Slashdot Mirror


User: maclay01

maclay01's activity in the archive.

Stories
0
Comments
8
First seen
Last seen
Profile
(view on slashdot.org)

Comments · 8

  1. Spiderman trailer pulled on More On Tragedy · · Score: 1


    It's interesting to note that the Spiderman movie site has a "will return soon..." message and that quicktime, who housed the trailer, has pulled it. The climax of the trailer was a shot of a helicopter full of bank robbers caught in a giant web between the two towers of the WTC.

    Please donate. It'll increase your stake in this mess.

  2. The answer is nigh on Dead Sea Scrolls Copyrighted? · · Score: 2


    To gain insight into this debate all you need to do is look to the bottom of your Slashdot page.

    All trademarks and copyrights on this page are owned by their respective owners. Comments are owned by the Poster. The Rest © 1997-2000 OSDN.

    Now if the autor of the scrolls had so much insight why didn't he foresee to ad something like this to the bottom of each page?

  3. In my day... on Video Games and ADD · · Score: 1

    These kids don't know how good they have it.

    Back in my day, I had to learned how to ADD, I wasn't born with it. I had to learn how to SUBTRACT, too and MULTPLY. Now they're saying playing games helps kids with ADDing.
    I'm truly living in the best of times. I wish I had all the things that kids today have. I really would've been someone...

  4. Re:What about the dinosaurs? on Salty Ocean On Europa Could Mean Life · · Score: 2

    "Never before has a species that's evolved on this planet been able to leave the world that it was created from"

    I'm gonna have to disagree here. Nobody can figure on what really happened to them dinosaurs. Hell, they might living in it up on a solar system close by watching us through big binocs.

    I subscribe to the theory that we are the product of an interferring race that came down and genetically engineered us from apes way back when. They needed creatures smart enough to follow orders but dumn enough to not get any bright ideas. They took away our strength so we couldn't revolt effectively. Then they had us mine precious metals and left us to fend for ourselves when they got what they wanted. Hey it explains the missing link and wouldn't we do the same if we could?

  5. Re:Prime Directive on Salty Ocean On Europa Could Mean Life · · Score: 1

    I always thought the prime directive was a bit pretentious anyway.

  6. Clarke had his scientists on Salty Ocean On Europa Could Mean Life · · Score: 1

    Here is my little bit of knowledge I recall from an interview with Arthur C. Clarke.

    When Mr A.C. Clarke wrote 2001 he was going on the unpopular theories of a few scientists of the day. They predicted that the heavy gravity of nearby Jupitor is why there would water under the Ice. The friction created from the variations of gravitational pull heat the ice and the rock. The ice on top is like our ozone. It protects the hypothosised creatures underneath from the ravages of vacuum space.

    Imagine the frist of these creatures to crack through the protective shell with the spirit of a Columbus or Magellion only to find an American flag and a discarded rocket booster...

  7. Woz the hacker / Gates the cracker on Wozniak Interview In Failure · · Score: 1

    Before Gates hired some lacky to back-engineer someone elses OS for IBM, Woz was building his company from money selling boxes to hack long distance. How cool is that?

  8. Re:What exactly this Human Genome is at this point on Human Genome Project Believed Complete · · Score: 1

    My Result (Damn Hollywood promoters are everwhere):

    EthanHawkeasVincent&Jerome/UmaThurmanasIreneCass ini|Homo actorus1997sequence /len=122mins
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA