Slashdot Mirror
New Antibody Attacks 99% of HIV Strains (bbc.com)
An anonymous reader quotes a report from BBC: Scientists have engineered an antibody that attacks 99% of HIV strains and can prevent infection in primates. It is built to attack three critical parts of the virus -- making it harder for HIV to resist its effects. The work is a collaboration between the US National Institutes of Health and the pharmaceutical company Sanofi. Our bodies struggle to fight HIV because of the virus' incredible ability to mutate and change its appearance. These varieties of HIV -- or strains -- in a single patient are comparable to those of influenza during a worldwide flu season. So the immune system finds itself in a fight against an insurmountable number of strains of HIV. But after years of infection, a small number of patients develop powerful weapons called "broadly neutralizing antibodies" that attack something fundamental to HIV and can kill large swathes of HIV strains. Researchers have been trying to use broadly neutralizing antibodies as a way to treat HIV, or prevent infection in the first place. The study, published in the journal Science, combines three such antibodies into an even more powerful "tri-specific antibody." The experiments conducted on 24 monkeys showed none of those given the tri-specific antibody developed an infection when they were later injected with the virus. "We're getting 99% coverage, and getting coverage at very low concentrations of the antibody," said Dr Gary Nabel, the chief scientific officer at Sanofi and one of the report authors.
Woohoo!
The summary is very understandable......I know it's uncomfortable to read the summary, though. Would you like me to copy and past it down in a comment so you don't have to make the effort to scroll up a bit?
"First they came for the slanderers and i said nothing."
If it doesnâ(TM)t have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.
That means if the initial virus DNA sequence is (for example) tgagcagattcgctggtacgatgacgtactaa
if the virus can escape with a sequence of
tgaccagattcgcaggtacgatgacggactaa (five letters have been changed in specific locations). That is no good, because HIV usually has a mutation every few times it copies itself. Since there are trillions of HIV replicating every few seconds in an infected person, it is not mathematically infeasible for one of the HIV replicants to get lucky and have the required 6 mutations for it to escape.
of the strains they tried, but due either to lack of access to a sample, or other known factors, that 1% of HIV virus types would not be affected be these particular antibodies.
I don't remember exact amounts, but there are as many or more kinds of HIV than there are HPV, which is to say there are a lot of variations, not all of which may attack the same binding points.
"The experiments conducted on 24 monkeys"
When did that movie sequel come out?
"National Security is the chief cause of national insecurity." - Celine's First Law
HA take that aids
Another story about the one-percenters.
#DeleteChrome
I know a couple of people who have lived for decades with HIV. Both are hemophiliacs and got the virus before there was testing of the blood supply. They both lived in the same region of the US and caught the virus about the same time. They have to take tons of medicines to stay alive and they're already being treated for hemophilia, so it sucks for them. If they can finally get cured, that would be great. They're really good people.
It sounds like this new antibody works a little bit like the various treatments they have for Hepatitis C. There are multiple genotypes of HepC and not all the drugs work for all the genotypes, but the medicines interfere with some protein or something and causes the HepC virus to not be able to "hide" from the immune system and it just ends up getting killed off. Completely. A disease that until 2014 couldn't be cured now has a treatment that is 90% effective. One pill a day for 12 to 24 weeks and virtually no side effects. And done. Cure. Completely. Unfortunately it costs like a quarter-million dollars so insurance companies won't let you have the treatment without a fight. They will first say no unless you have at least Stage 4 fibrosis (the stage before your liver starts dying), and then they make you jump through hoops and get multiple blood tests and ultrasounds and sometimes even liver needle biopsies (which actually damage the liver). Then, they'll deny you one more time hoping to run out the clock until you die. But if you have a good GI doctor, he'll go to bat for you and keep sending the prescription until it gets approved.
To give you an idea how stupid our insurance-based system is, it's not even the insurance company that's denying you. It's a company that the insurance company hires called a "Pharmacy Benefits Manager" who are even harder to deal with than the insurance company. Then, they'll do completely random things like force you to use a different specialty pharmacy to get the meds (because you can't get these meds at your regular Walgreens, you have to go through a specialty pharmacy who will deliver the drugs to you, because every bottle of 30 pills is worth like $60,000. It's all really stupid. In Canada, the treatment is a small fraction of the cost. In India, it costs about $400 (but medical tourism doesn't work because the pharma companies have cut a deal with the Indian government to require people to show an Indian passport before they can receive the medication).
I know all this because a musician I play with on a regular basis had HepC. He was getting sicker and sicker and my wife and I helped him a lot dealing with the insurance companies and pharmacy benefits managers and special pharmacies. The freaking medicine acted remarkably fast. Within 4 weeks, a guy who had been positive for HepC for 25 years was coming up negative for the virus on his blood tests. He felt better after only a few weeks. After 24 weeks, he was done. After another few months, he was tested, still negative. Since the liver regenerates, within 8 months, his fibrosis had gone from level 4 to level 3 to 2 and is now at level 1. Yes, it cost the insurance company a couple hundred grand (although it really didn't because the pharma companies make special deals with them where it only really costs a few grand) but it's still a LOT less than a liver transplant, which he would have needed eventually, or liver cancer treatment, which sucks really bad.
I'm sorry to write this long story, but a cure is a cure. I hope eventually they can cure HIV as easily as they can now cure HCV. And if you're a baby boomer or Gen Xer, you should get tested for HepC the next time you get blood drawn. You don't want to wait until your symptomatic to find out you got it.
You are welcome on my lawn.
It's incredibly expensive to do human trials and get approval from fda. Many drugs never make it through process. These costs are recouped through high non generic drug prices.
If you want cheaper and more diverse treatments, fix the fda incentive structure. Bring down the cost to innovate. Heavy regulatory environments make it hard for small businesses who can't afford huge legal teams.
They have every incentive to say no, because it's hard to point at specific people who aren't being helped by a drug which doesn't exist. If they say yes, and people die, they get in trouble because it's very easy to point at dead people and no one gives a fuck about the potentially many more people who don't die.
Our medical system has plenty of faults, but crazy conspiracy theories are not involved. If there was a conspiracy by big medical companies to hide cures because they make more money treating, then explain the following:
[a] The elites ALWAYS carve-out exscape hatches for themselves. Just look at Al Gore and friends who rant about Climate Change and demand the public change their use of energy etc - while THEY sail super-yachts, fly private jets to conferences at exotic vacation spots, own many glorious power and resource-sucking mansions and so forth and claim to be making up for it by buying "offsets" (google: indulgences and corrupt popes). Rich elite lawmakes put taxes on sodas and limit table salt (which affect middle-class and poor folks) but they do nothing about their expensive and fattening and salt and sugar-laden foods and beverages. Somehow, however, executives of big medical firms and their family members suffer the same diseases and unhappy demises as the rest of us.
[b] Big entities cannot keep secrets. There are always insiders who are opposed to a policy, or who see an injustice, or are personally affected, or see a hypocrisy they despise, or who want to puff-up their credentials with friends or relatives who end-up leaking stuff. Where are the current or former "insiders" who are publicly outraged to be ill or dying or have sick or dying family members who are blowing the whistle on the particular executives who are hiding these magical mystery cures while making sure they themselves and their kin have access to those cures?
The simple FACT is that human beings are remarkably complex biological machines. An individual blood cell is frighteningly complicated and not fully-understood nor human-engineerable. Bone cells, kidney cells, liver cells etc are all similarly brain-bending in complexity and when you gang all of these together into a complex creature and then add-in a virus - well I personally am impressed by ANY drug advance. When you consider how difficult it is to find ANY new medicine, add-in the idea that we have probably discovered all the "easy" to discover drugs, then consider the enourmous resources to find a new drug and clear the massive pile of government regulations to get a drug approved, it's even more amazing ANY drug advance is possible.
Oh, I personally have a chronic illness and have experienced the annoyance of hearing about "breakthroughs" periodically and seeing nothing that helps ME, while also having a family member with a very serious illness who is currently involved as a subject in a drug trial program. If you ever find yourself in that tough spot and are a good candidate to be a test subject, DO IT. It may be very unpleasant and painful and embarassing and lots of other stuff and my do nothing for YOU but your participation could eventually contribute to a new drug or a better understanding and thus save or improve the lives of an uncountable number of people. Imagining conspiracies that do not exist only makes people hostile and bitter; it does NOTHING to improve the condition of any human being and is a completely self-centered non-productive waste of human energy.
Welcome to core Statistics.
This would have to be a randomized controlled experiment, and the confidence interval being tested would be 99%. What this means in frequentist statistical terms is that if you had 100 test subjects, and out of those you would expect for whatever reason one of those would somehow turn up positive, then you would still be within your 99% confidence interval. More formally stated, the true population mean is somewhere greater than the 2.5th percentile and less than the 99.5th percentile of the the distribution of the values in your samples.
So, because they are working with statistical sampling methods, they never say that they are 100% confident.
It is included
It's included for blood donation, but what I'm saying is it should be included in regular blood work. I've heard that as many as 10% of certain age groups might be infected.
You are welcome on my lawn.
Not saying I know fuck-all. Isn't there a good chance that the 1 percent that isn't finished off will become the new 99 percent?
So the first reports of AIDS started coming in a bit over 30 years ago. Ever since it was identified, and linked strongly with homosexual males, we've heard one preacher, imam and rabbi after another tell us how AIDS is a punishment from god visited upon a segment of humanity that richly deserves to die.
Well, I guess we've got some bad news for god. In just two generations...less time than a lot of the punishments god metes out (remember "even unto the third generation"?), we've pretty much got AIDS under control, maybe even cured.
So two possibilities: either god doesn't really care all that much about a mutual dick-sucking every now and again, or maybe...just maybe...god doesn't exist.
Either way, it's all good for rational people. I'll be waiting with bated breath to hear Pat Robertson explain how just a few people working for much less than a human lifetime managed to take this god-mandated death sentence for gays and turn it into a non-issue.
I can't help but wonder what the next failure of religion will be when it attempts to contradict science.
I've calculated my velocity with such exquisite precision that I have no idea where I am.
Antibodies are Os?
Play Command HQ online
But can the herb cure pancreatic zika chlamydia? Um, asking for a friend.
24 monkeys? Is this worse than the army of 12 monkeys?
I had to specifically ask for HepC in my std screening. If you go into a Dr and just ask to get full std screening, they more than likely won't include HepC. I've had quite a few by this point in my life.. it wasn't in any of them unless asked. I realize that's slightly off topic since the OP was referring to blood donations but it really should be in std screening.
And they have G?
It's far more expensive to market those drugs, apparently.
Gotta recoup those costs too.
No, the 99% refers to the % of HIV strains it kills. The 0/24 monkeys is an animal experiment. Totally different things.
Now we can get back to unprotected sex, needle sharing and no blood screens.
The major problem with HIV is that it's a retrovirus. It inserts itself into the DNA of immune cells and then stays dormant (sometimes for years) until the cells are stressed, so simply clearing the virus from blood plasma is not enough. Modern anti-retrovirals can eliminate every single live virus particle but they can't touch the reservoir of dormant virus.
Scientists are now looking at various gene-editing tools to get after it, like RNAi- or CRISPR-based therapies. It's not easy because the virus mutates easily but there's some hope.
The alternative is to keep hoping for a cure to a virus - something human being have never yet achieved.
We've eradicated smallpox in the wild, and barring any lab accidents or foul play at the few places holding samples, it should stay that way.
Too busy foaming at the mouth over shit you don't understand to actually read shit and understand it? Even the SAT has a reading test, should you be required to take it before commenting?
If these guys cure HIV they must surely get the Nobel prize for medicine.
== Jez ==
Do you miss Firefox? Try Pale Moon.
This is about the 10th time they've cured AIDS/HIV just in Slashdot's reporting. This is solar panel and battery efficiency all over again. I think both are at about 105% efficiency cumulatively. Why is HIV still a thing now?
it's FREE!
You have a strange definition of free
In my book – and many people's books – when you have to give up something, e.g. money, time, things you like to do, it's no longer free.
And I dunno, why could it only be hetero spouses? How would a monogamous gay couple spread HIV? Answer: they can't, not if they're truly monogamous. I think you just have a thing about homosexuality and you couldn't help but take a pot shot at gays.
And while recreational drug use isn't my thing, there are, and were, safe ways to use IV drugs. All we needed to do was make sure there was a clean supply of needles; you know, to control the spread of disease. But I know you don't like that because someone else (you perhaps?) probably would have had to pay for it. Why not, you don't like the idea of controlling the spread of disease? Oh, you're only happy when other people have to pay for it, is that right?
Yeah, so there is no Free solution, and there never was.
Just like anything else that 'cures'. It seems like this same kind of thing happens.
Some research comes up with something that attacks aids/hiv/cancer/whatever... shows to be a promising treatment/potential cure... and then... nothing. We never hear anything further about it. It never reaches human trials. It just, vanishes from all news.
Being that AIDS in wealthier countries is no longer the epidemic that it use to be, this is due to a lot of advancements in medical technology, where the HIV virus can be managed. Shows there has been progress in fighting the virus.
Dating myself a bit, but I remember when the Basketball Star Magic Johnson was reported to have HIV back in the early 1990's people assumed he had only a few years left to live, and countries boycotted playing against him during the Olympics. He is still around and healthy except for the HIV Virus which he will need to manage.
Back in the 1980's and 1990's HIV was mostly considered a death sentence, now it is more of a chronic condition which needs to be managed and safeguards to prevent it from spreading. This is progress, However we are past the Polio and Small Pox phases of medicine where you can just take a pill or get a shot and you are protected. So the progress now is incremental, and chances this drug may be effective but not for all people, and perhaps not forever.
If something is so important that you feel the need to post it on the internet... It probably isn't that important.
That's pretty common round here.
Good thing too - you're unlikely to catch anything that way.
Confucius say, "Find worm in apple - bad. Find half a worm - worse."
ISIS claimed responsibility for AIDS. ae911truth dot org
You can have the All Natural GMO Organic HIV Virus munch away at your Immune system until you are dead.
Poison Ivy is all natural, and Organic and GMO Free, and it is still bad for you, hence why it is called POISON ivy.
If something is so important that you feel the need to post it on the internet... It probably isn't that important.
Have you read why the FDA had rejected them?
There are a lot of ways to cure problems, but often the side effects are worse then the illness they are causing.
So it cures IBS so you don't need to go to the bathroom as often and less pain from gas... However you now need to get a new kidney or liver. Is that really better?
If something is so important that you feel the need to post it on the internet... It probably isn't that important.
"Welcome to core Statistics"
Lies, damn lies, and statistics.
Wake me when they can do straight math without needing to fudge numbers.
I believe another term for permanent sleep is death? It's definitely a sign of brain death not to recognize the value of statistics to our world.
Reality is a slackware box running on a 386 tucked away in god's sock drawer.
They can proceed to buttfuck each other with impunity.
Friction burns can get infected.
"we are past the Polio and Small Pox phases of medicine" Not following here... medicine is only getting more powerful and advanced. Medical science barely knew what bacteria were let alone viruses were when cures for these diseases were developed. Progress may appear incremental now but these diseases are being targeted at the microbiological level, which involves a whole new set of techniques. It looks incremental but the quantum leap of complete eradication of transmissible disease is around the corner, based on advanced techniques that were impossible even two decades ago. Might be a decade or two but soon it will effectively be impossible for transmissible diseases to escape the jaws of technological progress.
Yup, that's what the Reagan administration thought, too. They, too, forgot about blood donations and people who need them. Who then in turn infect their spouses and future kids.
Even they back then eventually understood why this is not going to work out, so I am confident you'll eventually see it, too.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
IBS is not a disease, it's a symptom, and a lazy hand-waive excuse. Find the real defect or disease, then you'll be on the path to a cure.
A comprehensive food allergy test might be a nice start for your IBS. Don't eat anything that causes an immune system response for you. Don't be surprised if this includes eggs, a specific type of nut, dairy, and gluten. If you cannot or will not completely avoid all of your allergy foods, then you'll just stay sick forever.
Whenever someone says "they'll never let ...", it's generally followed by the rantings of an uneducated conspiracy theory nut. So, stop ranting and begin educating yourself.
Yes, big pharma wants your money. Yes, doctors also want your money and can make mistakes in the process of getting your money. Some can even be dangerously incompetent.
They're doctors, not deities. If one doesn't deliver clear results in a timely fashion, fire him and move on.
God will now not only punish them there Qeeeayars, but the people who took away God's divine and loving punishment for them.
But seriously, this is pretty good news.
The shepherds did so well protecting the flock that the sheep no longer believed that wolves existed.
The dangerously ignorant zealotry in your post can be countered by smallpox
Since you aren't likely to read the article or anything that contradicts with your myopic world view, I'll quote the first two words for you:
"Smallpox was ..."
"Every time I see an adult on a bicycle, I no longer despair for the future of the human race." - H. G. Wells
Don't limit yourself to food allergies. Excess nasal secretion can cause many of the same problems.
It's definitely a sign of brain death not to recognize the value of statistics to our world.
There was a county in my state which had a 400% increase in the number of reported cases of a certain STD (can't remember which one) in one year. That's a massive statistic.
They went from 1 reported case to 4 reported cases.
It's like when the news reports the Dow or S&P 500 were up 0.3 percent for the day. 0.3 percent of what figure? From 100? 1000? 10,000? Giving that statistic is meaningless without a reference.
That took the Soviets and the USA working together for the common good. Nowadays the USSR is gone and the Americans stopped trying to even appear as the good ones.
"It's such a fine line between stupid and clever" -- David St. Hubbins, Spinal Tap
Uh, that's a 300% increase.
...at what point does a man just stop and say "you know, I think I'd like to have a dick up my ass!"
It's like when the news reports the Dow or S&P 500 were up 0.3 percent for the day. 0.3 percent of what figure? From 100? 1000? 10,000?
0.3 percent of the price at the previous trading day's close.
Giving that statistic is meaningless without a reference.
The reference is how invested you are in the market. A portfolio containing one unit of the basket for any particular index will be worth 0.3 percent more than it was worth yesterday. (The DJIA basket is currently 6.89 shares of each of 30 companies; S&P's is 112 trillionths of 500 companies' market cap.) Or if you had a $20,000 in an exchange traded fund (ETF) that tracks that index, such as DIA or SPY, it'll be worth $20,060.*
* Minus expenses, which tend to run lower for an ETF than for an actively managed mutual fund.
No, but the mice they're made in are. Humira (adalimumab) and other monoclonal antibodies are produced inside mice with human immunoglobulin genes, which are genetically modified organisms.
Percentage calculator.
What is four hundred percent of one? Four.
Four is what percent of one? Four hundred.
The point is, they're meaningless statistics. Obviously the closing prices are based on the previous day closing price, but without a reference, simply saying X percent increase is worthless. As I showed above, you can have a huge increase but the raw number of change is small.
Further, as you demonstrated, you need to know what you're basing the increase (or decrease) on.If you don't know that number, everything else is irrelevant.
The increase was 3 though. Not 4. A 300% increase on 1
buy now
And guess what, I'm glad I'm not a faggot.
It is not meaningless. It just doesn't mean something that you value.
They gave you the derivative and you're recognizing that derivative is only interesting to you if the absolute value (which cannot be inferred from the derivative) is interesting to you. If someone doesn't understand how to interpret statistics, they may not understand the limitations implied in the statement "there was a 400% increase in reported cases of the clap in Jackson County," but I assure you I immediately understood and anyone who regularly uses statistics to make inferences for business purposes would have inferred immediately. This doesn't mean the stats are useless just because a politician can hijack them to mislead the ignorant.
Your data point only shows that misunderstanding the statistic is dangerous and not useful. On the other hand, if we discover that the rate of HIV infection is dramatically correlated with number of sexual partners, have we not used statistics to infer a hypothesis for causality that is bloody useful? Or, if a business wants to determine how many units to make when entering some market so that it doesn't sink too much capital too early and limit its cash flow (and hence its profitability), then it can use stats in a highly profitable way. Stats was also extensively used to track the inbound progress of a storm which probably saved lives in Florida and Houston, recently. Do you really want to take the position that statistics is useless?
People who blame stats for being "lies" are like people who hear a politician lie to them using English and blame English. In nearly all cases, you should either blame your ignorance, the person trying to leverage your ignorance of statistics to inject an understanding that isn't useful, or both.
Statistics is a triumph of modernity which is increasing our quality and length of life.
Reality is a slackware box running on a 386 tucked away in god's sock drawer.
If you're invested in an all-market fund, the rate of change in the market is meaningful to you. This is the point you're calling "meaningless". Do you not understand it?
How do you acquire an answer to the question "what is the change in my all-market shares since yesterday?" There is no way to answer this question without the information you call meaningless.
Reality is a slackware box running on a 386 tucked away in god's sock drawer.
We've *almost* finished off polio as well - the yearly infected total has been below 100 for a while, and two out of three strains are probably exterminated.
He just meant that the low hanging apples have been picked. You, of course, are talking about designing ladders.
Space Shuttle was a program that strapped humans to an explosion and tried to stab through the sky with fire and math
Speaking of monkeys with AIDS, it's Khyber everybody!
Sounds more like níggers to me. Like níggers, AIDS came out of Africa. So did killer bees (Africanized bees!). So do blood diamonds.
Black is the color of evil for a reason! If it's black it's bad! If it's from Africa it's bad! For safety! For the children!
Suppose I invest $10K in a market fund. 0.3% means I've made 0.3%, or thirty bucks. It doesn't matter what the market is at in the first place, because that affects only the number of market units I bought, and I really don't care about that. The number I'm interested in (how much is my investment worth today) is directly derivable from the statistic you call irrelevant, and I don't care about the one you consider necessary for relevance.
"When you have eliminated the unacceptable, whatever is left, however improbable, must be the truthiness" - Holmes
There's an old saying, "Figures don't lie but liars figure."
"When you have eliminated the unacceptable, whatever is left, however improbable, must be the truthiness" - Holmes
Back in the 80s when the military was being told that HIV was 100 percent fatal in ten years and had a 25% transmission rate (much higher than the common cold); I was told to sit down and shut up when I opined that we would more likely find a portion of the population would be found to be carriers but asymptomatic and some people would have a natural immunity and the fatality rate would taper off when information was in hand.
A vaccine for a rapidly modifying virus, such as HIV or influenza, is quite problematic. I'm glad to see someone is making some progress.
As to the "it's a faggot disease" crowd; I was happy to find out the Dental Technician I served with in the Navy was still around and on his 26th year of antivirals to keep his HIV infection under control. He was bitten by a patient. No longer able to care for patients, he works in a prosthodontic lab making crowns and dentures. He made the crown I had put in last year and sent a note for me to call along with the tooth sent to my dentist. I had a sphincter tightening 18 months after responding to an accident and getting blood all the way up to my elbows and sprayed into my face from a girl we later found was HIV positive. Back in the 80s; they wouldn't declare you free of infection until they had three tests negative taken six months apart in addition to an initial negative test. A nurse I knew in the service died of HIV contracted by an inadvertent needle stick caused by a recalcitrant ER patient. Even if the majority of documented cases are from gay men; it ain't a faggot disease.
NRRPT/RCT
Hello let me give this testimony to the public about a great man who help me out in serious illness I have HIV AID for good 5year and I was almost going to the end of my life due to the way my skin look like all I have in my mind is let me just give up because life is not interesting to me any longer but I just pray for God every day to accept my soul when ever I’m gone lucky to me my kids sister run to me that she found a doctor in the internet who can cure HIV AID he help me out on everything the man ask for my picture, so he can cast a spell on me from his temple after all he ask is done 45mins later I started getting more stronger my blood start flow normally for 4 to 5 days I start getting Wight before a month my body start developing my skin start coming up after 2month I went for HIV test and I was tested negative I’m so happy that I can say I’m not a HIV patient if you have HIV AID or any sickness please for your save contact him via peterwiseherbalhome@gmail.comor add him up on whats app +2349051208634