Slashdot Mirror
DNA Encryption
brn writes "There is this BBC article that talks about hiding information inside the DNA. Very interesting and well worth a read, apparently information hidden this way is virtually undetectable.
" It's the espionage agencies that first got interested, but the notion of "watermarking" is another that is brought up-and you thought PIII ids were bad.
Who wants to become a DNA courier for the fucking CIA, Mafia or the chinese Triads ?
By the way, can I store my PGP key under my skin ?
For once there is a technology that they cannot patent. Why? If I remember, there was a two-part Star Trek episode that dealt with hiding (encoding/encrypting) data into the DNA of all living things. They (the crew of the Enterprise) decoded the data (with help from many other species) and found a message for all sapient beings.
Heh, invented in the 60s. Let's see them patent that.
-B
i thought microdots were for lsd... silly me =]
This krypto stuff is vaporware. Many scientists around the world make extraordinary claims that later are proved false, inacurate or pure show off.
Don't believe the HYPE spread by organisations such as the "BBC - The British Spinning Machine".
It is generally acknowlwdged that the military (NSA et al included) than the rest of commercial technology. I'm sure that the spy agencies have been using this technology for years....if its just being 'discovered' now, then the military has most likely had it for nearly 10 years already...
Just think of how many kkeys/s the NSA's computer gets....it can probably crack 128 bit linear crypto in days. Just think: MIT has just 'discovered'/'created' a quantum computer--sure it doesn't do much now, but think of 10 years later. The NSA probably has lots of powerful quantum computers routinely cracking crypto.
Well, if you wanted to mark people, you'd have to also embed something that was easily decipherable by standard methods (deconstructase reactions, say)...so maybe the Koran followed by a bunch of nonsensical pairs to make the ratios work out right.
:)
"The blue duck flies by the light of Io" -- Kosh
(or something like that -- who knows?
Adelman wrote about DNA computing, including the travelling salesman problem, in Scientific American. I think the issue came out about 8 or 10 months ago. Very interesting.
Hm, that's a cool idea (storing your PGP key in your DNA). I personally think the idea of putting encoded DNA in humans is ridiculous. Not "scary", just ridiculous. I mean give me a break...There's easier ways to hide 2k worth of info...But anyway that's beside the point. Remember the article about the iris scanner? I wonder if there'd be some way you could use your iris fingerprint (or your thermal facial photo...those would be easier, if you could figure something out...) kind of like a private key...So you could sit down in front of a scanner, have it take your picture, and then it would use that to decrypt whatever you needed (incoming messages, whatever). It would have to be very secure tho, so that faking it would be as difficult as possible...That or just don't use it for any information that's "too sensitive" or something. Sure there's things to work out, but it's a cool idea...Takes the fingerprint one step further and uses it to decode stuff instead of just accessing databases and crap. Whatver...
Most people are not aware, that in the UK in order to use a TV one must pay about $160 for a license.
You can't avoid it even if you want to watch other programs, so effectively this is a tax from every single person, you also has to pay if you have a TV-card in your PC. How about that?
Whoa, cool idea. Put up a "cover" website, and then put gifs or jpegs on it. You know, "This is a picture of me with my kitty. I love my kitty." Or whatever kind of crap. And then everyone has a special Netscape plugin, for example, that takes some secret key and grabs and decrypts the hidden data...And displays it as a website. So you could "surf" (geez I hate that term...) a huge hidden website. Following links to other steganographically encoded/encrypted images... That's a pretty cool idea...I think I'll add that to the long list of things to do when I finally get up off my butt. Haha...
Store the source code for Windows 2000 and one of the DNA segments might just happen to code some deadly virus (the biological kind) and kill us all. The human genome is like a hard drive. Sure there's endless chains/clusters of blank, unused sectors, and yes, you can hide data in there. Put data in the wrong sector and you may find that the system suddenly freezes up or crashes, or takes down your whole LAN.
Actually, the Adleman work was in Science, not Scientific American. It was 1994, probably November. Hopefully that'll help anyone interested.
Who, it seems to be possible that this method, used during the progress of cloneing, allows to mark a human during his
whole life without any chance to remove it...
With the exception of identical twins, we all have different DNA sequences already. We are all marked with no chance of removing the mark. And it has been used for quite a while too, in crime investigation and for determining a kids biological parents. Get over it.
Adleman's original paper was indeed in Science, but he also wrote a more accessible (and nicely illustrated) article for Scientific American last summer.
Adrian
adrian.heilbut@utoronto.ca
It would all depend upon the length of the DNA strand. You have four bases, so each base could (in theory) represent two bits of data. So I would imagine that you could fit a good bit of information onto a long enough strand-- but I'm not sure how long a strand you could embed into the DNA of an actual human being without causing problems-- i.e., cells interpreting the embedded information as the bases for a protein, etc. But I'm sure a little research will turn up answers.
Incidentally, it might also be possible to embed information through other means:
When creating a DNA fingerprint, enzymes are used to "slice" a strand of DNA whenever a certain sequence occurs. The result is a whole load of smaller DNA stands, each with different lengths-- the exact number of strands and their lengths is unique to each person/animal/whatever. A small electric current is then used to pull the miniature stands across a special material. The smaller strands travel more quickly across this material than the large ones, causing a unique fingerprint that looks something like:
|| ||| | | | || ||
If an organization (say, maybe, the NSA) were to sequence a strand that were to be cut at certain points by the right enzymes, they could (in theory) create a strand of DNA whose fingerprint represents a bar code that holds data.
Any other ideas for data hiding in DNA?
Another interesting article by the BBC. The Real Audio file is good too if you check it out.
I think European media in general is so much better because they are sponsored by the state. The European states have checks and balances to make sure the media is not a propaganda tool. Our American media does not have the same safeguards to prevent commercial interests from twisting the news.
Espionage (at least the popular meaning of the word) tends to be more oriented towards obtaining information that you shouldn't have. So an agent infiltrating an organization and obtaining their five-year plans would be espionage -- but how he sends it back to his home agency is SIGINT (signals intelligence). Unless, of course, he just walks... :)
:) is going to have a little of your DNA on it; so mixing a message sequence in and putting the cypherdna on the letter isn't an issue.
In some sense, this brings new meaning to the old joke about BTP (bipedal transfer protocol)...
Tampering with human DNA, though, isn't as bad as it sounds. The demonstration in the article doesn't involve any tampering with DNA in an organism -- a letter that you write and send (yes, some people still do
As for humans: it's not like that one Far Side where a kid is sitting on an airliner, and his armrest contains a "Wings Stay On/Wings Fall Off" switch. The human body would interpret a little random junk in the occasional DNA strand as just that -- random junk. It won't kill anyone, make them grow a third arm, or even turn them into Steve Gutenberg (halleluia!) Keep in mind: (1) They're only affecting one out of every 30 million (something like that) DNA strands, and (2) they're not going to give you a pill that transforms every DNA strand in your body.
I'd imagine that, if a human were to be used as a carrier, they'd doctor up their DNA appropriately and then inject a small amount just under the skin (like a tuberculosis test). The solution would stay for a few days before dissipating throughout the body, so there's no effect on the "packet" (if you will), and it's easy for the intended reciever to extract and decode the message (whereas an enemy would have no idea where to begin, and couldn't do anything nasty to find out before the solution dissipates). So, even though it sounds a bit scary, it's not so bad. (How much worse is it than high-strength encryption?)
BTW - I'm not sure about capacity. Something like 90% of our raw DNA is thrown away and not used to make proteins anyway: if the data were placed in those portions, we could be talking about data capacity in the tens of thousands of base pairs. A base pair translates to two bits, (assuming you have a scheme to tell which backbone is the one you want), so if we use 10,000 base pairs, we can encode 20,000 bits (or 2.5 KB) of data.
Great, so even though we still really have no idea how DNA works (we do know it's not quite as simple as "codons 3 billion through 3 billion and four determine if you're blonde"), we're going to go using it for steganography. DNA is not like jpegs, people. We can't be sure there's such a thing as a "least significant amino acid". What if it turns out that writing "This person owned by Gene-Corp" means "cancer of the armpit" in cell-speak? Then again, perhaps we'll have some sort of wacky scenario in which a Johnny Genetic courier suddenly manifests Akira-like psionic powers because he's carrying Yakuza bank account numbers in his DNA. Heh.
It sounds just like chaffing & winnowing, except using DNA instead of packets.
What amount of data could you store in DNA with that method? I guess this may be the first true molecular storage device. However it is hopelessly redundant since it has many DNA strings all with the same sequence stored on them. But considering the amount of data needed to encode a human being, I imagine you could possibly put audio/video streams in a sequence. Would take a while reading it back though, forget about streaming it.
Gee. Why don't cattle ranchers stop branding their cattle and just keep the animals' information in a big centralized database?
People don't crash or erase their own DNA. Not to mention the space that would be required to store that volume of information in a database.
Let's try not to let fact interfere with our speculation here, OK?
They don't need to sequence 30 million strands of DNA. PCR amplifies out a target DNA fragment using oligonucleotide probes which are specific to regions of DNA. After the PCR has been performed, the purified PCR products may be sequenced quite easily, in a single step.
Let's try not to let fact interfere with our speculation here, OK?
hmmmmm....so now we can watermark our leach-neuron claculators with all sorts of info :)
Who am I?
Why am here?
Where is the chocolate?
What is your Slash Rating?
I agree that that is what the article said, but what is to prevent them from actually inserting that DNA back into a cell? From what I gather from listening to news reports on sheep cloning and such, you can't insert DNA into adult cells but you can insert it into embryonic cells. And, of course, there has been fetal tissue research as well. Would it be possible for someone to introduce the modified DNA strand into fetal tissue and then place that tissue into an adult human?
Who am I?
Why am here?
Where is the chocolate?
What is your Slash Rating?
What's next?
Werd.
It could be placed in the interons. With sufficient care it would do no biological harm there.
Risks? Sure, plenty of them. But since when have intelligence agencies been concerned about risk, especially when it's someone else at risk.
More specifically, the risk is that the interon sequence may end up active if an unlucky data stream is coded there.
I'm not too worried about that since there's not much (if any) advantage to embedding the coded sequences into an organism's genetics vs. simply placing the DNA on something. For example, simply spraying the coded DNA on a courrier (possably an unwitting courrier) and collecting a sample of that courrier's dead skin later.
Example, sequence your message. Suspend the encoded DNA in a liquid carrier in an atomizer. Go to the airport and spray a suitable tourist. Tourist goes and has a nice vacation. Agents at the destination collect DNA from bedsheets at the hotel. Tourist is none the wiser, and not in any danger unless enemy agency finds out they're carrying a DNA code sequence.
The genetic material you already carry is sufficient to uniquely identify you. There's no need to add a watermark.
... yeah, right, and Gulf War Syndrome was sold by US Biowar companies to Saddam Hussein back in the '80s while he was at war with Iraq, and used on US troops in Desert Storm, and now the USAF is spraying US cities with a genetically modified virus to impart US populations with resistance to the Syndrome so we don't catch it from the infected troops returning home. . .
http://strangehaze.freeservers.com/index.html
"The number of suckers born each minute doubles every 18 months."
-jafac's law
These are my friends, See how they glisten. See this one shine, how he smiles in the light.
. . . and this idea comes from the X-Files. . .
"The number of suckers born each minute doubles every 18 months."
-jafac's law
These are my friends, See how they glisten. See this one shine, how he smiles in the light.
Or get this, for a way to pass a message undetected:
Incorporate a secret message into the DNA of a highly contagious (but non-fatal) flu virus, infect yourself. Spread the disease around by copughing in the subway, etc.. Disease spreads around the world, and is picked up by destination lab, sequenced, decoded and message is delivered. It's a tradeoff; slow delivery time vs. a untraceable delivery path (i.e. no radio or message handoff).
An esoteric scratched itch:
Homeworld Map Maker Tool
No, the technique itself can't be patented. However, bizarre though it sounds (at least, it does to me), individual DNA sequences can be (and routinely are) patented.
"The invisible and the non-existent look very much alike." -- Delos B. McKown
The BBC is of course state sponsored, by that nasty television tax. The biggest advantage of this has to do with the fact that the UK government forces the BBC to provide programming which the market would not have otherwise done. How big this advantage is, occupies debate. If the market would not have paid for the programming, the audience to see the programming probably doesn't exist either. On the other hand, it does allow some good shows to be produced and perhaps one of them may be a sleeper that suddenly has a tremendous impact on people.
However, privitization of the BBC is always talked about. These days, people in the UK, like here in the US, have access to satellite/cable television. Since there exists a good market for quality programming, there will be a channel with that programming. Competition is hurting the BBC, especially with regards to news. The news.bbc.co.uk web site is outstanding, and it is a result of severe competition in the news industry...huge investments were made to make it possible.
The thing is, the British, in general, have a higher demand for good quality news than Americans do. I need not remind people that the magazine "The Economist" is outstanding, and is not state sponsored.
Quality local news happens in the US, and it is the result of markets. A report is available which shows the percentage of households watching news in metropolitan areas. Columbus, Ohio, my current home, is rather low on the list, despite the size of its metro area population, consequently, the news isn't all that great. On the other hand, the other "C" cities--Cleveland and Cincinnati, are both in the top 10, and the news programming is more diverse and higher quality. Good broadcast jouralists strive to be in the higher rated cities, and it is no coincidence that Cincinnati has been a point on the way for some to become national anchors (including Jerry Springer, which is another story.)
My point is, Americans seem not to demand higher quality news (and it is not like it isn't available...for instance, the Macneil News Hour on PBS is very good, but underwatched. NPR is excellent, and is on par with BBC radio.)
I am not sure about the checks and balances statement. The BBC is more curtailed in coverning British government than American news organizations...because of tradition and law.
I'm as naive as most others when it comes to biology, but it seems as though it would be unlikely to have tagged DNA in a living being. The reason steganography works in, say, image files is because there are unused bits in there. I know of no such unused space in DNA; once you change it, you have a fundamentally different string. What does that add up to in a living being? Cancer?
An expert clarification would be appreciated.
It beats having a barcode tattoed on your arse ;)
If you really want to categorise people like this, why not just have a big database with everyone's DNA fingerprint in it, with an attribute on each object that says what category it's in?
I don't claim to be expert, but something like 90% of all human DNA is 'junk' (now called something else I think), i.e. not known to code any proteins. This so-called junk DNA may in fact have some subtle purpose, but as long as the 'watermark' was coded into junk DNA it should be fine.
For some reason this made me think of chaffing and winnowing, in which a series of messages are sent, each with a message authentication code (cryptographic checksum) that marks the message as authentic (i.e. you can check that it was signed with the sender's key). Any messages with fake MACs are noise that is filtered out by the receiver. It was described on the Net, and you can find a description under rsa.com somewhere.
The proposed scheme is really steganography, but if you encoded a number of messages into DNA, you would just need to attach MACs to the real messages and fake MACs to the fake messages, adding significant security.
I guess the marker that lets you pick out the signal from the mass of human DNA is rather like computing the MAC and finding that it matches the included MAC of a message.
Of course, you could just encrypt the signal messages instead - chaffing and winnowing is really intended for when you want to 'encrypt' without using any encryption, so to speak (only authentication is used to achieve confidentiality here.) However chaffing and winnowing helps by making the actual signal messages very hard to detect.
Hey everyone, this is not encryption. Why? The message itself is never obfuscated or transformed in any way, instead it is merely hidden among a lot of other DNA, on a very small dot that wouldn't be noticeable under brief scrutiny. The only similarity between this and encryption is the existence of a secret (the base-pair sequence of the DNA strand "caps") between two parties.
There is a term for this type of message-hiding, but it's eluding me (someone around here knows it, I'm sure...). Other popular examples include:
Again, this is different from encryption because the important message is hidden in an otherwise benign and useless message. So the hard part of breaking the system is knowing whether a message is hiding another message. Once you know that, breaking the scheme is pretty trivial - there's no computational complexity behind the system.
Reminds me of a short story by Kelvin (John Walker) "We'll Return, After This Message"
Not great fiction, but it is interesting to read it ten years later in light of this story and the SETI at Home news.
(All _my_ slaves have the same genetic watermark.
--
--
The Internet is the Suppository of All Knowledge. You get it in the end.
The problem with this method is an ability to synthesize long stretches of DNA. For now only 100 nucleotides (it is enough for 20-30 latin letters) can be made in one set. To write a one page report would cost enormous amount of equipment time and money.
This is amazing that Nature published this paper.
The idea is on a surface. For years one letter code is used to define aminoacids and stop signals and people have fun putting their names in DNA for a long time.
1) First, you can do it too. check out the DNA-o-gram generator:
Encode your own secret messages in DNA code. Now all you need is a synthesis machine to create your encoded ladder, and someone to give it to whose got some good biology knowhow and a gene sequencer machine. (I'm sure there are plenty of people in column A, but not column B)
From the limited information in the BBC article, it seems pretty unlikely that this type of encryption will be widely used. The expense and effort that would go into: ...)
... this would give you other ways to send your encrypted message (in food, tiny vials, a handshake even!). Of course, this would still be expensive and time-consuming ...
... Now I will have to read the actual Nature paper to see the details!)
a) modification/creation of desired DNA sequences
b) DNA analysis
would make this technique prohibitive. And, in terms of security, how many people would you trust in these labs anyway? (A one-man operation would probably have trouble handling many samples
And, as mentioned elsewhere, this technology is nowhere near the point where they can insert coded messages into your own genome! They could, however, put the information into self-replicating circles of DNA (plasmids) that can be propagated in microorganisms
(Before I began my developing career I was a molecular biologist, and stories like this always catch my eye
YS
"Arrr! The laws of science be a harsh mistress." -- Bender
I don't know squat about cryptography, but I find this cool. I had actually thought of writing a science fiction story along these lines a while back but well, blah, blah, . . . I didn't.
The cool part about it is no one expects a message. If you send someone a CD, papers, e-mail, anything than it suspect. But if it's in DNA, inside someone, they pop in, leave a drop of blood or a skin scrape, voila message delivered.
Or how about using someone (something? . . . dogs, cats) as an information repository. They walk around with all this data encoded in them and who would know? *They* might not even know.
One thing that's pretty cool is you can layer information in DNA sequences by making a one base pair frameshift. There are viruses that use this technique to pack as much genetic information into there small head capsules as they can.
It looks like this:
ACG ACG ACG ACG
CGA CGA CGA CGA
GAC GAC GAC GAC
Of course, that's if your using 3 base pair codons, it might be easier to encode using straight base pairs. Which would allow for more storage? You might have to use natural codons though, in order for them to exist/be replicated in your snazzy new BioDrive (TM).
. . . Act now!! Store all your pr0n, ROMs and MP3s in the privacy of you own DNA, never leave home without them again!!
Who, it seems to be possible that this method, used during the progress of cloneing, allows to mark a human during his whole life without any chance to remove it...
Normaly I'm luckey if people find another way of data-storage. But this expectation realy scares me.
I sure hope none of the goverment branches will use this for espionage... somehow the idea of tempering with human DNA seems a bit spooky to me
The human DNA is removed a person and mixed with the coded DNA just to present background nooise. The DNA isn't biologically active and in fact would get chewed up by polymerases within biological organisms.
"When you sit with a nice girl for two hours, it seems like two minutes. When you sit on a hot stove for two minutes, it
With eletronic eyes, neuron computer and other add ons seen here we thought that could only be it. Now they tell us about converting our dna to basically Harddrives...
Starting to sound like Farenheit 451, everyone will be all happy, with no emotion and no real thinking.
I ate my tag line.
I ate my tag line.
-=Ellis (D)25=-
These vans are not capable of detecting a single tv set in your room. This is technically impossible (your tv is only recieving programs, not sending. Their equipment is not that sophisticated to scan the low emission level of your tv). All they are doing is to test the quality of terrestrial broadcasting.
In Germany we are having the same system of a monthly tv fee, collected by the GEZ (Gebuehreneinzugszentrale). You are expected to pay that fee, and they sometimes send people to households who don't, trying to find out whether you own a tv by asking trick questions or something like that...
God, root, what is difference? - Pitr
It looks like the end markers tell where the message is and the message itself is not encrypted so much as just remapped to a different alphabet. The technique of hiding messages is called steganography (not encryption), and this instance would have to be the best example of "security through obscurity" I've ever seen! ;-)
But creating the message - how could that be done quickly? Doesn't it take some time to create a specific DNA sequence? I can't imagine we can do that quickly outside a lab.
If this holds, the best use I can imagine is in "fingerprinting" items. Imagine them used like "taggants" in explosives. First you create a a whole library of different sequences (a precomputed alphabet) and then assign them to specific items or specific lots of items you want to track. One hundred dollar bills, for instance. The detection lab kit would then become a standard part of the counterfeit detector's toolkit.
Anyway, my point really is that this new thing is really useful in the signature scenario than where you want to send an arbitrary message.
OK, in crypto language what we have here is a symmetric, secret key system where the key is the marker sequence at the ends of the DNA chain (I'm assuming the coding of the message into four bases is trivial). To put it into a more commonplace form, imagine taking your plaintext, encoding it into, say, the lower bit of 3 seconds of an audio CD recording, putting it into the middle of an audio CD and then sending it to the recipient. The key is knowing which 3 seconds to decrypt. Accordingly, you need a secret key which tells you: when you see a, say, 0x6a6c7ff45c054 sequence, start decoding. The advantage of using DNA is that your "CD" is very very long, but you can compensate for this in a variety of ways.
So, while this whole thing sounds cool, cryptographically this is nothing new and has no particular advantages (all the problems of dealing with secret symmetric keys, etc.). No wonder the NSA was not interested.
Kaa
Kaa
Kaa's Law: In any sufficiently large group of people most are idiots.
You and a lot of other posters forget that there is absolutely no need to watermark people -- everybody is already "watermarked".
Consider this: to watermark a person you need to access his DNA and insert a watermark, then access it again to read it. Well, if during the first time you just read his DNA (which is unique) and the second time read it again and compare to a database -- voila! exactly the same result without all the unpleasantness of invasive DNA surgery. Why do you think reasonable people get worried when the police decides to take DNA samples from everybody arrested? (I don't know if the law/regulation to that effect passed in New York, but was definitely considered).
Kaa
Kaa
Kaa's Law: In any sufficiently large group of people most are idiots.
What if the DNA gets X-rayed and the message mutates? "Assault on target zero to begin at dawn" could become "Killer wombat found on moon" :-)
They have vans with TV detection equipment in. I don't know how it works; I guess it can detect UHF receiving equipment somehow. If they detect a TV in your house, and you haven't paid, you can get slapped with a hefty fine.
BTW: Owners of black and white TVs are charged a lower fee, and TV receivers which don't display a picture (sound only, for blind people) aren't taxed at all.
Hey, Asimov's from June 1999 has a story called "Written in Blood" by Chris Lawson that covers this idea. Highly recommended.
This seems like something out of a Neal Stephenson book, pretty neat. I have to wonder about the stuff they can do that they *are not telling us about* You can bet that there are some geek scientists in an undergroud bunker doing working on something that would make your head spin.
DNA statistical models could be used in more clever ways than in the BBC article to encode messages that looked like other DNA. This is not difficult and could be done today.
Even better would be to exploit the biological machinery by creating a message in a synthetic gene that is expressed in the presence of some regulatory element, perhaps a synthetic small molecule.
This news was on slashdot a while ago (a week or two maybe). Not this specific article, but talking about the same paper they're talking about.
that last bit didn't come out quite right- that'll teach me to preview!
--Gene B
3'TGACTAGTACGTCATGAAGTCAGAGGGTC5'
5'ACTGATCATGCAGTACTTCAGTCTCCCAG3'
Gene A-->
can't seem to learn the difference between submit and preview, can I?
I'm assuming my inadequate HTML knowledge is screwing up my arrows, so I can't draw the positions correctly.
That Gene B thing should be over to the right, with an arrow pointing to the left.
It's just a nit that I'd like to pick,
but without knowing the PCR primer "password",
it's unlikely that you'd be able to amplify
enough DNA to read its sequence.
So, no: The DNA is not exactly sitting there
"in the clear" and able to be read. Not only do you need to know where it is, you also need to know a little bit about what it is.
But, yeah, technically you're right: The message isn't encrypted. Encoded, certainly, but not encrypted. Maybe if you define "encrypt" as "hide" but I digress.
whuppy enjoys smelling like diesel fuel
This article is so content-free, it hardly
bears comment except for the hysteria it seems
to be inducing.
First of all, the technology described here --
synthesis of DNA oligomers and use of the polymerase chain reaction (PCR) to detect
them -- is old hat. Every molecular biology lab in the world has been using these techniques
routinely for over 15 years.
Second of all, coding DNA into something
biologically "meaningful" is orders of
magnitude more difficult than spelling out a message.
Finally, you all already can be uniquely identified by your DNA. Nobody needs to implant an ID in you, Big Brother can just take a drop of blood from you and store your DNA fingerprint in a database if he thinks you're worth looking after.
In closing, I would urge everyone not to look at biology (or even bioinformatics) through a hacker's eyes -- it doesn't work; the two fields don't map to each other well.
Oh, PS: If you want to see something genuinely cool being done with DNA by a hacker, check out Adleman's (the "A" in RSA) tackling the travelling salesman problem with DNA oligomers. (Sorry I don't have a cite handy.)
whuppy enjoys smelling like diesel fuel
Haven't seen this addressed before, but considering we haven't completely mapped the human genome supposedly, isn't there a sort of danger that our hidden data might cause some problems whether inheritable or accidentally causing a disease or something? Anybody have any idea?
Doobie Doobie Doo- Beware The Penguins
the sci-fi movie i was thinking of was Terry Gilliam's Orwell-esque "Brazil" the gripping black cult classic. home of the infamous Ministry of Information, who still manage to blunder through to a bent and bizarre beurocratic end despite a shitload of blundering enroute. it all begins with a typo...
this DNA watermark story has all those hallmarks. to the point it relies on alphabet conversion to a piece of DNA spelling out " the secret message in the middle, plus short marker sequences at each end" then these synthetically engineered strands are just "slipped into a normal piece of human DNA".
gee i hope their data entry staff have high accuracy levels! no room for error...and what? do you meet these encryption chicks in bars, they lure you back to their place to privately encode you? or boys for us girls?
makes james bond and bond girls look postively small town. but probably far more likely.
BLAMMO shaken not stirred
Hmm, I don't see much use in DNA as a message carrier. You can't artificially synthesize more than a few hundred base pairs at most, and even Nature's best polymerases can't do more than a few million without making a mistake. Nor is it possible to use PCR to amplify a message of more than few thousand base pairs. Reading the message, by means of a sequencer, will also be a slow and painstaking process.
But isn't the purpose of the Doomsday machine lost if you keep it a secret!
In last month's Asimov's Science Fiction magazine there was a story called Written In Bloodabout someone who develops this kind of a technology and uses it to inscribe passages of the Koran into the blood of believers. Since this would be passed down from parent to child it could be used to mark Muslims in a way that was impossible before. It raises some interesting ideas about uses for writing in the genetic code of humans. I recommend the story and the magazine in general.
"Understanding is a three-edged sword"--Kosh
So, how do we know that someone or something hasn't done this already? Like, maybe we're just a carrier for a message, a carbon-based animated post-it that some other critters will read when they arrive, like "nice real-estate in this quadrant of the galaxy". Or maybe we are the message, the expression of some higher order of process... like Alan Watts said, "the universe is peopleing." I kind of like that one. Life forms as artistic creation of 4.5 billion year old massively parallel molecular supercomputer.
Too much. I have to go lie down now.
1) DNA encryption is really no different from any other nonobvious code-based encryption. You must still transmit all the information to decode the message in a secure manner. The method referred to in the BBC article operates in the same manner as the DNA-o-gram generator (try it out), except that the code is generated randomly. If someone were to intercept the DNA-to-text code and the information necessary to isolate the coding DNA from the "noise" DNAs, they could crack the code.
2) This has nothing to do with human DNA. There is DNA in everything from the fungus between your toes to houseplants. The DNA used for encryption would probably be chemically synthesized.
3) A good sequencing run can read 1000 bases of DNA. Because three bases correspond to one english letter, you could get ~300 letters at a time.
4) You would be better off adding fake gene sequences to a gene database and giving someone the keys to decrypt it. That saves all the hassle of synthesizing and sequencing the DNA.
A description of Adelman's solution to the travelling salesman problem can be found at http://dna2z.com/dnacpu. (whuppy)
I sure hope none of the goverment branches will use this for espionage... somehow the idea of tempering with human DNA seems a bit spooky to me.
And in the wrong hands it could become a very dangerous (+efficient) method of info transfering.
BTW - it doesnt say how much KB you can "stuff" into one person's DNA sequence...ne idea ne1?
To the fool, he who speaks wisdom will sound foolish. ---Euripides
We are basically walking computers using vast amounts of data to move/think/eat/sleep - With this new method, instead of people having to go to school and waste their precious lives away learning absolutely nothing, they could, instead, have information injected into their DNA, making them evolve from a complete moron, to an absolute, omnipotent being.
The only problem with this is that the government(s) will not allow this to happen, considering they like to keep knowledge imprisoned away from people - the goverment hates it when people get access to huge amounts of knowledge. That would explain why all our education systems suck - hardcore. Death to the United States, I say.