Slashdot Mirror


Meteorite Contains Complex Organic Molecules

An anonymous reader writes "Previously unknown organic molecules have been discovered in a 100 kg meteorite that hit Australia in 1969, suggesting that our early Solar System contained a soup of highly complex organic chemistry long before life appeared. Quoting: 'According to [the study's lead author], the newly discovered compounds in the Murchison meteorite "may have contributed to the organic complexity of the early 'soup' that led to the development of life on Earth." The findings also suggest that extraterrestrial chemical diversity surpasses that found on Earth. The meteor probably passed through primordial clouds in the early solar system, accumulating organic molecules in a snowball effect along the way. By tracing the sequence of organic molecules in the meteorite, researchers believe they may also be able to create a timeline for their formation and alteration since the early days of our solar system.'"

106 comments

  1. I for one by koreaman · · Score: 3, Funny

    welcome our new meteor-dwelling overlords.

    1. Re:I for one by adosch · · Score: 1

      Could it be that Futurama is becoming reality? It's only a matter of evolutionary time before that chemical blob morphs into Yivo, and not only becomes a meteor-dwelling overlord, but our planet-sized, tentacled, omnipotent alien overlord that controls us all!

    2. Re:I for one by Anonymous Coward · · Score: 0

      Could it be that Futurama is becoming reality? It's only a matter of evolutionary time before that chemical blob morphs into Yivo [wikia.com], and not only becomes a meteor-dwelling overlord, but our planet-sized, tentacled, omnipotent alien overlord that controls us all!

      Hentai lovers rejoice!

    3. Re:I for one by RavenChild · · Score: 1

      Look at the world today. Perhaps we are ex-meteor-dwelling overlords.

    4. Re:I for one by steelfood · · Score: 1

      This finding can only mean one thing: Space dolphins passed by billions of years ago, dropped some bricks behind, and we resulted.

      --
      "If a nation expects to be ignorant and free in a state of civilization, it expects what never was and never will be."
  2. I shit organic material, but so does Kilauea by BadAnalogyGuy · · Score: 5, Funny

    Before we get all excited about finding "organic" material in space rocks, it's important to remember that organic doesn't really mean anything unless it is certified by the government. There is a battery of tests and criteria that must be passed before anything can truly be referred to as organic.

    I doubt anyone has certified a ROCK from OUTER SPACE as anything but a space rock. You can't eat it anyway, so there really isn't any reason to get it certified organic.

    1. Re:I shit organic material, but so does Kilauea by EdZ · · Score: -1, Troll

      I.. I really can't tell if this is deliberate humour or just stunning stupidity. I'm really hoping for the former, but you can never tell these days. For the record, 'organic' means 'contains carbon' in the context of chemistry.

    2. Re:I shit organic material, but so does Kilauea by koreaman · · Score: 3, Insightful

      Check out the name of the guy who posted that...

    3. Re:I shit organic material, but so does Kilauea by StuartHankins · · Score: 0, Redundant

      You got Punk'd.

    4. Re:I shit organic material, but so does Kilauea by Anonymous Coward · · Score: 1, Informative

      Well, to make your statement 100% perfect, please say "contains Hydrocarbons", because molecules like CO2 and CO don't count as organic material compound (though they are used/produced in a lot of organisms through organic chemistry of course)

      but i guess he was joking of course... ;)

    5. Re:I shit organic material, but so does Kilauea by steelfood · · Score: 4, Funny

      But it contains a chemical known to the state of California to cause cancer.

      --
      "If a nation expects to be ignorant and free in a state of civilization, it expects what never was and never will be."
    6. Re:I shit organic material, but so does Kilauea by Gilmoure · · Score: 1

      I thought a cancer in the state were undesirables. At least, they're always characterized as being a cancer.

      --
      I drank what? -- Socrates
  3. 2323 Origin of life in our solar system discovered by Orga · · Score: 4, Funny

    A passing space cruise liner flushing passenger waste as it passed our primordial solar system injected the base complex organic molecules needed to form life on our planet.

  4. Teeming with organic molecules by proverbialcow · · Score: 0

    A giant rock has been on Earth for forty years, and just now they're discovering that it's contains organic compounds? Um...did it fall directly into a controlled vacuum?

    --
    The only surefire protection against Microsoft infections is abstinence. - The Onion
    1. Re:Teeming with organic molecules by IndustrialComplex · · Score: 4, Informative

      A giant rock has been on Earth for forty years, and just now they're discovering that it's contains organic compounds? Um...did it fall directly into a controlled vacuum?

      If you find organic molecules which do not exist on Earth OTHER than on this meteorite, the likely conclusion is that the meteorite is the source, not the recipient.

      --
      Out of modpoints but really liked a post? 1BDkF6TtmmeZ3yqXbz9yhdYVqRYnwFoXDj
    2. Re:Teeming with organic molecules by Anonymous Coward · · Score: 0

      Well, it's one thing to have it covered in moss, it's another thing to find complex carbon-based molecules embedded into the structure. Rocks generally contain pockets, so you can tell if a molecule was there when the rock solidified or not. Plus, I'd imagine that the organic compounds found in space would have different concentrations than what you'd expect to find breezing around the outback.

    3. Re:Teeming with organic molecules by eleuthero · · Score: 1

      I have often wondered how this worked with the "martian" asteroids. The news articles never explained why the scientists involved were certain they came from Mars and why the bacteria in them had to have come from there - the answers to your post are somewhat helpful but I would still like to understand the methods behind it all a bit better.

    4. Re:Teeming with organic molecules by sonnejw0 · · Score: 1

      Could be wrong, but I think the martial meteorites (not asteroids, wiktionary that if you don't know why), were fossilized bacterial cells that were fossilized within the martian rock, which has a different composition than any rock on earth (due to its distance from the primordial sun during planet formation).

      This article claims complex organic molecules that they do not name, which means they might not have a common chemical name and no one cares about IUPAC nomenclature. I would assume the chemicals were similarly embedded. I doubt someone would put their career on the line saying they found extraterrestrial organic chemicals unless they could not easily be refuted (but that's just my trusting nature) ... I have no reason to discredit the claim, at least.

    5. Re:Teeming with organic molecules by eleuthero · · Score: 1

      Thank you - and like most lay people, asteroids tend to be my way of referring to any rock from outer space (though I do know that is not technically true). Your explanation on the rock origination was most helpful.

    6. Re:Teeming with organic molecules by Scrameustache · · Score: 1

      A giant rock has been on Earth for forty years, and just now they're discovering that it's contains organic compounds? Um...did it fall directly into a controlled vacuum?

      If you find organic molecules which do not exist on Earth OTHER than on this meteorite, the likely conclusion is that the meteorite is the source, not the recipient.

      I saw that movie, it had Fox Mulder innit, and he shot a dragon! :)

      --

      You can't take the sky from me...

    7. Re:Teeming with organic molecules by idontgno · · Score: 0, Troll

      If you find organic molecules which do not exist on Earth

      And you know this with scientific certainty because... you've analyzed every organic molecule on Earth?

      That certainly must have taken a long time

      FWIW, I don't remember when you stopped by to sample my organic molecules.

      --
      Welcome to the Panopticon. Used to be a prison, now it's your home.
    8. Re:Teeming with organic molecules by thrawn_aj · · Score: 2, Informative

      To build on your point, I read the same story yesterday (could be the same source, I don't recall) and their work is based on mass spectrometry only (from the vague, unscientific, dumbed down crap that finally makes it to the popular press so I could be wrong). Essentially, they would crush a small sample of the meteorite, analyze it for known compounds/elements (dunno what instruments they use) and infer the composition. Their spokesperson also mentioned that their instruments aren't sensitive to every single ion species so they might even be missing things. Also, since their selection is just that - a selection - the actual number of different compounds may be much higher!

      At this point, people that are really interested in understanding the science should look up the working of a mass spectrometer. The toy model is that you volatilize ("gassify [sic] by heating") your sample and electrically tear apart the molecules using a high voltage between (canonically) a pair of electrodes. Guide the ions electromagnetically into a chamber with a magnetic field perpendicular to the ions' motion. This bends the ions in different circular paths (the radii are different because of the ions' charge/mass ratio). Now, here is where the sophistication (read: cost) of the instrument comes into play - the detectors that measure the incidence of these separated ions. For organic chemistry, your instrument would have C, H, O, N and other common elements calibrated. Of course, this is all just a toy model of how things work - the specific instrument you use would of course have its own pros/cons. Cheaper ones might have more assumptions built into them (where you know what you're trying to measure and just wanna know relative element ratios - clearly this is not what you would want to use for exobiology where assumptions can be fatal).

      Here's the abstract of the actual paper: http://www.pnas.org/content/107/7/2763
      Full text requires a subscription, alas.

      From a quick perusal of the text (University library FTW), this paper is a breakthrough for precisely the reason I alluded to above, i.e. for exobiology, you want to have little to no assumptions built into your investigation - a so-called 'non-targeted investigation' as the authors say. The newer analytical methods they used include (for keyword searches by interested readers): Electrospray ionization (ESI) Fourier transform ion cyclotron resonance/mass spectrometry (FTICR/MS), Nuclear magnetic resonance spectroscopy (NMR) and ultraperformance liquid chromatography coupled to quadrupole time-of-flight mass spectrometry (UPLC-QTOF/MS). This was from the actual paper.

      Intuitively, you can sort of see what all that jargon means (thank science for meaningful terminology). FTICR/MS sounds like making the ions go in a circle using a magnetic field (the rotation frequency for a given charge/mass and mag field is the cyclotron resonant frequency - can be found via Fourier transform methods I presume - this sounds quite interesting and I believe I'll look this up to see exactly how they do it). NMR is simply MRI (the latter is a term used because neobarbs get their panties in a bunch when they hear "nuclear"). Vaguely speaking: you flip nuclear spins using an oscillatory mag field and measure the response - tells you what stuff is made of. Time-of-flight spectrometry is exactly what it sounds like. Recall my toy model of spectrometry. Well, instead of a mag field, you use an electric field to accelerate the ions and figure out how long it takes to make a given trip. Simple high school kinematics tells you the rest. Dunno offhand what the chromatography or ESI are but I'm sure you can google them if you're interested.

      By the way, I see that there are many here who bring up the question of whether this is just terrestrial contamination. While the question is legit, the idea that scientists routinely ignore such obvious questions is a symptom of the irresponsible and incomplete nature of sc

    9. Re:Teeming with organic molecules by Cassius+Corodes · · Score: 1

      The above comment brought to you by the society for replacing the scientific method with a brute force search.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
  5. Discrimination of rocks. by Polarina · · Score: -1, Offtopic

    Find a rock, ???, report to the press, ???, profit!

    This rock looks exactly the same as the one I got at home -- it has the same shape, color, size and is just as aggressive as the rock advertised, yet, my rock doesn't get all the fame.

  6. Really? by mujadaddy · · Score: 5, Funny

    The Murchison meteorite contains complex organic molecules – including carbon, hydrogen, oxygen, nitrogen and sulphur.

    Molecules do not work that way!

    TFA is short on details.

    Again, TFA: Now, for the first time, scientists have used advanced analytical methods to conduct a non-targeted experiment....wtf?

    --
    Populus vult decipi, ergo decipiatur...
    "Force shits upon Reason's back." - Poor Richard's Almanac
    1. Re:Really? by xavieramont · · Score: 2, Funny

      hey now, that article summary was outsourced to bangladesh. just be glad its in english.

      --
      If it is natural to die, then to hell with nature. --FM 2030
    2. Re:Really? by Anonymous Coward · · Score: 0

      You mean: it's

  7. science-ignorant article by rubycodez · · Score: 5, Informative

    Looking at better news sources, one finds the scientists found over 14,000 organic compounds which contained (besides carbon), the hydrogen, sulfur, nitrogen, etc. None of those things by themselves constitutes an organic substance. Do kids even study chemistry in high school anymore?

    1. Re:science-ignorant article by Bowling+Moses · · Score: 4, Informative

      With a few exceptions like carbonates, cyanide salts, or allotropes of carbon (graphite, diamond, buckyball, etc), if it contains carbon it's an organic molecule. Since there aren't all that many molecules that meet these exceptions it's pretty safe to apply the rule: they found a crapload of different organic molecules.

      A different news writeup (the actual paper isn't available yet on PNAS, not even online) says millions of compounds, including 70 different amino acids. It'll be interesting as details unfold.

    2. Re:science-ignorant article by burningcpu · · Score: 0, Flamebait

      This depends on your definition of organic compound. If you are referring to the prevalent definition in chemistry, then yes, these are organic compounds. If you are going to be snarky about it you should at least double check yourself first. http://en.wikipedia.org/wiki/Organic_compound

    3. Re:science-ignorant article by Anonymous Coward · · Score: 0

      He got the answer to "what is organic chemistry" on Jeopardy.

    4. Re:science-ignorant article by sonnejw0 · · Score: 0, Troll

      Wikipedia is not a source.

    5. Re:science-ignorant article by burningcpu · · Score: 2, Informative

      Erm, ok, how about Organic Chemistry 6th Edition, by L.G. Wade? I'm not writing a paper here... show a little initiative and look it up yourself.

    6. Re:science-ignorant article by Inda · · Score: 1

      I didn't RTFA because I read it here the other day: http://news.bbc.co.uk/1/hi/sci/tech/8516319.stm

      I thought it was informative.

      --
      This post contains benzene, nitrosamines, formaldehyde and hydrogen cyanide.
    7. Re:science-ignorant article by rubycodez · · Score: 1

      problem was wording of linked article implying that hydrogen, sulphur, nitrogen, oxygen were organic molecules in picture caption and in text; they are not. They should for picture and in article have said "organic molecules containing atoms of ....."

    8. Re:science-ignorant article by FleaPlus · · Score: 2, Informative

      A different news writeup (the actual paper isn't available yet on PNAS, not even online) says millions of compounds, including 70 different amino acids. It'll be interesting as details unfold.

      The abstract is up now:

      http://www.pnas.org/content/early/2010/02/12/0912157107.abstract

      High molecular diversity of extraterrestrial organic matter in Murchison meteorite revealed 40 years after its fall

      Numerous descriptions of organic molecules present in the Murchison meteorite have improved our understanding of the early interstellar chemistry that operated at or just before the birth of our solar system. However, all molecular analyses were so far targeted toward selected classes of compounds with a particular emphasis on biologically active components in the context of prebiotic chemistry. Here we demonstrate that a nontargeted ultrahigh-resolution molecular analysis of the solvent-accessible organic fraction of Murchison extracted under mild conditions allows one to extend its indigenous chemical diversity to tens of thousands of different molecular compositions and likely millions of diverse structures. This molecular complexity, which provides hints on heteroatoms chronological assembly, suggests that the extraterrestrial chemodiversity is high compared to terrestrial relevant biological- and biogeochemical-driven chemical space.

    9. Re:science-ignorant article by HeadlessNotAHorseman · · Score: 1

      Erm, ok, how about Organic Chemistry 6th Edition, by L.G. Wade? I'm not writing a paper here... show a little initiative and look it up yourself.

      I only have Organic Chemistry 5th Edition, by L.G. Wade, you insensitive clod!

      --
      I like my coffee the way I like my women - roasted and ground up into little tiny pieces.
  8. organic sources by Scarumanga · · Score: 1

    Well the thought of the building blocks for life to have just "formed" on earth is too far fetched. This just helps solidify that earth was somehow seeded by meteorites long before life started and that is where life started up from i believe. It just makes more sense. Also once you do the math as to how many galaxies there are just in the visible portion of the sky, it just becomes even more realistic that we are not alone, but space is just so big that we pretty much are alone in our tiny sector of the Galaxy perhaps. Its like living out in the boonies where everyone house would be separated by 5 miles with trees in the way, just because you can't see their house, doesn't mean its not there, but just out of sight.

    1. Re:organic sources by CyberBill · · Score: 4, Informative

      "Well the thought of the building blocks for life to have just "formed" on earth is too far fetched."

      Why is it far fetched? We've generated nearly every one of the bases of RNA and DNA in conditions that mimic the early Earth - Some from experiments like the Miller-Urey Experiment created a whole slew of different organic compounds, and more recent studies have shown the synthesis of an amino acid resulting from exposure to ultra-violet light (I believe it was uracil?) - showing that there are many many different ways to create complex organic compounds.

      --
      -Bill
    2. Re:organic sources by Anonymous Coward · · Score: 0

      .............umm.......... and it's less far fetched it was formed on some tiny asteroid in the middle of nowhere?
      The universe might be filled with lots and lots of galaxies and planets, but it contains a several magnitudes greater amount of void, hence, the chance of this asteroid forming life, traveling across the galaxy, surviving a kiloton/megaton impact against earth is more likely?
      If the earth was blasted into pieces right now, do you seriously think anything would survive and any of those pieces would spread life to other solarsystems?

      What 'makes more sense' to me is that you wish you had some 'ancient' alien dna in you, that would allow you to control a starship and save the earth one day or that you would 'know' what the meaning of life is blahblahblah...

    3. Re:organic sources by vlm · · Score: 4, Informative

      Well the thought of the building blocks for life to have just "formed" on earth is too far fetched.

      Basically you're promoting "vitalism"

      Organic chemistry dropped vitalism around 1828 more or less due to Wohler synthesis.

      Looks like biology still hasn't made that advance yet, OR your belief is a bit out of date, out of step with modern bio beliefs.

      http://en.wikipedia.org/wiki/Wohler_synthesis

      http://en.wikipedia.org/wiki/Vitalism

      --
      "Science flies us to the moon. Religion flies us into buildings." - Victor Stenger
    4. Re:organic sources by Anonymous Coward · · Score: 0

      All this really proves is that these compounds are actually quite common, and all the talk about them being rare is baseless.

    5. Re:organic sources by CorporateSuit · · Score: 1

      There is a difference between forcing a monkey smash every letter of the alphabet on a keyboard, including some chance words up to 8-letters in length, and having a monkey voluntarily type out all of the works of Shakespeare, in the order they were written by Shakespeare, and then turn the typewriter into a primitive compiler, using only the information he typed; a compiler (using a language that is much more intricate, error-resolving, and efficient than any of our own) that starts building walking libraries, out of nothing but typewriters and monkeys, who recite the complete works of Shakespeare, in order (while subconsciously discarding any mispellings one of the typewriters could make). The difference is not a small one.

      The Miller Urey experiment did manage to show that our atmosphere (and subsequently, the biosphere) knows what to do with excess carbon.

      --
      I am the richest astronaut ever to win the superbowl.
    6. Re:organic sources by Scarumanga · · Score: 1

      Of course, some pieces of earth would travel through space, extremophiles would remain alive on the pieces of rock, after all extremophiles are our most ancient ancestors.

    7. Re:organic sources by Black+Parrot · · Score: 1

      Well the thought of the building blocks for life to have just "formed" on earth is too far fetched.

      Why is it so hard to imagine organic molecules forming on Earth, if they for on asteroids (or wherever the meteorite came from), and, for that matter, in deep space?

      I agree with your suggestion that we're probably not alone, though.

      --
      Sheesh, evil *and* a jerk. -- Jade
    8. Re:organic sources by Scarumanga · · Score: 1

      I should have worded it a bit differently, what i mean its more of a possibility that the key ingredients to form those essential building blocks for life, may have come from elsewhere in the solar system/galaxy. One thing we know is our planet gets showered with meteorites on almost a daily basis, most of which are just so small we cant see them. Then again its know that earth used to have a sister and both collided to form our current earth, and the leftover debris is what formed our moon, its more possible that everything was on both these planets, just when they combined it created the right kind of "soup" to spawn life.

    9. Re:organic sources by primenerd · · Score: 1

      Good of you to bring up the Miller-Urey experiments. Those experiments and subsequent ones with different atmospheric conditions have demonstrated how easy it is to create complex organic molecules under fairly common conditions (common in a cosmic sense).

      Uracil is not an amino acid, it is a pyrimidine. Very necessary for RNA and life, but not an amino acid.

      --
      AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
    10. Re:organic sources by famebait · · Score: 1
      AOL.

      The thing that always bothered me about pansperima and related theories is that, while exciting, they depend on the premise that there must be a certain concentration of places out in space that are better suited for generating life or its basic compunds than here on earth. I have a hard time imagining such a place, and have yet to see any of the proponents describe even the rudimentary properties of such a place would need to have.

      I find much more encouragement in recent theories (as described recently in Sientific American) concering deep-sea vents here on earth, and the combination they offer of vital and complex compounds, microscopic fluid-filled compartments, any life-suporting temperature you like within short reach, and acidity gradients that might power complex chemical cycles to produce and concentrate the building blocks for the most primitive of life-like systems.

      I have little doubt that lif has also arisen elsewhere in the universe. The question is whether it is more likely to have traveled here than arisen here. My impression is that as our understanding of the possibilities expands, the need for the space connection just keeps slimming, and there is no reason to assume that trend is going to abate anytime soon.

      --
      sudo ergo sum
    11. Re:organic sources by metaforest · · Score: 1

      In "bucket chemistry" it is not uncommon to have the following situation:

      BEGIN CAR ANALOGY:

      1) Take a large cement mixer, fill it will enough loose components to manually assemble 10,000 automobiles.
      2) Agitate, heat, compress and cool the "mixture" while adding a few more components and some tools at appropriate times.... continue for a loooong time...
      3) dump resulting mixture through a car-philyic filtering process....
      4) not-cars are washed away; leaving a two or three fully assembled cars.
      5) Wash. Rinse. Repeat.
      6) ...
      7) profit.

      END CAR ANALOGY;

      Most industrial chemistry works on similar principles. YMMV

    12. Re:organic sources by metaforest · · Score: 1

      The thing that always bothered me about pansperima and related theories is that, while exciting, they depend on the premise that there must be a certain concentration of places out in space that are better suited for generating life or its basic compunds than here on earth. I have a hard time imagining such a place, and have yet to see any of the proponents describe even the rudimentary properties of such a place would need to have.

      Is it so difficult to imagine that our little patch of galactic sky has had it's share of Pandoras, Endors, Degobahs, Earths, etc... that have bloomed, and become utterly saturated in organic mass?

      Would it also be much of a stretch to imagine that some meaningful fraction of such moldy boulders might get shattered by other less interesting rocks?

      Would it be too much to expect that some get slung out of orbit, or turned into a ~0.1*c shotgun-blast of interstellar gravel when their local star takes 'The Big Shit?'

      How many million years might it take a chunk of one of those organically contaminated splinters to travel a few dozen light years, or even a few hundred?

      How long until it might it wander until it got caught in another stellar waltz and hit something? A million years? A few billion years?

      Interstellar space seems to be sparse, but it's not THAT sparse. Stars tend to collect shit too.... So do large clouds of dust. In the mean time, the flash-heated, vacuum-frozen, moldy chunks would get a nice protective layer of dust and gas, keeping the remaining organics relatively safe.... maybe.

      Do we know that this happens? No. Is it reasonable to expect that it does? I tend to think it might.

      5 billion years (give or take a billion) is a long fuxing time. Where will the Pioneer and Voyager probes be in a few million years, for comparison?

      We get a constant rain of crap filtering down on this moldy rock -- many tons per year. Almost all of it extra-teresstrial. Some fraction of it probably was not part of the formation of this star system. Some smaller fraction of it is likely organic. How much might that be?

      Bringing this up, I am not suggesting that life here was patterned elsewhere. I am saying that it doesn't strike me as fantastic that we'd find complex organics in extra-terresterial debris. I also would not be very surprised that continual influx of such material for billions of years might have influenced the diversity of native organics.

      YMMV

  9. Panspermia? Yeah right. by T+Murphy · · Score: 3, Funny

    I tried to explain on another website how this means life may have come to earth from space, and the only response I got was someone pointing out how I'm an idiot because this meteor is only from 40 years ago. He must be right, given no one would call someone an idiot when he himself is the idiot, so I must inform all of you panspermia is wrong and you should be ashamed of yourselves for believing it.

    1. Re:Panspermia? Yeah right. by MyLongNickName · · Score: -1, Troll

      Wow. You had an argument on the internet. Then you came here to report it. Maybe you can report on digg how you explained your brilliance on Slashdot and just got a sarcastic reply.

      --
      See my journal for slashdot ID's by year. Mine created in 2005. http://slashdot.org/journal/289875/slashdot-ids-by-year
    2. Re:Panspermia? Yeah right. by Anonymous Coward · · Score: 0

      The part I prefer is the "sperm" part of Panspermia.

    3. Re:Panspermia? Yeah right. by T+Murphy · · Score: 1

      Some idiots are amusing. Bash.org is evidence of that.

    4. Re:Panspermia? Yeah right. by Scarumanga · · Score: 1

      I think life came from space, and did not originate here on this planet. I have just come to accept that there is more at play than any human can understand at the moment, and probably won't be understood for a very long time. I also believe that all religions (in general) might have stemmed up from something else all together, someone passes a story on and changes it when he tells it to someone else, the process repeats itself until you have several different version of the same story (all religions have "a higher power" in common). Obviously something happened in human history that no one understood at all and that's where religion started, this is why i am not religious as i know its all baloney. No one is an idiot for having their own concepts, without different concepts or theories, well we would be lost.

    5. Re:Panspermia? Yeah right. by Anonymous Coward · · Score: 0

      It seems inevitable that panspermia exists. So I propose a radical rethink in how we conduct space missions. We have been careful to not contaminate other planets with Earth microbes, etc. Lets take the gloves off and load up our probes with all sorts of organic matter, maybe giving greater attention to adding extremophiles to the mix. Especially for Mars, this could help the terraforming process. Add lichens and stuff, and let it stew for a few thousand years, and we can watch evolution in action. If meteorites have been dropping random stuff on planets, the concept of contamination no longer exists. You could say we have a duty to spread our lifeforms onto as many places as possible. Recently they even said ice was found on the our moon, a place with no atmosphere. Lets shit bomb the planets and asteroids!

  10. Soup Again? by Anonymous Coward · · Score: 0
    1. Re:Soup Again? by courteaudotbiz · · Score: 1

      Yes, ya right. That's exactly what I thought. But I think that in both cases, the word was used incorrectly. When I hear "soup", I think about a liquid in which stuff is floating. Where's the liquid here?

      Yesterday's story was no better, since there was no liquid, the stuff was barely matter as we know it!

      I would have changed the word "soup" for something more appropriate, like "a mix"

  11. Proof there is a god by meekg · · Score: 5, Funny

    "The Murchison meteorite landed near a town of the same name... "

    What are the odds for THAT happening?!

    1. Re:Proof there is a god by Anonymous Coward · · Score: -1, Flamebait

      "The Murchison meteorite landed near a town of the same name... "

      What are the odds for THAT happening?!

      It's a conspiracy. Call the Tea Party.

    2. Re:Proof there is a god by Anonymous Coward · · Score: 0

      Proof that he is opposed to panspermicidal Oz filtering of space porn too!

    3. Re:Proof there is a god by garompeta · · Score: 1

      Maybe it has the same odds of a town landing on a meteorite of the same name

    4. Re:Proof there is a god by mister_playboy · · Score: 2, Informative

      Well played!

      --
      Do what thou wilt shall be the whole of the Law ::: Love is the law, love under will
  12. wouldn't it be awesome by circletimessquare · · Score: 3, Interesting

    if, as we sample more planetary, asteroid, and interstellar matter, that we simply find RNA everywhere?

    that RNA simply permeates the entire universe: in the oort cloud, on europa, on ceres, in interstellar dust, in the data sent back to from probes to other stars/ exoplanets, etc

    that life is not unique to earth, and that life is pretty much inevitable wherever the conditions are right. we got used to the fact that earth is not the center of the universe, and then that our star isn't even that notable. as we discover more exoplanets, we'e beginning to come to grips with the ho hum mundane facts of the existence of millions of planets. yet right now we operate on the assumption life on earth is this rare unique thing native to here. really?

    and then the question would be: why RNA everywhere? how long has this been going on? where did it start? or for all practical purposes has it always been so and the ubiquity of panspermic RNA makes it pretty much a pat cosmological fact without discoverable cause or reason?

    it would be a pretty awesome intersection of; astronomy, cosmology, theology, biology, and even mathematics/ physics/ information technologythat complexity is simply inevitable, and that information storage and retrieval is an emergent phenomenon intrinsic to the way physical laws inexorably play out... and that this is "God". deus ex machina

    and it's entirely possible, as we keep looking

    ok, sorry, i'll put down the marijuana. dude: have you ever looked at your hand? l mean REALLY look at your HAND

    --
    intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
    1. Re:wouldn't it be awesome by ZeroExistenZ · · Score: 1

      that we simply find RNA everywhere?

      There have been alot of stupid asses in the universe blowing themselves up. We just collect the last piece of their asploded civilization.

      THIS COULD BE YOU!! IF YOU DONT RECYCLE! THE METEORITES ARE A WARNING!!!

      --
      I think we can keep recursing like this until someone returns 1
    2. Re:wouldn't it be awesome by Anonymous Coward · · Score: 0

      All of this has happened before, and will happen again. so say we all.

    3. Re:wouldn't it be awesome by panda.punter · · Score: 1

      Don't confuse how life arose on Earth with how it may have evolved elsewhere. It's unlikely that RNA is the universal carrier for genetic information.

    4. Re:wouldn't it be awesome by Nazlfrag · · Score: 1

      'I refuse to prove that I exist,' says God, 'for proof denies faith, and without faith I am nothing.'

      'But,' says Man, 'The Murchison meteorite is a dead giveaway, isn't it? It could not have evolved by chance. It proves you exist, and so therefore, by your own arguments, you don't. QED.'

      'Oh dear,' says God, 'I hadn’t thought of that,' and promptly vanished in a puff of logic.

      They call them fingers but I've never seen them fing... wait, there they go.

    5. Re:wouldn't it be awesome by famebait · · Score: 1

      If life is pretty much inevitable wherever the conditions are right, why resort to space-faring RNA to explain life here on earth?

      --
      sudo ergo sum
    6. Re:wouldn't it be awesome by valduboisvert · · Score: 1

      not a chemistry major here, but from what I know RNA has a greater instability than DNA. This is most of the time a problem in biological experiments. So I would be curious to find an ( scientific) answer to how come RNA can survive the harsh conditions of outer space plus harsh conditions of a meteorite impact/landing?

    7. Re:wouldn't it be awesome by valduboisvert · · Score: 1

      judging by the level of alcohol found in that meteorite we can not rule out the possibility of landing on the head of a stray biker.

  13. Published??? by Pedrito · · Score: 5, Interesting

    From TFA: ...according to the study published in the U.S. Journal Proceedings of the National Academy of Sciences.

    I'm going on the assumption that "published" implies past tense. As in, done. Yet, a search of PNAS finds no connection between the quoted author Philippe Schmitt-Kopplin and the word "Murchison" appearing ANYWHERE in the text of an article. And since no title is mentioned and no other authors are mentioned, I'm not really sure what to say.

    I mean, I suppose it's possible PNAS completely screwed up somehow. I tried matching just the guy's first name, just his last name. He has written for PNAS in the past. He's written three articles on wine. That's quite a jump, from wine to meteorites.

    I'm not saying it's not there. I just can't find it among the 81 PNAS articles on the Murchison meteorite.

    1. Re:Published??? by Kingleon · · Score: 1

      Hold your horses! I've discovered in the past that news articles about PNAS articles generally appear a week before the actual article can be found on the PNAS website.

    2. Re:Published??? by Anonymous Coward · · Score: 0

      A search into the isi web of knowledge does not link the mentioned author to the meteorite either. They may just have cited someone who has just commented without participating ?, nooooo ... From his published papers it would appear that he is a good candidate for such an analytical work... I was hoping someone would find the paper... well there are other interesting and related articles available.

    3. Re:Published??? by Anonymous Coward · · Score: 0

      Time travel?

    4. Re:Published??? by Anonymous Coward · · Score: 0

      Heh.. heh heh..

      You said PNAS.

    5. Re:Published??? by Anonymous Coward · · Score: 1, Informative

      You internet fu is weak.

      Original article.

      http://www.pnas.org/content/early/2010/02/12/0912157107.abstract

    6. Re:Published??? by Anonymous Coward · · Score: 0

      I'm not sure what the problem is. Here's a link to the paper:
      http://www.pnas.org/content/107/7/2763.abstract?sid=300b2847-a085-4846-b7c6-b0ac3fd6fdc8

  14. Titan has complex organics. by Kupfernigk · · Score: 0, Offtopic

    Article in February Scientific American says latest astronomical research shows that Titan has sand deserts where the grains are complex organic molecules. (a great place for a vacation - deserts of bituminous sand, littered with rocks made of water ice, and with occasional heavy methane showers. )

    --
    From scarped cliff or quarried stone she cries "A thousand types are gone, I care for nothing, no not one."
  15. Well, I for one... by gestalt_n_pepper · · Score: 1

    Welcome our dark, smudgy, foul smelling organic overlords.

    Oh wait, that's who's been here for millennia already. Damn. Damn. Damn!

    --
    Please do not read this sig. Thank you.
    1. Re:Well, I for one... by Anonymous Coward · · Score: 0

      Is that a racist remark?

  16. Re:2323 Origin of life in our solar system discove by Anonymous Coward · · Score: 2, Funny

    Boy, if the creationists were upset at the idea of being related to Chimps, imagine how they'll go ape over being the spawn of alien space dung!

  17. They made a documentary about this years ago by Anonymous Coward · · Score: 0

    http://www.imdb.com/title/tt0064393/

  18. Nonbelievers shall perish. by Anonymous Coward · · Score: 0

    Hallowed are the Ori!

  19. failzo8S by Anonymous Coward · · Score: -1, Offtopic

    standPoint, I don'[t you are a screaming Darren Reed, which what we've known

  20. Wildfire alert by Anonymous Coward · · Score: 0

    Call in Dr Jeremy Stone and his team

  21. Either that ... by Tired+and+Emotional · · Score: 1

    or it whacked a dinosaur.

    --
    Squirrel!
    1. Re:Either that ... by joke_dst · · Score: 1

      40 years ago?

    2. Re:Either that ... by M8e · · Score: 0

      Birds are dinosaurs!

      Also, fruit are candy and the cake is a lie.

    3. Re:Either that ... by kevinNCSU · · Score: 3, Funny

      There's no way to prove with absolutely certainty that there aren't still velociraptors out there hiding somewhere....biding their time.

  22. There Is Life by Anonymous Coward · · Score: 0

    There is life on Mars!!! Run, run to the hills!!!

    Oh and welcome alien invaders!

  23. anyone ? by alobar72 · · Score: 0, Redundant

    And I, for one, welcome... and so forth Did anzbody mention it by now ?

    1. Re:anyone ? by M8e · · Score: 0

      It was in the first post. Mod me informative.

  24. Re:2323 Origin of life in our solar system discove by j00r0m4nc3r · · Score: 3, Funny

    You mean they'll go ape-shit?

  25. Re:2323 Origin of life in our solar system discove by Anonymous Coward · · Score: 0

    Hahahahaha!

  26. yuo fail I9t? by Anonymous Coward · · Score: -1, Troll
  27. Hey... by Anonymous Coward · · Score: 0

    I was outsourced to Bangladesh, you insensitive clod!

  28. Does anyone have an actual link. by mbone · · Score: 1

    The author of the original article clearly doesn't understand what a molecule is, and the article is not very informative.

    Does anyone have an actual link to a scientific article about this ? ArXiv would do just fine.

    1. Re:Does anyone have an actual link. by Group+XVII · · Score: 1
    2. Re:Does anyone have an actual link. by Anonymous Coward · · Score: 0
  29. but that's exactly my point by circletimessquare · · Score: 1

    life can of course evolve in a myriad ways, and rna might very well be unique to earth alone

    however, what if the rna template for retrieval/ storage is actually just floating out there, everywhere, ubiquitously? the earth, and all celestial bodies, are constantly seeded from/ seeding everything else

    you say "It's unlikely that RNA is the universal carrier for genetic information". how can you be certain? you'd have to tell me for certain there is no rna floating out there, and that rna can only possibly have been created right here on earth. currently you have no cause for saying that your speculation: rna is unique to earth, is any less or more speculative than my speculation: rna is everywhere

    i am openly admitting that my words are conjecture, speculation. but you need to admit to yourself that saying rna is unique to earth is also equally speculative an assumption

    --
    intellectual property law is philosophically incoherent. it is your moral duty to ignore it or sabotage it
    1. Re:but that's exactly my point by Cassius+Corodes · · Score: 1

      BTW - DNA is the storage mechanism in life - RNA is used in a step for transcription. It is hypothesised that rna used to the primary storage method before but this is still up in the air.

      As for whether its universal - that depends on how many other molecules exist that could potentially fill the role that is played by dna. All life needs a way of storing information in a durable way (with about 1 defect/offspring if you want good evolvability). If it turns out the dna is the only way of doing this properly (or the best way) then we would expect to see it everywhere there is life. For all we know there could have been a number of competitor systems but DNA won hands down due to its superior properties and/or ease of evolutionary access - in which case we can expect it to be ubiquitous as well. This is basically a variation of the contingency vs inevitability argument.

      --
      Control is an illusion, order our comforting lie. From chaos, through chaos, into chaos we fly
    2. Re:but that's exactly my point by metaforest · · Score: 1

      If it turns out the dna is the only way of doing this properly (or the best way) then we would expect to see it everywhere there is life. For all we know there could have been a number of competitor systems but DNA won hands down due to its superior properties and/or ease of evolutionary access - in which case we can expect it to be ubiquitous as well. This is basically a variation of the contingency vs inevitability argument.

      A key point might be made that DNA works for the regime WE evolved in. It works when you are 8 light minutes away from a yellow star and have a fairly substantial atmosphere of hydrogen, oxygen and nitrogen.

      It's far less clear what will work under a less forgiving regime.

      What goes on with organics in Jupiter's or Saturn's atmosphere, at say 5 - 20 atmospheres?

      What about the more sheltered locations on Venus or Mercury?

      Maybe not much...

      We have hundreds to thousands of years of planetary study yet to accomplish. There is a huge amount of work yet to be done.

      YMMV

  30. FRRRRRRP! by Anonymous Coward · · Score: 0

    It didn't contain as many as that!

  31. Then again... by Hurricane78 · · Score: 1

    ...organic does not equal building block of life. Because it’s <John Cleese>just one way... just one way... </John Cleese> life can evolve.

    --
    Any sufficiently advanced intelligence is indistinguishable from stupidity.
  32. Re:2323 Origin of life in our solar system discove by RockDoctor · · Score: 1

    Boy, if the creationists were upset at the idea of being related to Chimps, imagine how they'll go ape over being the spawn of alien space dung!

    By "go ape", do you mean "devolve"?

    --
    Birds are not dinosaur descendants;birds are dinosaurs, for all useful meanings of "birds", "are" and "dinosaurs"