Slashdot Mirror


Astronomers Announce 5-Planet System

An anonymous reader writes "Astronomers have detected a record-breaking 5th planet orbiting the star 55 Cancri, 41 light years distant. This planet orbits within the 'habitable zone,' where water could presumably exist, but it's probably another gas giant like Saturn, so any liquid water would have to be on a moon. There's still a big gap between this planet and the outermost planet where no planets have been detected yet, so there could yet be a rocky planet in the system. The lead researcher said he's optimistic that 'continued observations will reveal a rocky planet within five years.'"

115 of 145 comments (clear)

  1. MORE cuts!?!? by Nerdposeur · · Score: 5, Funny

    When I first saw this headline, I gasped. They already eliminated Pluto - what ELSE could they disqualify!?

    1. Re:MORE cuts!?!? by Anonymous Coward · · Score: 3, Funny

      When I first saw this headline, I gasped. They already eliminated Pluto - what ELSE could they disqualify!? Well it turns out that Neptune was just a smudge on the lens, Mercury was just a big piece of garbage and Jupiter was just Rosie O'Donnell's long-lost sister.
    2. Re:MORE cuts!?!? by geekoid · · Score: 1

      Anything that can't support life is a rock, oceball or gas giant. Not worthy of the title 'planet'

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
    3. Re:MORE cuts!?!? by stoolpigeon · · Score: 1

      I was going to be very impressed, but you didn't link to Quark.

      --
      It's hard to believe that's how Micronians are made. Why don't we see it right now by having you both kiss one another?
    4. Re:MORE cuts!?!? by e2d2 · · Score: 1

      Look, I'm gonna be frank, Those fat ass outer planets haven't been pulling their own weight. Our solar budget just didn't live up to expectations and we're looking at trimming... We've brought in some outside consultants to help us identify where we can slim down. This is for the better.

    5. Re:MORE cuts!?!? by lostguru · · Score: 1

      probably have to keep uranus for all the dumb jokes

      --
      Jayne: "These are stone killers, little man. They ain't cuddly like me."
      98% of America's teens drink alcohol, smok
    6. Re:MORE cuts!?!? by Scarletdown · · Score: 1

      probably have to keep uranus for all the dumb jokes


      Of course, all those jokes will finally be put to rest come 2620 when scientists agree to finally rename Uranus.

      --
      This space unintentionally left blank.
    7. Re:MORE cuts!?!? by Wabbit+Wabbit · · Score: 1

      Look, I'm gonna be frank, Those fat ass outer planets haven't been pulling their own weight.


      Haven't they, though? I'm no scientist (no, really) but doesn't their larger size have some kind of gravitational effect on other planets which helps keep them in proper orbit (or somesuch?)

      Someone help me out here?
      --
      Nothing is inexplicable; only unexplained -Tom Baker, Doctor Who
    8. Re:MORE cuts!?!? by Cecil · · Score: 1

      Except we have no idea what the requirements for supporting life are, really. Even "life as we know it" is becoming broader and broader every day. Maybe one day we'll be able to conclusively say "carbon-based DNA-based mitochondrial cellular life cannot exist in this environment because (x)" but we're a very, very long way from even there right now.

    9. Re:MORE cuts!?!? by afaik_ianal · · Score: 1

      There was a pretty interesting article in New Scientist in June that discussed the potential for "other" forms of life, and considered the environment that commonly proposed life bases would require: http://space.newscientist.com/article/mg19426071.200-life--but-not-as-we-know-it.html (subscription required)

      Non-carbon-based life has some pretty difficult-to-overcome hurdles.

    10. Re:MORE cuts!?!? by DiscipleN2k · · Score: 1

      I don't know. I think it's more of a "we always knew there had to be one out there and it's about damn time we found it" kind of thing.

    11. Re:MORE cuts!?!? by Cecil · · Score: 2, Interesting

      I've read that article, it's good, but it is still "life not quite as we know it" rather than "life nothing like what we know". As a counterexample, what about an AI? An AI has basically no requirements as far as chemistry are concerned. While it's laughably implausible to imagine an electronic AI "evolving" out of nothingness the way biological organisms did it's still -- by my definition -- "life" and there's no reason we couldn't find it "living" on any planet on our solar system or indeed any we've discovered so far. I find it hard to believe that these are the only two types of life that are physically possible, so I imagine that there may yet be some interesting things to discover out there.

    12. Re:MORE cuts!?!? by qmaqdk · · Score: 2, Interesting

      "...is in orbit around the Sun..."? Then technically, what they found is not a planet.

      --
      My UID is prime. Hah!
    13. Re:MORE cuts!?!? by stjobe · · Score: 1

      (subscription required)

      Gee, thanks for linking to that interesting article I HAVE NO WAY OF READING.
      --
      "Total destruction the only solution" - Bob Marley
    14. Re:MORE cuts!?!? by e2d2 · · Score: 1

      Trouble maker! :D

    15. Re:MORE cuts!?!? by YttriumOxide · · Score: 1

      Actually, I've always disliked the "gas giant" terminology for planets. I prefer to think of them as planets that have much thicker and larger atmospheres than some others.

      Jupiter, just as an example, (probably) has a "core" of rock. I think of this "core" as the planet itself, and everything outside of that core to be the atmosphere.

      --
      My book about LSD and Self-Discovery
      Also on facebook as: DroppingAcidDaleBewan
    16. Re:MORE cuts!?!? by pclminion · · Score: 1

      As a counterexample, what about an AI? An AI has basically no requirements as far as chemistry are concerned. While it's laughably implausible to imagine an electronic AI "evolving" out of nothingness the way biological organisms did it's still -- by my definition -- "life"

      I find it hard to imagine how a person could NOT call that life. Why are you calling it "AI?" What's so artificial about an electronic life form which evolved on its own? I don't find the idea implausible at all, at least, no more implausible than "biological" life evolving. Since "biological" really means "of life," I would in fact call such an organism biological. Different from us, but still a living, biological thing.

    17. Re:MORE cuts!?!? by gstoddart · · Score: 1

      I've read that article, it's good, but it is still "life not quite as we know it" rather than "life nothing like what we know".

      You make a valid point, to an extent.

      See, the reasons why scientists look for life as we know it is because we don't have the slightest clue as to how to look for life that is nothing like we know.

      Looking for something you can conceive of is difficult enough on an astronomical scale. Looking for the inconceivable is ... damned hard!! At that point, every object you look at in the sky might have some form of life you know nothing about nor how to identify. But, it doesn't help you narrow down your search in any meaningful way.

      If we could go those distance, we might find all sorts of stuff. But, I'm afraid most of that falls into the purely hypothetical category.

      Cheers
      --
      Lost at C:>. Found at C.
    18. Re:MORE cuts!?!? by Cecil · · Score: 1

      The problem is electronic intelligence doesn't have the same innate growth characteristics that cellular life does. Even the simplest collection of organic molecules has a unique built-in ability to grow and reproduce. For an electronic intelligence to have the same capabilities to grow and reproduce, in my estimation, requires a much higher level of development. And that much higher level of development is correspondingly difficult to occur by pure chance.

      Note though, that I didn't say it was impossible, only laughably implausible. If an electronic organism is not able to spread and grow and evolve until it reaches a fairly high level of sophistication, then it can't rely on evolution to achieve that high level of sophistication, it has to rely on something else. The only other alternatives I can see are artificial development (by another species) or by sheer chance, which as I said I consider to be highly unlikely.

      Of course, I could be very wrong (I really hope I am, that would be exciting) I just think that electronic intelligence, unless it's developed by some mechanism that we haven't yet conceived of, is most likely to be something created by other intelligences, specifically us.

    19. Re:MORE cuts!?!? by CorSci81 · · Score: 1

      Actually, likely not. Jupiter is massive enough the center is likely made of metallic hydrogen and there may not be any clearly identifiable "surface" (i.e. sharp density jump) given most of the planet is made of the stuff and it's still convecting. Contrast this to Uranus or Neptune which very likely do have a rocky core surrounded by a very thick atmosphere, given their relatively low masses. And then there's Saturn which may be somewhere in the middle.

    20. Re:MORE cuts!?!? by afaik_ianal · · Score: 1

      Learn to use a fucking library, moron.

    21. Re:MORE cuts!?!? by aminorex · · Score: 1

      When I read "reveal a rocky planet", was I the only one who imagined a population of Sylvester Stallone clones bumping into each other and saying, "yo, Adrian" ?

      --
      -I like my women like I like my tea: green-
  2. More news by Skiron · · Score: 4, Funny

    "The lead researcher said he's optimistic that 'continued observations will reveal a rocky planet within five years.'" Sylvester Stallone commented on this breaking news; "Eh?"

    1. Re:More news by kaizokuace · · Score: 1

      SPACE ADRIAAAAANN!!!!

      --
      Balderdash!
  3. What record? by teh+moges · · Score: 2, Funny

    Our solar system has more then that...

    1. Re:What Record? by evwah · · Score: 3, Insightful

      assuming systems with more than said number of planets are common, or even exist (other than ours). scientists take nothing for granted. well they aren't supposed to anyway. that makes this newsworthy.

    2. Re:What record? by Klaus_1250 · · Score: 1
      RTFA. It is in the first paragraph.

      Astronomers have discovered a record-breaking fifth planet around the nearby star 55 Cancri, making it the only star aside from the sun known to have five planets. Still a bit awkward though to use a headline like that. I'm pretty sure that statistically speaking, there are at least millions of stars with five or more planets around them.
      --
      It only takes one man to change the Wisdom of the Crowd to Tyranny of the Masses.
    3. Re:What Record? by meringuoid · · Score: 5, Insightful
      That shouldn't be too hard considering we're probably missing over half of the extrasolar planets with our current detection threshold.

      To a very, very close approximation, we're missing all the extrasolar planets. We've yet to discover a single one outside our own Galaxy :-)

      --
      Real Daleks don't climb stairs - they level the building.
    4. Re:What Record? by evwah · · Score: 2, Informative

      population of the universe: none

    5. Re:What Record? by Jarjarthejedi · · Score: 1

      Touche, you out pedanted me very well :P.

      --
      There are two kinds of fool One says 'This is old therefore good' Another says 'This is new therefore better'- Dean Ing
    6. Re:What Record? by someone1234 · · Score: 1

      Besides some detection methods rely on the time a planet goes around its sun, so the further the planet from its sun, the longer the detection takes. Planets like Earth need 3 years of continuous watching, even if their size matches Jupiter.
      So, the sentence would be: every year we detect planets farther and father from their sun, and we just reached the necessary time of finding planets in the habitable zone.

      --
      Patents Drive Free Software as Hurricanes Drive Construction Industry
    7. Re:What Record? by YttriumOxide · · Score: 1

      The record is 5 and you think this record is being broken every year? ...for how many years do you think this has been going on?

      Longer than 5, but it's only really in the last 5 years that lots have been discovered so the grandparent probably is fairly accurate...

      From TFA:

      The second planet discovered in 2002 around the star...
      --
      My book about LSD and Self-Discovery
      Also on facebook as: DroppingAcidDaleBewan
  4. What Record? by Jarjarthejedi · · Score: 2, Insightful

    What Record did this break? The number of planets detected in a single (extrasolar) system record? That shouldn't be too hard considering we're probably missing over half of the extrasolar planets with our current detection threshold. I mean, this is certainly interesting, but by no means surprising. We should be detecting systems with more and more planets every year as we begin to detect smaller and smaller planets.

    --
    There are two kinds of fool One says 'This is old therefore good' Another says 'This is new therefore better'- Dean Ing
  5. more planets to come! by wizardforce · · Score: 5, Interesting

    55 Cancri has produced "a rat's nest of radial velocity data," Fischer said. "We probably still don't have all the planets. We are pulling out one thread at a time, disentangling all these orbits, and it has taken a lot more data and time than we predicted.


    by the sounds of it, the wobble on this thing is just a mess- probably a lot like what our solar system's wobble looks like from the outside.
    --
    Sigs are too short to say anything truly profound so read the above post instead.
    1. Re:more planets to come! by 4D6963 · · Score: 1

      by the sounds of it, the wobble on this thing is just a mess- probably a lot like what our solar system's wobble looks like from the outside.

      The problem, is that the wobble we measure is a lot more messy, as we have relatively poor signal/noise ratios. The wobble isn't even very messy when you look at it in the frequency domain (its spectra), as basically each planet orbiting it represents a single vertical line, provided that their orbit is not too eccentric.

      There was this java program I tried to analyse the "wobble" data of stats in order to find planets, i just don't remember what it's called, however usually the community of people who use that find about planets before the press releases.

      --
      You just got troll'd!
    2. Re:more planets to come! by meringuoid · · Score: 1
      by the sounds of it, the wobble on this thing is just a mess- probably a lot like what our solar system's wobble looks like from the outside.

      Probably worse than ours. The Solar System is dominated by two planets. An astronomer looking back at us from 55 Cancri with the same technology would detect Jupiter, and probably Saturn. If he's patient enough to watch for a couple of orbits, he might just spot Uranus and Neptune too.

      The other planets wouldn't be detectable to our technology. They'd see a system with four planets, not eight. So their five is, in a sense, already ahead of our own system.

      --
      Real Daleks don't climb stairs - they level the building.
    3. Re:more planets to come! by cperciva · · Score: 4, Interesting

      The gas giants are more massive, but also much further away. Saturn is 95x more massive than the Earth, but it's 9.5x further away from the Sun, so its tug on the Sun (mass/distance^2) is only marginally more than the Earth's -- and is less than that of Venus, which is 0.8 Earth masses but only 0.72 AU away from the Sun.

      An astronomer from 55 Cancri would probably detect Jupiter (mass/distance^2 = 11.7 Earths/AU^2), Venus (1.56 Earths/AU^2), Saturn (1.04), Earth (1.00), and possibly Mercury (0.367), while Mars (0.046), Uranus (0.039), and Neptune (0.019) would almost certainly go unnoticed.

    4. Re:more planets to come! by MMatessa · · Score: 4, Informative

      The java program to analyze wobble data is called Systemic and can be found at http://www.oklo.org/.

    5. Re:more planets to come! by MtViewGuy · · Score: 2, Interesting

      I think we will find a lot rocky-crust planets orbiting other stars by 2025 thanks to the Terrestrial Planet Finder space telescope array that will probably be fully operational after 2016. They should concentrate on every star like our Sun within 100 light years of our Solar System in its search.

    6. Re:more planets to come! by 4D6963 · · Score: 1

      Yup. And actually they've had an update related to today's release which is quite relevant.

      --
      You just got troll'd!
    7. Re:more planets to come! by mad_robot · · Score: 1

      An astronomer from 55 Cancri would probably detect Jupiter (mass/distance^2 = 11.7 Earths/AU^2), Venus (1.56 Earths/AU^2), Saturn (1.04), Earth (1.00), and possibly Mercury (0.367), while Mars (0.046), Uranus (0.039), and Neptune (0.019) would almost certainly go unnoticed.

      The astronomer is not measuring gravitational pulls, but variations in the position of the star. These depend on the position of the barycenter (i.e. center of gravity) between the sun and each other planet. The earth weighs so little compared to the sun that the resulting wobble is barely perceptible, whereas Jupiter (much more massive and much further away) has a barycenter that actually lies above the sun's surface and is quite easily detected.

      Wikipedia explains this in a bit more detail.

      --
      U1NCaVpYUWdlVzkxSUhkcGMyZ2dlVzkx SUdoaFpHNG5kQ0JpYjNSb1pYSmxaQT09
    8. Re:more planets to come! by boris111 · · Score: 1
      According to Wikipedia that project was canceled by congress. Shame if it's true.

      Congressional spending limits under House Resolution 20 passed on January 31, 2007, by the United States House of Representatives and February 14 by the U.S. Senate have all but cancelled the program.
  6. Curb your enthusiasm by QuantumG · · Score: 4, Interesting

    Imagine astronomers found a whole lot of earth like planets.
    Imagine they even found one that seemed to have artificial satellites.
    After years of observing and improving our telescopes, imagine we managed to image the planet itself and saw a civilization much like our own.
    Glorious times we live in huh?

    Imagine after much observation we found lots of these civilized neighbors out there in the black.
    Imagine we tried to send them signals and waited the many years for a reply.
    What if none came?
    After hundreds of years of knowing we were not alone we came to the inescapable realization that just communicating with other intelligent beings in our galaxy is so hard and takes so long that it may never be achieved.

    Wormholes and warp drives and ark ships.. what if it is all an unattainable dream?

    Thankfully, I like to dream.

    --
    How we know is more important than what we know.
    1. Re:Curb your enthusiasm by 4D6963 · · Score: 2, Interesting

      Here's exactly the kind of comment I hate whenever we're talking about something dealing more or less with extraterrestrial life, it's how we go from very down-to-Earth claims such as "here's what we know about exoplanets" to "here's what we might find out a few years from now" to "teh extraterrians they wont care about us cause were so inferior omg!". I know extraterrestrial life is an exciting topic, but because they're so little to satisfy ourselves with people are so quick to wildly speculate that they forget that the next important and exciting steps are to find a planet where conditions for life as we know it is there and then to detect biological activity on a planet, and at this stage we're most likely talking about bacterial forms of life and such.

      But you people don't care, you'd rather push your imagination to its limits to the point you'd find it disappointing if we found an alien civilisation but that they wouldn't communicate with us in a satisfactory manner. It's like people only care about what would the alien Britney Spears be like, what would aliens think about us, or what their technology must be like, that kind of stuff.

      --
      You just got troll'd!
    2. Re:Curb your enthusiasm by Loke+the+Dog · · Score: 1

      You obviously don't get it. Who cares about talking to the aliens? The interesting thing is to find out if we are unique or not. Finding lots of earthlike planets but no signs of life would be just as interesting as finding an alien civilization.

    3. Re:Curb your enthusiasm by QuantumG · · Score: 1

      How about because we're generally of the belief that if we *can* detect extraterrestrial life from here on Earth then its likely to be a heck of a lot of life. If all you detect is an oxygen rich atmosphere then that is unlikely to be very conclusive is it?

      --
      How we know is more important than what we know.
    4. Re:Curb your enthusiasm by thealsir · · Score: 1

      And thankfully, I like to be realistic. Who says that these things cannot occur?

      My position is one of neutrality; I believe it's possible, but I need to be shown the money before definitely confirming it as true. But there's just so much us humans are limited to in terms of perspective that I caution from saying something is absolutely or even most likely not possible.

      --
      Do not downmod posts "overrated" simply because you disagree with them.
  7. Ewoks live on a moon by HTH+NE1 · · Score: 2, Funny

    This planet orbits within the 'habitable zone,' where water could presumably exist, but it's probably another gas giant like Saturn, so any liquid water would have to be on a moon. Any chance they plan to name this planet Endor?
    --
    Oh, say does that Star-Spangled Banner entwine / The myrtle of Venus with Bacchus's vine?
  8. Think positively by imsabbel · · Score: 4, Funny

    At least after we send our greeting, it will take 2 or 3 generations for the extermination fleet to arrive....

    --
    HI O WISE PRINCE. WHT TOOK U SO DAM LONG?
    1. Re:Think positively by ashitaka · · Score: 2, Funny

      The current generation always dumps their problems on the following generations.

      --
      If you don't want to repeat the past, stop living in it.
    2. Re:Think positively by Tangent128 · · Score: 1

      There's no reason to assume that technological progress = social progress. Especially since war is one of the stronger drives for technological advancement. (For us, anyway.)

      But yeah, flying light years to another planet just to make war is rather impractical. Even with some sort of hyperdrive- do you want to risk any survivors of an attack, knowing such a device is possible, developing their own and striking back?

      Don't count out ego, though- I wouldn't place aliens above empire-building for empire's sake.

    3. Re:Think positively by uniquename72 · · Score: 1, Funny

      Not if we send our greeting in the form of an extermination fleet.

    4. Re:Think positively by heinousjay · · Score: 1

      There's no reason to assume that what a piece of humanity considers social progress would have any resonance with an alien intelligence. There's no reason to assume anything about humanity would bear any similarity.

      --
      Slashdot - where whining about luck is the new way to make the world you want.
    5. Re:Think positively by edittard · · Score: 1

      But yeah, flying light years to another planet just to make war is rather impractical.
      Depends how much oil they've got.
      --
      At the bottom of the /. main page it says 'Yesterday's News'. Well they got that right.
    6. Re:Think positively by PMBjornerud · · Score: 1

      There's no reason to assume that technological progress = social progress. However, we can safely assume that time ~= technological progress.

      Alien life forms would certainly be millions of years either more or less developed than us. Probably billions. How much has human warfare changed the last 1000 years? Even with several orders of magnitude error margins, we're talking "sufficiently advanced technology" here.

      Alien warfare will not be fair. It will be like discovering an amazonas hunter-gatherer tribe, then deciding whether or not to attack them with gunships, infrared sensors or maybe nukes.

      Even with some sort of hyperdrive- do you want to risk any survivors of an attack, knowing such a device is possible, developing their own and striking back? I'm not sure if this is any more likely than nuking an amazonian hunter-gatherer tribe. And having said tribe realize nukes are possible, develop their own and strike back. Not very likely.

      Any intelligent life we encounter will probably be millions of years behind us, or millions of years ahead. Maybe more. If they are behind, they will not even have a civilization to fight, they will be an intelligent species that may evolve into a civilization given a few million years.

      In the other case, they will be "magic". Or, assuming there is a hard cap on technological progress (and that we are close to it) - they will have a few millions of years worth of experience, probably including intergalactic warfare, in all those millions of years they've been around.
      --
      I lost my sig.
  9. Make up your mind. by camperdave · · Score: 1

    First we're told that there are nine planets in our system. Then we're told that there's ten. Then we're told that Pluto and the rest don't count. Then we're told that there's not even a scientific definition of a planet, so technically there's none in our system. Now we're told that some distant star has five planets. That's more than we have!

    --
    When our name is on the back of your car, we're behind you all the way!
  10. What is the gate address? by Joe+The+Dragon · · Score: 1

    So we can Stargate there

    1. Re:What is the gate address? by hypnagogue · · Score: 1

      Walking bird, standing dog, big eye, big eye.

      --
      Liberty you never use is liberty you lose.
    2. Re:What is the gate address? by jamstar7 · · Score: 1
      That's only half of it.

      Walking bird, standing dog, big eye, big eye, snake, archer, pyramid.

      --
      Understanding the scope of the problem is the first step on the path to true panic.
    3. Re:What is the gate address? by Auraiken · · Score: 1

      Bah! People seem to find new ways to unleash goatse.cx upon others everyday.

    4. Re:What is the gate address? by Zenaku · · Score: 1

      That's still not right, you can't have "big eye" in there twice. Each of the first 6 symbols identifies a unique point in space, denoting the endpoints of three line segments which intersect at the target location. The seventh is the symbol for the point you are dialing from.

      Ugh. I feel dirty for being compelled to point this out.

      --
      If fate makes you a motorcycle, you become a motorcycle.
    5. Re:What is the gate address? by hypnagogue · · Score: 1

      Um, this gate doesn't support SGv6. Please use an SGv6->SGv4 tunnel.

      --
      Liberty you never use is liberty you lose.
    6. Re:What is the gate address? by WilliamSChips · · Score: 1

      You mean the McKay-Carter bridge? You should only need that for intergalactic trips!

      --
      Please, for the good of Humanity, vote Obama.
  11. SETI, and contact them? by newgalactic · · Score: 5, Interesting

    I already assume SETI takes finds like these into account when listening. However, is there a program around who's not intent to just listen? What if we developed a database of systems most likely to contain life, and we started a program to send the top candidates high powered radio signals. Far fetched, but maybe it'll produce some results in 100 years.

    1. Re:SETI, and contact them? by thatskinnyguy · · Score: 1

      Assuming that the inhabitants on the planet in the habitable zone are developing technology along the same timeline as us, it would be [date we first send or sent communications outside the solar system] + 41 years. Depending on how old you are, I doubt we'll know in our lifetimes.

      --
      The game.
    2. Re:SETI, and contact them? by newgalactic · · Score: 1

      Of course there are plenty of reasons for this to fail. But if they are listening to radio (biggest point of failure), any regular signal should get their attention. Think "Contact", except maybe we can send them pictures of Pamala Anderson hidden in the carrier signal.

    3. Re:SETI, and contact them? by gad_zuki! · · Score: 3, Insightful

      Inherent self-preservation instinct of any successful race will dictate that no one will begin transmitting like crazy to suspect systems. Its too much of a risk. Only idealists with a lot of faith in both humanity and alienity would be willing to take such a risk. The problem here is idealists are usually poor and can't afford to the equipment and energy to do what you propose. Not to mention, I imagine that the people who would even attempt such a thing are pretty credulous to begin with and would just conclude that aliens are here already and point to fuzzy videotapes and tall-tales of area 51 as proof.

    4. Re:SETI, and contact them? by Anonymous Coward · · Score: 2, Insightful

      "What if we developed a database of systems most likely to contain life, and we started a program to send the top candidates high powered radio signals. Far fetched, but maybe it'll produce some results in 100 years."

      I'll see your what if, and raise you one:

      What if 50 years from now we receive a tight-beam laser transmission inviting us to join the galactic survival club and, BTW, whatever you do, don't send out radio signals to random planets, the neighborhood has been littered with alarms by the berserkers.

      Uh-oh, the captcha is "deaths".
    5. Re:SETI, and contact them? by jamstar7 · · Score: 4, Insightful
      Upside, they're now watching the original Star Trek in its first run.

      Downside, they're judging us all by William Shatner.

      --
      Understanding the scope of the problem is the first step on the path to true panic.
    6. Re:SETI, and contact them? by pintpusher · · Score: 1

      The problem is that it's highly likely that the PTB's will cut the funding for this project shortly after it gets started. We'll only have enough time to send out a few seconds of signal. Some poor sap at the other end will draw a circle around the printed representation of the signal and scribble the equivalent of "Wow" in the margin. And that will be the end of it. oh well.

      --
      man, I feel like mold.
    7. Re:SETI, and contact them? by cnettel · · Score: 1

      Worst, they already know about the carbomite maneuver.

    8. Re:SETI, and contact them? by pokeyburro · · Score: 1

      Turn that around, and we have the new alien scare: "Aliens want to invade your planet and not only sleep with your women, but deliver CORNY MONOLOGUES!!"

      --
      Lately democracy seems to be based on the skybox, the Happy Meal box, the X-box, and the idiot box.
    9. Re:SETI, and contact them? by SquirrelsUnite · · Score: 1

      There's one problem with that kind of thinking. Finding all technological civilizations in the Galaxy is easier than sending a fleet to the nearest star system. A lot easier. Indeed SKA will be able to detect radio leakage similar to what we are producing from as far as a thousand light years. It will be fully operational in 2020. Noone knows when we'll be able to send a ship to Alpha Centuri but I think it's safe to bet that we won't in the next 50 years. It's actually very likely that if a civilization has the technical capability to harm us than they already know we are here. If they have the intention too than it's completely certain they already have the galaxy mapped out.

    10. Re:SETI, and contact them? by frankie · · Score: 1

      self-preservation instinct of any successful race will dictate that no one will begin transmitting like crazy to suspect systems
      Umm... I guess you must have missed the 70s, because been there, done that.

      Don't worry though, I'm sure we'll have space defenses built up some time in the next 50000 years. And if not, we really weren't going to get very far in the galaxy anyways.
    11. Re:SETI, and contact them? by vecctor · · Score: 1

      Melllvar! Melllvar is the ultimate fan!

      --
      Why, yes I have been touched by His noodly appendage. And I plan to sue.
    12. Re:SETI, and contact them? by WilliamSChips · · Score: 1

      IT'S THE DOC-TOR! EX-TER-MI-NATE! EX-TER-MI-NATE!

      IT'S THE LAME-NESS FIL-TER! EX-TER-MI-NATE!
      The lameness filter is thinning out the Dalek fleet! Wait...aren't Daleks more deadly when their numbers are lowered? They've adapted it to work for them!

      --
      Please, for the good of Humanity, vote Obama.
  12. An even bigger distance by Cally · · Score: 1

    from any one of those planets to ours... at the risk of offending the "human-colonisation-of-space" brigade, a great exercise is to try making some sort of scale representation. Like, if earth is as far from the sun as the size of a grain of sugar, how far away is this system? Hmmm, well, if we're 12 light-minutes from the sun (forgive me if I got that wrong, it's been a long time), and the parent star is 41 light years away, is that like... next door? next town? next country? Anyone?

    --
    "None are more hopelessly enslaved than those who falsely believe they are free." -- Goethe
    1. Re:An even bigger distance by 4D6963 · · Score: 1

      and the parent star is 41 light years away, is that like... next door? next town? next country?

      Next town. ((41 light years) / (1 AU)) * 0.7 mm = 1.82 kilometers

      You could have found out on your own I'm sure ;-)

      --
      You just got troll'd!
    2. Re:An even bigger distance by cathector · · Score: 1

      i love how google handles unit conversions so nicely.

    3. Re:An even bigger distance by Samah · · Score: 1

      FYI, 1 AU is approximately 8.3 light-minutes.

      --
      Homonyms are fun!
      You're driving your car, but they're riding their bikes there.
    4. Re:An even bigger distance by Cally · · Score: 1
      thanks!

      Of course I'm in the very small camp (small around here anyway) that thinks physics trumps capitalism, ie. that the problems involved in traveling that distance make extra-solar human travel effectively impossible. That's a useful way to think about the scale involved I think (hope).

      --
      "None are more hopelessly enslaved than those who falsely believe they are free." -- Goethe
  13. Starting to sound like flying cars.. by ashitaka · · Score: 1

    The discovery of an earth-like rocky planet is always five years off.

    However, at least we stand a good chance of being alive when the discovery is made. (Madly knocking wood)

    --
    If you don't want to repeat the past, stop living in it.
    1. Re:Starting to sound like flying cars.. by Anonymous Coward · · Score: 2, Funny

      The discovery of an earth-like rocky planet is always five years off.

      However, at least we stand a good chance of being alive when the discovery is made. (Madly knocking wood)


      Whoa. Only a true uber-geek could masturbate to astronomy news.

      - T

  14. Re:Curious But Meaningless by meringuoid · · Score: 1
    no human being will ever leave our current solar system to visit a distant planet

    Perhaps not, but our descendants might. We don't have to stay human forever.

    --
    Real Daleks don't climb stairs - they level the building.
  15. How far has our reach extended? by newgalactic · · Score: 2, Interesting

    Does anyone know how far our strongest radio signals have gone in the galaxy? I'm thinking of the movie Contact, where they stated that the opening of the 1936 Olympics in Berlin produced the first signal with a strength capable of being detected at greater distances. Is this true? And if it is, how far has that signal gone so far?

    1. Re:How far has our reach extended? by newgalactic · · Score: 2, Informative

      Here's a cool website that has some of the brightest stars within 50 Light years. Here's to getting a signal in 30 or so years. http://www.atlasoftheuniverse.com/50lys.html

    2. Re:How far has our reach extended? by Tsuki_no_Hikari · · Score: 2, Informative

      The 1936 Olympics were 71 years ago, 60 when Contact came out.

      Television and radio signals are both part of the EM spectrum, all of which travel at C with varying levels of refraction depending on the medium it passes through.

      That gives us a range of 71 light years for a civilization to have received the signal at all, and 35.5 light years if we would expect to hear a response from a civilization tomorrow.

    3. Re:How far has our reach extended? by David+Gould · · Score: 1

      You're far too nice. When presented with such a stupid question as "the opening of the 1936 Olympics [...] how far has that signal gone so far?", the correct answer (in 2007) is "Well, I'm no astrophysicist, but I'm guessing... about 71 light-years". Or if you wanted to be really helpful, you'd convert the distance to football-fields.

      --
      David Gould
      main(i){putchar(340056100>>(i-1)*5&31|!!(i<6)<< 6)&&main(++i);}
    4. Re:How far has our reach extended? by ChrisA90278 · · Score: 5, Informative

      Let's set, radio travels at the speed of light. In one year light travels (get's out calculator.) one light year. If there are any people there listening to Earth they are hearing what we heard in 1956.

      When did we first build powerful transmitters? Comercial radio started in the 1920's so almost 90 years ago. Higher frequency VHF got beg after the war in the lat 40's when TV got popular.

      Could they hear it? Only if they have invested in VERY sensitive receivers MUCH more sensitive then anything we have. Our current receivers could only hear a signal if it were from a very powerful beacon aimed right at us.

      We do not currently have a system then could detect our own signals if they were coming from another star.

    5. Re:How far has our reach extended? by tompaulco · · Score: 1

      The 1936 Olympics were 71 years ago, 60 when Contact came out.
      Shirley: you mean 49 years ago, as the book was published in 1985.

      --
      If you are not allowed to question your government then the government has answered your question.
    6. Re:How far has our reach extended? by mcvos · · Score: 1

      Could they hear it? Only if they have invested in VERY sensitive receivers MUCH more sensitive then anything we have. Our current receivers could only hear a signal if it were from a very powerful beacon aimed right at us.

      Exactly. SETI wouldn't be able to detect Earth from 0.5 lightyears away. Broadcast transmissions are as good as undetectable over interstellar distances.

  16. A perfect spot for a rebel base! by primenerd · · Score: 2, Funny

    A gas giant with habitable moons. Only 41 LY away, it can't be as remote as Dantooine.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    1. Re:A perfect spot for a rebel base! by Anonymous Coward · · Score: 1, Funny

      Fortunately, we're already conducting an exhaustive search of the surrounding systems.

    2. Re:A perfect spot for a rebel base! by guabah · · Score: 1

      And it's just over 12 parsecs away. COOL!!!!

    3. Re:A perfect spot for a rebel base! by jamstar7 · · Score: 1

      We better jump on that before the real estate developers invade. otherwise, we'll be up to our asses in telemarketters...

      --
      Understanding the scope of the problem is the first step on the path to true panic.
    4. Re:A perfect spot for a rebel base! by siwelwerd · · Score: 1

      Those aren't moons...

  17. Re:Curious But Meaningless by Loke+the+Dog · · Score: 2, Insightful

    No human will set foot on Neptune either, does that make it's discovery meaningless? Thank god no scientist thinks like you.

    Come to think of it, I will never meet you in person, so I guess you're meaningless too.

  18. 5 planets? by Pedrito · · Score: 1

    Astronomers have discovered a record-breaking fifth planet around the nearby star 55 Cancri, making it the only star aside from the sun known to have five planets.

    Not to nitpick, but just so people don't go away thinking there are only 5 planets in our solar system, the sun in fact, has 8 planets currently.

    1. Re:5 planets? by verbatim_verbose · · Score: 1

      Well, the sun does in fact have 5 planets. The fact that it also happens to have a couple more doesn't change that.

  19. Extrasolar simply means beyond our solar system by hlomas · · Score: 2, Insightful

    Extrasolar planet refers to any planet beyond our solar system, not beyond our galaxy.

    The Milky Way galaxy (ours) contains ~200 billion stars, each one a potential solar system.


    Obligatory wikipedia article listing some of the discovered extrasolar planets: http://en.wikipedia.org/wiki/Extrasolar_planet

    1. Re:Extrasolar simply means beyond our solar system by Grave · · Score: 1

      Sorry, but everything outside our galaxy is, by definition, also outside our solar system; thus, everything outside our galaxy is extrasolar.

    2. Re:Extrasolar simply means beyond our solar system by jberryman · · Score: 1

      What grandparent is saying is that considering that we have yet to discover a planet outside our own galaxy, 0% is a very good approximation of the percentage of the few planets in the Universe which we have discovered.

  20. Re:Any chance they plan to name this planet Endor? by ls+-la · · Score: 1

    Wookies live on Kashykk, and Endor was a MOON. The PLANET was Yavin. Yavin IV or V, if I remember right. Yavin was the gas giant the FIRST death star had to go around to get to the rebel base on its moon, Yavin 4.
    Endor is the name of both the moon the second death star was built over, and the name of its gas giant planet.
    At least you're (almost) right about the wookies, except it's spelled Kashyyyk.
  21. more convenient in english for once by cathector · · Score: 1

    oh but this is neat,
    if you use english units and assume that 1 AU = 1 inch,
    then you get (1 inch / 1 au) * 41 light years = 40.9 miles,
    which is kinda convenient !

    ie,
    if AUs are Inches, just change Light Years to Miles.

  22. All their planet should belong to us! by borat4president · · Score: 1

    Quick, someone set up them a bomb!

  23. Re:Curious But Meaningless by Ihlosi · · Score: 1
    no human being will ever leave our current solar system to visit a distant planet.



    I'd settle for a swarm of powerful telescopes all over the solar system. If we can't go there, then we might at least get some good pictures.


    Also, the phrase above doesn't preclude generation ships. Sure, the original crew won't live to visit a distant planet, but their ((great-)grand-)children would.

  24. Rocky planets by jandersen · · Score: 1

    This planet orbits within the 'habitable zone,' where water could presumably exist, but it's probably another gas giant like Saturn, so any liquid water would have to be on a moon. There's still a big gap between this planet and the outermost planet where no planets have been detected yet, so there could yet be a rocky planet in the system.

    Rocky planets are usually found closer to the star than the gas giants - the heat from the the young star will make lighter elements evaporate, you see. So if this planet is a gas giant, it is not likely that they will find a rocky planet in the gap. Fortunately liquid water doesn't have to be on a rocky surface, there are such things as clouds. On the other hand, one thing that does seem to be important for the development of life as we know it is plate tectonics. Perhaps something with a similar effect could exist in the atmosphere of a gas planet.

    1. Re:Rocky planets by mcvos · · Score: 1

      Rocky planets are usually found closer to the star than the gas giants - the heat from the the young star will make lighter elements evaporate, you see.

      The sample for rocky planets being closer to the sun than gas giants is really small: just us. There are a lot of systems out there with gas giants in very close orbits around their sun, however. So basically, we have no idea where rocky planets are in your average solar system, or how common they should be. We have a lot of theories about the formation of planetary systems, but none of them are good enough to predict all our current observations, and our observations aren't detailed enough to be sure about anything anyway. We know virtually nothing.

      On the other hand, one thing that does seem to be important for the development of life as we know it is plate tectonics. Perhaps something with a similar effect could exist in the atmosphere of a gas planet.

      Again, this is all speculation. We have too little data to tell exactly what is necessary for the development of life as we know it. Liquid water (seas, lakes, not just clouds) seems rather vital, but volcanism, plate tectonics, regular (but not too frequent) asteroid impacts, tides, weather, could all play an important role. Or not. Maybe it all depends on your definition of "life as we know it". Or not. Again, we know nothing.

  25. We don't know, if we don't try. by master_p · · Score: 1

    It may be impossible to travel to other stars, but we don't know that for certain. We have to try, and then declare it impossible.

    If there is a way to travel to other stars though, it would be the greatest thing ever happened to mankind.

    1. Re:We don't know, if we don't try. by 4D6963 · · Score: 1

      It may be impossible to travel to other stars, but we don't know that for certain. We have to try, and then declare it impossible.

      Oh God, did you even think before you pulled that one out? Of course we do not have to "try" to find out it's "impossible", we know damn well what we can or can't do and the thing is as of now we couldn't send a probe to another star in a timely manner, let alone astronauts. "Trying" would be like trying to simulate the folding of proteins with a DEC PDP-1. We just can't do that as of now, period.

      --
      You just got troll'd!
    2. Re:We don't know, if we don't try. by master_p · · Score: 1

      I did not say we have to try interstellar travel now. What I said is that we have to try to find the technology which will enable us to try interstellar travel tomorrow.

  26. Floating Stations on Gas Giants? by AP31R0N · · Score: 1

    i'll say right off the bat i have no idea what i'm talking about, so this idea could be really silly. So, that out of the way: Would it be possible to build floating stations/ships on/in a gas giant? What would be involved? Would it be useful? Too dangerous?

    --
    Utilizing the synergization of benchmark e-solutions to pre-workaround action items!
    1. Re:Floating Stations on Gas Giants? by pi_neutrino · · Score: 1

      Sure, it wouldn't be too difficult, assuming we'd already developed the industrial capacity to get large amounts of raw materials and personnel out there. The main problem is gravity. Saturn's surface gravity is only 0.914g, so it's not any harder to walk around inside a floating station on its surface than on Earth, but Jupiter's surface gravity is 2.358g. Not impossible to walk in, but quite difficult.

  27. Re:Any chance they plan to name this planet Endor? by ashitaka · · Score: 1

    But Chewbacca lives on Endor!

    Therefore you must acquit!

    --
    If you don't want to repeat the past, stop living in it.