Slashdot Mirror


Human Genome Sequencing Completed

Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

13 of 337 comments (clear)

  1. So now. by AltGrendel · · Score: 3, Funny

    Can we start the patent countdown clock?

    --
    The simple truth is that interstellar distances will not fit into the human imagination

    - Douglas Adams

  2. Secret Project Complete by FhnuZoag · · Score: 5, Funny

    Now where's my +1 Talent in every base?

  3. Would've been decoded sooner ... by Anonymous Coward · · Score: 5, Funny

    if God wouldn't have used LISP to encode the darn sequence in the first place

    1. Re:Would've been decoded sooner ... by Fjornir · · Score: 3, Funny
      You thought wrong.
      I was taught assembler
      in my second year of school.
      It's kinda like construction work --
      with a toothpick for a tool.
      So when I made my senior year,
      I threw my code away,
      And learned the way to program
      that I still prefer today.

      Now, some folks on the Internet
      put their faith in C++.
      They swear that it's so powerful,
      it's what God used for us.
      And maybe it lets mortals dredge
      their objects from the C.
      But I think that explains
      why only God can make a tree.

      For God wrote in Lisp code
      When he filled the leaves with green.
      The fractal flowers and recursive roots:
      The most lovely hack I've seen.
      And when I ponder snowflakes,
      never finding two the same,
      I know God likes a language
      with its own four-letter name.

      Now, I've used a SUN under Unix,
      so I've seen what C can hold.
      I've surfed for Perls, found what Fortran's for,
      Got that Java stuff down cold.
      Though the chance that I'd write COBOL code
      is a SNOBOL's chance in Hell.
      And I basically hate hieroglyphs,
      so I won't use APL.

      Now, God must know all these languages,
      and a few I haven't named.
      But the Lord made sure, when each sparrow falls,
      that its flesh will be reclaimed.
      And the Lord could not count grains of sand
      with a 32-bit word.
      Who knows where we would go to
      if Lisp weren't what he preferred?

      And God wrote in Lisp code
      Every creature great and small.
      Don't search the disk drive for man.c,
      When the listing's on the wall.
      And when I watch the lightning burn
      Unbelievers to a crisp,
      I know God had six days to work,
      So he wrote it all in Lisp.

      Yes, God had a deadline.
      So he wrote it all in Lisp.
      All credit to Julia Ecklar -- and (I believe) Heather Alexander who is singing the linked copy.
      --
      I want a new world. I think this one is broken.
  4. I'd like fries with that by gentimjs · · Score: 4, Funny

    I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!

  5. Oblig. by mk_is_here · · Score: 5, Funny

    Scientists: All your base pair are belong to us!

  6. Part of the sequence: by GroeFaZ · · Score: 4, Funny

    ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA

    --
    The grass is always greener on the other side of the light cone.
    1. Re:Part of the sequence: by ggvaidya · · Score: 4, Funny

      ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT

  7. Re:First Chromosome by PyrotekNX · · Score: 5, Funny

    I always wondered where the movie GATTACA got it's title.

  8. and then there was a two...! by Anonymous Coward · · Score: 4, Funny

    gtcatgcgatacgtaggcaaatcg2tgacggcagt

    hmmm i guess its not as funny unless its binary

  9. Comment removed by account_deleted · · Score: 5, Funny

    Comment removed based on user account deletion

  10. Re:First Chromosome by tomhudson · · Score: 4, Funny

    Well, now that they've sequenced the Genome, can sequencing the KeDE be far behind?

  11. Re:Because it evolved by fyngyrz · · Score: 5, Funny
    Nonsense. We'd design it to have 32 bits to index the chromesomes, 32 bits to index the genes in each chromesome, and an alternate set of registers so you could quickly swap chromesomes for different tasks. You could clock it at any speed, or leave it static, and it'd never lose data. It'd be radiation hardened, low-power, erasable by ultraviolet, reprogramable by anything from dip switches to GHz pulse trains, internally and externally redundant, solar-powered, ecologically friendly, and involve a great deal of caffiene. Primary developmental needs would be met by carefully metered infusions of pizza.

    However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.

    Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.

    All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.

    Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.

    For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.

    At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.

    In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.

    --
    I've fallen off your lawn, and I can't get up.