Slashdot Mirror
Breakthrough In Human Genetics
Many readers have submitted this story about a breakthrough in our understanding of human DNA: in particular, how much variation can exist between peoples' genes and how genes are involved with certain diseases. "One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically.
They said their new version of the human genetic map, or 'book of life,' fills in many missing pages and chapters to explain how genes are involved in common diseases.
The Human Genome Project mapped the billions of letters that make up the human genetic code. Scientists later refined the map by looking for single variations called SNPs or single nucleotide polymorphisms.
The CNV map gives researchers a different way to look for genes linked to diseases by identifying gains, losses, and alterations in the genome."
One person's genetic code can be 10% different from another's, and chimps are 98% the same as humans.
No wonder so many of you can't spell.
No, no, no, no, no... this is all just a misunderstanding of scientifical facts. You see, it's only the darker folks, whom we are 10% different from, that are 2% different from monkeys. The world was made this way intentionally, presumably by some Great, Omnipotent Designer... whatever you want to call him. I know this to be true because I learned it in a museum. In Kentucky. It was right next to the exhibit with humans and dinosaurs living together.
Honestly folks, get it together already.
All that without stem cells?!
shocker.
My brother is explained...
"Everyone on the earth is unique, ..."
except this one guy
Physics is like sex: sure, it may give some practical results, but that's not why we do it.
1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created
monkeys and humans 98% the same, and this new genetic analysis indicates human up to 10% different, or, only 90% the same
therefore, 98%-90% = 8% difference in monkey versus human random shakespeare manuscript creation
8% of 1 million is 8,000
therefore, 8,000 more monkeys than humans are required to produce one shakespeare manuscript
it's a scientific fact folks
(as well as all other "facts" gleaned from this 10% number in the article)
intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
picture someone sticking they hands over their ears and yelling LALALALALA I CANT HEAR YOU, and you will know the religous stance
If you mod me down, I will become more powerful than you can imagine....
There are even scarier truths in science. Imagine this:
100% of the atoms making us up are DIFFERENT. No two person has the exact SAME atoms!!
Oh please say it ain't true! Say it ain't true! Now I will have to meditate for half an hour in my religious beliefs just to be able to breath again!
It takes a man to suffer ignorance and smile
Be yourself no matter what they say
We already found him. And we elected him President!
Right, because when I want the latest news on evolutionary biology, the first place I go and look for it is a creationist spew site. Just like how I get my facts on the safety of nuclear power from greenpeace, and my intimate knowledge of global warming from exxon-mobile.
Please, lets try and keep the lunatic fringe off slashdot.
OK, according to the Chromosome FAQs:e /posters/chromosome/faqs.shtml
http://www.ornl.gov/sci/techresources/Human_Genom
The X chromosome comprises ~5% of the genome while the Y chromosome is ~1%. Since women are XX and men are XY, men and women differ by ~6%.
If chimps are only 2% different from men, then men are more closely related to chimps than women. QED
gtagcgtagatagctctagctagcttaggagcttagaggcgcttagatcg cgatcga
> And we elected him President!
Elected?
how the hell is this a troll?
moderator dislikes poster?
Example of a 10% different human.
Beware: In C++, your friends can see your privates!
I would argue that for many people 70% of the brain is air.
Yes, I'm left. You have a problem with that?
I'm not religious, but let me try: Adam was created by God using mud from a river bank. The materials available in common earth are not different from the ones found in a human body.
All the matter in the Universe was concentrated in one single place and time, then it exploded and eventually became all the stars, planets and creatures we know today. God is everywhere and we all are part of God.
Simple creatures evolve to become complex creatures. If we have a really close look, the basic components and the instructions (DNA) are similar across species. The best mutations survive, the others fail and do not carry on in the gene pool. God is perfect, Nature is perfect.
Unfortunatally it seems to be just the kind of humans you wouldn't want running around the place that are having lots of children nowadays.
thank God the internet isn't a human right.
Well, anecdotally, I have observed that a lot of stupid and ugly people are having children. I don't meant his flippantly, I mean it literally.
I think the grand-parent has a very good point -- the people who are producing children are not being selected based on attractiveness, or ability to earn an income, or any form of "breeding of the fittest", they are being selected on their willingness to put out. I know in my high school, the biggest idiots were the ones having children. Repeatedly usually. Sometimes, they were helping to perpetuate a cycle of poverty of kids being born to poor, uneducated people, and having very few opportunities in life.
Modern society insulates people from any of the good parts of natural selection. Between welfare footing the bill for the kid, or irresponsible people who go around serially knocking up everyone they come across (no pun intended
I would argue that your point of "sexually preferred" people is more like "sexually available" -- they're not the most attractive or desireable people, they are whoever is handy. There's just way too many people peeing in the gene pool.
Cheers
Lost at C:>. Found at C.