Q: I read somewhere that Whistler will feature a new feature to finally cure "DLL hell". Is this true?
A: It sure is. [...] In Whistler, applications will think they're copying their [DLL] files as usual, but the OS will manage the process so that they don't actually overwrite any existing files. Then, each time the application is run, Whistler will ensure that it only uses its copies of the files, ensuring that all apps run correctly and none of them are able to get in the way of other applications. Microsoft says that this feature will "isolate applications from each other, providing users with a 'run once, run forever' environment.
So basically M$ is negating the whole point of DLLs here. Great. Instead of one copy of BLOAT32.DLL, you'll have BLOAT32.DLL 4.0.1, 4.0.2, etc. all taking up disk space and RAM! Woohoo! Thanks, Bill!
There do exist MD-Data discs, but the only products I've ever seen that used them are digital multitrack recorders. Supposedly, you can buy MD-Data drives in Japan (not that that helps a lot in this case).
looks like slashcode always puts in a space after 90 continuous characters whether it's in the middle of a link or not. attempts to give a better example set off the "lameness filter". (thanks, rob!)
I don't know about you guys, but I prefer to modify my genome...er...differently.
I prefer the traditional methods: being bitten by radioactive spiders, bombarded with gamma radiation, etc.
Of course there are the occasional undesired side effects, like sudden transformations, excessive body hair, spontaneous posing, and terminal angst. But that's the price you pay for being on the bleeding edge of evolution!
"I think the country could be spared a lot of agony and the government could worry about inflation and a lot of other problems if [Nixon would] go on and resign."
"[There is] no question that an admission of making false statements to government officials and interfering with the FBI and the CIA is an impeachable offense."
It's obvious that these quotes have been distorted to suit the political leanings of those who repeat them (politicians? bending the truth?! never!);)
What we need is a small device with a decent amount of computing power that can be extended with downloadable software plugins-- basically a hardware version of Winamp (which plays all the major mod formats, IIRC).
Nullsoft, are you listening? This could be huge!:)
Crutchfield carries the Sanyo EXCD-1000, which packs a CD player and cassette deck into a single-DIN unit. If they can do that, they can probably squeeze a 2.5" HD and an MP3 decoder in there instead of the tape deck...
For example, if I copy your column up there and post it on my website, what do you call what I did?
Bad taste? *rimshot*
Seriously, "copyright infringement" should suffice. There's no need to use inaccurate (and inflammatory) words like "thief" and "pirate". Napster users don't go around breaking into houses and/or saying "Arr, matey!" all the time.
(I guess we should be thankful that the RIAA didn't choose to label infringers "murderers" or "pedophiles"...)
Sure, they're cheap to make now. The parts are cheaper, the design has been refined, ports removed, etc. Sony probably sells 'em at cost (or at a small profit). But when the PSX first came out Sony took a loss on every one sold. The PS2 is the same way.
I forget the exact numbers, but Sony's per-unit game license fee is pretty hefty. That's where the big $$ is... and that's why you don't see PSX games being produced without a license.
Try choosing a plausible value, like 14k or 28k... I don't think anyone is gonna be fooled into thinking you're running Gnutella over a 1200 baud connection (unless there's a C64 port of Gnutella out):)
If it's remote, why make it manlike, then? Why not, say, a small helicopter?
Because a human is not used to 'being' a non-humanoid. Telepresencing (is that a word?) into a humanoid body allows a human to use his/her natural instincts and reflexes to control the virtual body, rather than having to think "wings not legs, wings not legs..." all the time.:)
It's a 5-port 10BaseT hub with an uplink port, and it measures about 6"x3"x1". The power supp;y is about a third of that size. Should be very nicely portable.
Slashdot Mirror
Legally speaking, no. Remember what happened to my.mp3.com?
Does this ring any bells for ya?
A: It sure is. [...] In Whistler, applications will think they're copying their [DLL] files as usual, but the OS will manage the process so that they don't actually overwrite any existing files. Then, each time the application is run, Whistler will ensure that it only uses its copies of the files, ensuring that all apps run correctly and none of them are able to get in the way of other applications. Microsoft says that this feature will "isolate applications from each other, providing users with a 'run once, run forever' environment.
So basically M$ is negating the whole point of DLLs here. Great. Instead of one copy of BLOAT32.DLL, you'll have BLOAT32.DLL 4.0.1, 4.0.2, etc. all taking up disk space and RAM! Woohoo! Thanks, Bill!
There do exist MD-Data discs, but the only products I've ever seen that used them are digital multitrack recorders. Supposedly, you can buy MD-Data drives in Japan (not that that helps a lot in this case).
"Hey you! What's that in your coat pocket?"
"Um... definitely not an electrical substation!"
"Okay then, move along..."
a quick scan doesn't show any batman news tho.
Word is that Halo will still be coming out on Mac and PC. However, I imagine it'll be an Xbox-exclusive title for a few months... :P
looks like slashcode always puts in a space after 90 continuous characters whether it's in the middle of a link or not.
attempts to give a better example set off the "lameness filter". (thanks, rob!)
Other examples:
GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT...
I prefer the traditional methods: being bitten by radioactive spiders, bombarded with gamma radiation, etc.
Of course there are the occasional undesired side effects, like sudden transformations, excessive body hair, spontaneous posing, and terminal angst. But that's the price you pay for being on the bleeding edge of evolution!
"I think the country could be spared a lot of agony and the government could worry about inflation and a lot of other problems if [Nixon would] go on and resign."
"[There is] no question that an admission of making false statements to government officials and interfering with the FBI and the CIA is an impeachable offense."
It's obvious that these quotes have been distorted to suit the political leanings of those who repeat them (politicians? bending the truth?! never!) ;)
(Bill stole-- oops, "innovated"-- the idea from this Doom process manager.)
Actually, Ebay takes a small cut of every auction held on its servers, plus a small listing fee:
http://pages.ebay.com/help /sellerguide/selling-fees.html
Nullsoft, are you listening? This could be huge! :)
Crutchfield carries the Sanyo EXCD-1000, which packs a CD player and cassette deck into a single-DIN unit. If they can do that, they can probably squeeze a 2.5" HD and an MP3 decoder in there instead of the tape deck...
I think the following just might be what tipped 'em off:
rem barok -loveletter(vbe)
rem by: spyder / ispyder@mail.com / @GRAMMERSoft Group / Manila,Philippines
Hint for virus writers: DON'T put your email address right in the code...
"Mr. President? Napster just banned 20,000 of your user accounts..."
Bad taste? *rimshot*
Seriously, "copyright infringement" should suffice. There's no need to use inaccurate (and inflammatory) words like "thief" and "pirate". Napster users don't go around breaking into houses and/or saying "Arr, matey!" all the time.
(I guess we should be thankful that the RIAA didn't choose to label infringers "murderers" or "pedophiles"...)
Unlike the UK, Linda Tripp is not a sovereign nation (as far as I know, anyway) and thus can't make her own laws.
Duh! Everyone knows that the alien corpses are really kept at Wright-Patterson Air Force Base.
I forget the exact numbers, but Sony's per-unit game license fee is pretty hefty. That's where the big $$ is... and that's why you don't see PSX games being produced without a license.
Try choosing a plausible value, like 14k or 28k... I don't think anyone is gonna be fooled into thinking you're running Gnutella over a 1200 baud connection (unless there's a C64 port of Gnutella out) :)
Because a human is not used to 'being' a non-humanoid. Telepresencing (is that a word?) into a humanoid body allows a human to use his/her natural instincts and reflexes to control the virtual body, rather than having to think "wings not legs, wings not legs..." all the time. :)
It's a 5-port 10BaseT hub with an uplink port, and it measures about 6"x3"x1". The power supp;y is about a third of that size. Should be very nicely portable.