to spoil Gaia with your imaginary friend?
I find this most interesting. From the unexplainable gravitational force, to complex celluar structures, to the strict and perfect laws of physics... you see the beauty of it as well. Nature is indeed artistic masterpiece. Even though you view this masterpiece, this "Gaia", as having created itself, you too see nature as the beautiful mural that it is. You're just not willing to call the artist "God".
Eh, close enough =p
I already knew white mice and dolphins were more advanced than us lowly human beings, but now we've been surpassed by a mustard plant!!??? Douglas Adams would've laughed his head off...
Essentially what they're saying is, mouse genomes contain large (millions of bases long) intervals which don't appear to do anything, and that there are no noticeable effects on the mouse if these sections of their genomes are removed. Which begs the BIG question, "What are those sections of the genome actually doing there?"
It is possible that they really do nothing , but such an "explanation" would be even more disturbing than finding that they do something which we don't understand yet.
Someone mentioned Greg Bear's "Darwin's Children" series of books, and I agree that Bear is a good writer. But his explanation of these oddities of genetics is equally unsatisfying too. Nice books though - and Bear does keep his finger on the pulse of the science.
Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"
!00% all safe super growth formu1a.
Garanted! MONEY BACK !
To Unsubcrib click her
jimeejzwgogzgqbjtywwenhbkklwnpkeeleyj
"The estimate for the number of genomes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genomes..."
Only 20,000 to 25,000 genomes? I was sure that the number of genomes in human genetic code was closer to 6,500,000,000.
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
Actually, this is a over-generalisation, as if all Theists were a particular modern brand of obscuratist. Historically, the obvious next question, "So HOW did God do it?", is the reason that science arose in the first place, and arose in Europe rather than elsewhere. The idea of a single, omnipotent mind ordering the universe gave thinkers confidence that it was regular in its behaviour -- even musical as in Platonic thought -- rather than arbitrary. Reading early scientists themselves (esp. Kepler, Galileo, Newton, Pascal) shows this particular influence strongly, though always amongst others.
Compare to
the number of instructions isn't as crucial as how they are used
I think there are many similarities with machine code, and this in fact shows that it IS possible to spend thousands of years optimizing a piece of code.
I wonder what kind of debugger God uses? And if he ever reverse engineered someone elses code.
Actually it was the other way around and evolutionists won from a position in the 19th C where everyone was creationist.
What you see now is simply the final skirmishes mopping up the resistance in intellectually backward groups like american right-wing fundies
C'mon, it's trivial. Those are the comments in the code.
"sweet dreams are made of this..."
Natural selection is not evolution. Natural selection is a reduction in the gene pool, not an extension. Useful genetic modifications are rare and hard to come by, not to mention they don't get passed on well. If you go and kill all white people, and only black people are left, evolution did not occur.
Gene count is a funny thing. Frogs, for example, have a lot of genes to guide their development from egg to tadpole to account for variations in water temperature and chemistry. Mammals gestate in a much more controlled environment (controlled temperature and chemistry), and hence do not need this huge complex of genes.
It's not wasting time, I'm educating myself.
This is definitely a mis-perception, usually based on the fact that most evolutionary descriptions only describe those things that lead up to humans. Plants are, in many cases, more highly evolved than animals are. Even than humans are. They just haven't specialized for intelligence.
It is a mistake to think that supremacy in one area (intelligence) means supremacy in all areas. Some people pride themselves on being efficient workers, others pride themselves on being paid well to do very little. In the biological world, plants would be the "blue pill" type of creature, the type B personalities, and they're REALLY REALLY good at it.
When I was working at Monsanto, I was told that wheat has a genetic strand about three times as long as the human genetic strand. This may or may not have relevance to the rest of the post, but I thought I'd toss it in just because it's interesting.
As another point, the length of the strand doesn't necessarily indicate a more evolved state. It can be assumed that some strands are more efficient than others, and thus don't NEED to be as long. Take Microsoft code, for instance. Just because they take more code to do the job doesn't mean it's a superior product.
Wake up - the future is arriving faster than you think.