Slashdot Mirror

Stem cells are cells which can divide in the laboratory and which have the ability to develop into certain kinds of specialized tissues. There is several types of stem cells, all of which are not used for research. The stem cells being used for research are called human pluripotent stem cells. These cells can develop into most of the organs and tissues of the human body, but they cannot develop into a human life without the help of other types of cells. (National Institutes of Health)
These stem cells can be derived from fertilized eggs at a certain point during the development of the embryo. More information about this process is available in the NIH's publication, "Stem Cells: A Primer,".
some religous orginizations are NOT against it.
if the reader of this post is interested in finding some information explaining stem cells so the can make an informed decsision go here

After reading the guidelines to the contest, I figured I'd offer the following models/design specs for those interested in participating:

• Understanding how the Brain works
• When will computer hardware match the human brain?
• How your Brain Works
• How the Human Brain Developed and How the Human Mind Works
• Theory of Sequentially Timed Learning
• If your toaster had a brain
• neuroinformatics (please don't confuse with clam-baking)
• Brain Implants Control Computers

What one has to realize is that Henrietta Lacks went to Johns Hopkins to be tested and treated. Because it's affiliated with a University, it's a "research hospital," which means that above and beyond the current standard of care, patients should expect that the attendees and physicians also perform research on the side. Now this fact does not condone the conduct of the physician(s) who sent off her cells for culturing without the proper consent (assuming that he or she didn't get consent, because I'm not quite sure if that was the case--this was a research hospital after all). Because the incident occurred in the 1950's, you can be sure that the rules and regulations were not in place and this sort of conduct was probably acceptable. Moreover, the doctor-patient relationship then was nothing like the doctor-patient relationship now. Doctors then were viewed as "doctor knows best," whereas now, patients have the upper hand. I've only merely addressed the issue of patient/subject consent. The whole issue of proper compensation is a whole different subject. At which point can she claim that the cells are her's or is it public domain? Her cancerous cells would have been no use to her unless she had the facilities and the knowledge to keep them cultured and happy.

To learn more about the OHRP and human subject research and consent:

• OHRP

• Current FDA regulations (21 CFR 50)

P.S. The "21 CFR 50" only covers research done using chemical/biological agents that will eventually need FDA approval. Imagine the hundreds and thousands of other types of human research that doesn't involve the use of drugs and these agents--hence the type of research that is not federally regulated!

You are right...its not strictly about patents but the fact that people have been using "stuff" from *other people* for "fun and profit" even though it might not be intended that way.

I agree. I am very much against gene patents, in the least since there is no invention behind it. In my mind, a patent must have an invention behind it (OK, not necessarily true in US patent law, I know). After all, that's what is the essence of it, not a discovery, but an invention ... not chance, but skills.

At the same time, I think, however, that in the same line of reasoning, you don't hold the rights to your own genetic material. You didn't invent it, if anybody, it should be your parents and their decision to have sex at a specific time, chosing a specific pair of egg and sperm, which before had undergone genetic recombination in a certain way. Since you can hardly influence that, your DNA IMHO is not your intellectual property. They (the researchers) shouldn't own the rights, in the same way, you can't hold the rights. They should be public is what I am trying to say.

And considering the Moore story, I have read about that, too. And I don't like at all what happened there. But it's like everywhere in life, there are morally bad researchers and better ones. So I think we have to look at these stories put into a larger perspective, and in that way, we are not faring all too bad.

This article shows some anicetoded stuff. Stuff from companies rediculously overcharging just to test for a gene that causes life threatening problems(just the test...not even close to a cure) to limitations on the number of tests per year in the hopes they can get a profitable business deal out of it.

Lets say you are a university researcher(you claim to be) and you want to do a study genes and breast cancer. Oops! You can't do that because according to Myriad Genetics, which holds a bunch of patents on genes responsible for breast cancer, they control that stuff.

Oops, too, that is not true. You are allowed to do as much research as you like. You are not allowed to commercialize your results without a license from Myriad, however. But using the patented genes for studies or truncation assays or or or is perfectly legal in academic research (to my state of knowledge) There are plenty of academic research projects on BRCA1 (the gene Myriad patented), just have a look on PubMed for BRCA1.

How many projects had to be scrapped because they by accident stumbled into a gene someone patented and couldn't get or afford permission to continue work?

Again, none if you do research for the sake of gaining knowledge. If you want to start a company on your findings, then, yes, time to change projects ... But I think the ethical debate we're having is about research itself, no?

I hope I contributed something informative, and not just flamebait :)

Hey, if you can patent the software for silicon, why can't you patent the software for cells? :-(

You may have been joking, but a lot of people really do feel like this, and it's a serious problem. The British Columbia Cancer agency just stopped providing testing for Breast Cancer susceptibility genes to all BC families because "the BC Cancer Agency, through the Ministry of Health Planning, received legal notice from representatives of Myriad Genetics/MDS asserting patent rights for sequencing of BRCA1 and BRCA2 genes". They priced the patent such that the BCCA can not afford to pay for it.

My mother may carry these genes, and if she does, then I probably do and any children I may have might as well. Generations of my family could go through surgical amputation, toxic chemical treatments, and even risk death, if these genes are present in our DNA and if it manifests.

So please, don't give me the argument that people are entitled to make money. They're actually not, because withholding this information is morally repugnant. How much does a mature, capable human life cost?

I've often heard the argument that monetary compensation is offered to spur the investment of time and effort into scientific endeavour, and that if we were to stop this from happening then scientific progress would stagnate due to lack of interest. Right, okay - well, according to this study that I just found if your mother lives to be 65, she has a 1% chance of dying of breast cancer within ten years. Hey CmdrTaco, how many people visit this site in a week? Let's say it's a million, and let's say none of you share a mother. One thousand of you will have a mother die of cancer if she lives to 65. Pretend you're one of those thousand unlucky people. How much of your time would you, personally give to see that that didn't happen? If your mother had cancer and you were not locked into your career (say you were in University, not 45 and in middle management) would you consider choosing a career related to cancer diagnosis or treatment? I sure am. And if you believe I care if I don't get a dime from it, you're wrong. I'm not required to do it, but I will work on it even if I have to work another job for my money.

Some of you may wonder what I do that helps - I'm making my career in the area of human information access; intelligent searching, visualization, etc. In part, this is why I am extremely interested in the consolidation of information and its liberation from the greedy. If successful, I predict it will be the largest boost to research since well before the Internet, and probably for years to come.

/. is a focus for a lot of people who are interested in Open Source and Free Software. Most are interested in a way to get their work done, or a way to learn about software, or just a stable platform. Some want to make $$$ fast! Here, however, we have an application which Free software is uniquely suited to:

• It can evolve and change as this initative grows.
• It is without cost and without proprietary encumberance.
• It is stable and has unparalleled technical support.
• It is already built mainly by people who have at least as good moral as buiness sense.

More importantly, here we have the opportunity to catalyse scientific advancement. Try this: think of your friends, family, and coworkers and imagine that work you did help save that person's life, or made that person happier, or enable that other person to help you somehow. Heck, you can even think of the children - it actually works this time!

I urge you to head on over to http://www.publiclibraryofscience.org/ and read up on it. If you can, offer your help, and mean it. If you can't help, tell your friends. It's worth it.
_________

One of the "interesting" properties about biological weapons (from a security standpoint) is that, despite what you hear about "gene" patenting, much of the information you need to set about doing something "not-so-nice" is obtainable, and much of the raw materials you would need can be had w/o too much trouble (compared to say, bomb grade radioactive material).

For example, (for now) you can download DNA sequence information for various pathogens from the NIH (variola, ebola, et cetera). (although there are rumors that these sequences have already been "edited", i.e., you guys better start downloading potentially risky sequence information now and start mirroring before it's "pacified" or just simply censored).

couple this sort of information to the large scale dna synthesizers that exist today (e.g., here or here) that almost anybody can buy for around $100,000...

add in a bunch of "sex on steroids" strategies for mutating stuff in the lab (e.g., molecular breeding of viruses) just to overcome any prophylatic modifcations made by the notional "they"...

et cetera. the simple fact is biology is hackable, and we're gonna have to learn how to deal with it. no you can't easily make ebola for cheap from scratch today, but the day when you can isn't far off.

so, it's not surprising that people are concerned about this. the DoD seems to be taking some decent first steps. for example, one recent DARPA program whose goal is to synthesize arbitrary 10,000 nucleotide fragments of DNA within a 24-hour response period (see here, section 2.1 of the first word document) only really makes sense in the context of a rapid-response DNA vaccination program.

It seems like (at least) one other obvious thing that needs to happen soonish is for one (or more) of the national labs to establish large scale conventional vaccination production capability.

One of the "interesting" properties about biological weapons (from a security standpoint) is that, despite what you hear about "gene" patenting, much of the information you need to set about doing something "not-so-nice" is obtainable, and much of the raw materials you would need can be had w/o too much trouble (compared to say, bomb grade radioactive material).

For example, (for now) you can download DNA sequence information for various pathogens from the NIH (variola, ebola, et cetera). (although there are rumors that these sequences have already been "edited", i.e., you guys better start downloading potentially risky sequence information now and start mirroring before it's "pacified" or just simply censored).

couple this sort of information to the large scale dna synthesizers that exist today (e.g., here or here) that almost anybody can buy for around $100,000...

add in a bunch of "sex on steroids" strategies for mutating stuff in the lab (e.g., molecular breeding of viruses) just to overcome any prophylatic modifcations made by the notional "they"...

et cetera. the simple fact is biology is hackable, and we're gonna have to learn how to deal with it. no you can't easily make ebola for cheap from scratch today, but the day when you can isn't far off.

so, it's not surprising that people are concerned about this. the DoD seems to be taking some decent first steps. for example, one recent DARPA program whose goal is to synthesize arbitrary 10,000 nucleotide fragments of DNA within a 24-hour response period (see here, section 2.1 of the first word document) only really makes sense in the context of a rapid-response DNA vaccination program.

It seems like (at least) one other obvious thing that needs to happen soonish is for one (or more) of the national labs to establish large scale conventional vaccination production capability.

One of the "interesting" properties about biological weapons (from a security standpoint) is that, despite what you hear about "gene" patenting, much of the information you need to set about doing something "not-so-nice" is obtainable, and much of the raw materials you would need can be had w/o too much trouble (compared to say, bomb grade radioactive material).

For example, (for now) you can download DNA sequence information for various pathogens from the NIH (variola, ebola, et cetera). (although there are rumors that these sequences have already been "edited", i.e., you guys better start downloading potentially risky sequence information now and start mirroring before it's "pacified" or just simply censored).

couple this sort of information to the large scale dna synthesizers that exist today (e.g., here or here) that almost anybody can buy for around $100,000...

add in a bunch of "sex on steroids" strategies for mutating stuff in the lab (e.g., molecular breeding of viruses) just to overcome any prophylatic modifcations made by the notional "they"...

et cetera. the simple fact is biology is hackable, and we're gonna have to learn how to deal with it. no you can't easily make ebola for cheap from scratch today, but the day when you can isn't far off.

so, it's not surprising that people are concerned about this. the DoD seems to be taking some decent first steps. for example, one recent DARPA program whose goal is to synthesize arbitrary 10,000 nucleotide fragments of DNA within a 24-hour response period (see here, section 2.1 of the first word document) only really makes sense in the context of a rapid-response DNA vaccination program.

It seems like (at least) one other obvious thing that needs to happen soonish is for one (or more) of the national labs to establish large scale conventional vaccination production capability.

I agree that gene therapy, germ-line genetic editing, and even the oft-maligned eugenics have great possibilities-- but they also have great risks. The phobia, even near hysteria, generated in the public about these technologies is likely due to journalists' and authors' over-dramatization of these risks. I think we shouldn't categorically rule them out, but rather explore carefully, and have respect for the risks.

What risks lurk in germ-line control? If genomes become too homogeneous, that leaves the whole population vulnerable to, say, that one new virus mutation that exploits a "security hole" in the now common genetic code. If some unforeseen bug in a custom gene, or its unexpected interaction with some other gene variant, causes major problems 20, 40, or more years into someone's life, how can we reasonably assign risk assumption, liability, or even just cost of resulting medical care? In essence, we'd be borrowing the problems of software engineering, compounded by working in a system that's haphazardly constructed and mind-bogglingly complex, with no documentation and only binaries to study!

Eugenics are not inherently evil-- for example, a number of states have premarital genetic screening to warn potential parents of the risks they face if one or both of them carry a deleterious or seriously maladaptive recessive (hemophilia A[carried on X, so not recessive in XY or XYY case], Tay-Sachs, sickle-cell anemia, etc.) the couple may choose to adopt, or to combine one partner's genes with a known good set taken from a gamete bank. Alternatively, if they decide to roll the dice on their own genes, amniocentesis can identify when these variants combine, and may lead parents to abort rather than allow a lifetime of suffering. Misguided application of eugenics, however, can certainly be evil, as can misguided application of other technologies-- the potential for evil is obvious in weapons of mass destruction, but what about remote sensing, psychology, and mass media being used for surreptitious surveillance, spin doctoring, and manufactured culture?

In short, there is immense power in genetic engineering, whether by genetic editing or eugenic breeding, and that power can be used for good or ill. Whatever we do, though, we need to do with both eyes open.

I agree that gene therapy, germ-line genetic editing, and even the oft-maligned eugenics have great possibilities-- but they also have great risks. The phobia, even near hysteria, generated in the public about these technologies is likely due to journalists' and authors' over-dramatization of these risks. I think we shouldn't categorically rule them out, but rather explore carefully, and have respect for the risks.

What risks lurk in germ-line control? If genomes become too homogeneous, that leaves the whole population vulnerable to, say, that one new virus mutation that exploits a "security hole" in the now common genetic code. If some unforeseen bug in a custom gene, or its unexpected interaction with some other gene variant, causes major problems 20, 40, or more years into someone's life, how can we reasonably assign risk assumption, liability, or even just cost of resulting medical care? In essence, we'd be borrowing the problems of software engineering, compounded by working in a system that's haphazardly constructed and mind-bogglingly complex, with no documentation and only binaries to study!

Eugenics are not inherently evil-- for example, a number of states have premarital genetic screening to warn potential parents of the risks they face if one or both of them carry a deleterious or seriously maladaptive recessive (hemophilia A[carried on X, so not recessive in XY or XYY case], Tay-Sachs, sickle-cell anemia, etc.) the couple may choose to adopt, or to combine one partner's genes with a known good set taken from a gamete bank. Alternatively, if they decide to roll the dice on their own genes, amniocentesis can identify when these variants combine, and may lead parents to abort rather than allow a lifetime of suffering. Misguided application of eugenics, however, can certainly be evil, as can misguided application of other technologies-- the potential for evil is obvious in weapons of mass destruction, but what about remote sensing, psychology, and mass media being used for surreptitious surveillance, spin doctoring, and manufactured culture?

In short, there is immense power in genetic engineering, whether by genetic editing or eugenic breeding, and that power can be used for good or ill. Whatever we do, though, we need to do with both eyes open.

I agree that gene therapy, germ-line genetic editing, and even the oft-maligned eugenics have great possibilities-- but they also have great risks. The phobia, even near hysteria, generated in the public about these technologies is likely due to journalists' and authors' over-dramatization of these risks. I think we shouldn't categorically rule them out, but rather explore carefully, and have respect for the risks.

What risks lurk in germ-line control? If genomes become too homogeneous, that leaves the whole population vulnerable to, say, that one new virus mutation that exploits a "security hole" in the now common genetic code. If some unforeseen bug in a custom gene, or its unexpected interaction with some other gene variant, causes major problems 20, 40, or more years into someone's life, how can we reasonably assign risk assumption, liability, or even just cost of resulting medical care? In essence, we'd be borrowing the problems of software engineering, compounded by working in a system that's haphazardly constructed and mind-bogglingly complex, with no documentation and only binaries to study!

Eugenics are not inherently evil-- for example, a number of states have premarital genetic screening to warn potential parents of the risks they face if one or both of them carry a deleterious or seriously maladaptive recessive (hemophilia A[carried on X, so not recessive in XY or XYY case], Tay-Sachs, sickle-cell anemia, etc.) the couple may choose to adopt, or to combine one partner's genes with a known good set taken from a gamete bank. Alternatively, if they decide to roll the dice on their own genes, amniocentesis can identify when these variants combine, and may lead parents to abort rather than allow a lifetime of suffering. Misguided application of eugenics, however, can certainly be evil, as can misguided application of other technologies-- the potential for evil is obvious in weapons of mass destruction, but what about remote sensing, psychology, and mass media being used for surreptitious surveillance, spin doctoring, and manufactured culture?

In short, there is immense power in genetic engineering, whether by genetic editing or eugenic breeding, and that power can be used for good or ill. Whatever we do, though, we need to do with both eyes open.

Great stuff? Ehh -- what's with the public and sociobiology anyway? The original "Sociobiology" was written in desperation by Wilson, as an attempt to rekindle interest in his sort of behaviorial research at the time when molecular biology was making traditional observational biology rather passe. Twenty-five years later, mainstream biology *is* molecular biology.

There are interesting questions to be sure in the genetics of behavior, but experiment, combined with molecular evolutionary studies, are the way they are being addressed today (for example, this paper), rather than by just-so stories. Look at all the recent sociobiology proponents -- Pinker, Wright, Dennet -- and you'll notice that they aren't biologists.

...that I would recommend chiropractic, proper stretching techniques, and massage long before I would recommend drugs. Pain killers and muscle relaxers don't fix the problem, they just mask it. Most people who sit a computer all day have poor posture and much of their pain would be relieved if they corrected their posture.

Here is a bad analogy for you: If the CPU fan in your PC started making a bunch of noise, would you rather put head phones on so you can't hear the noise or would you rather fix the problem before the fan dies and your CPU overheats?

I can't speak as intelligently on the topic as a DC yet so I will offer you a few links to people who can:
http://www.chiroweb.com/find/tellmeabout/backpain. html
http://www.holisticonline.com/Chiropractic/chiro_b ack-pain.htm
http://www.nlm.nih.gov/medlineplus/backpain.html

The last link above may prove to be the most useful as it looks at the problem of back pain not only from holistical view but also from a medicinal view.

It had a 100Mb PCI ethernet card with low latency, and the other had a 10Mb PCI ethernet card with high latency. [...] The acknowledgements got back to the kernel.org server faster, which opened the TCP window. It wasn't just this one test, either - the computer with the 10Mb card got consistenly slower downloads.

I don't think that's quite the case. Both sides estimate the RTT (Round Trip Time) on the link, and then adjust the window according to the RTT. The problem you describe comes into play on much higher bandwidth connections with much higher latencies. This page describes the problem reasonably well, although it appears to be a little dated.

By default, TCP offers a maximum window of 64K bytes (which is 512K bits). At 4Mbit/sec, this takes 125ms worth of time to transmit. So, basically, if your RTT is about 125ms or less, you should see 4Mbit/sec transfers. For TCP's maximum window size to limit you to 30KB/sec, your RTT would need to be ~17000ms. I think it's much more likely that your network card's driver is hosed so thqt you're losing ACKs and having to wait for TCP to retransmit.

So what sort of latency are you seeing to kernel.org? I'm seeing 90-100ms. I doubt you're seeing 17000ms.

Dude...you married a fruit fly (Drosophila melanogaster)! At least that's according to the BLAST search at NCBI...

Look, I've done your research for you and I don't think it bears out your assertion at all. While the National Institute of Mental Health (www.nimh.nih.gov) has some statistics available the adult numbers are annual and the adolescent numbers are semi-annual. A comparison indicates that there is no significant difference in the rate of depression for adults (9.5% of all adults have this in a given year) and the rate for adolescents (6% of all adolescents in a given 6-month time frame, also shown as 8.3% but without specifying a time frame). Certainly this completely blows the statement made that "most teenagers are depressed".

Also interesting to note is that while women, according to the NIMH, experience depression at twice the rate that men do, men are four times more likely to commit suicide (if you believe this).

Look, I've done your research for you and I don't think it bears out your assertion at all. While the National Institute of Mental Health (www.nimh.nih.gov) has some statistics available the adult numbers are annual and the adolescent numbers are semi-annual. A comparison indicates that there is no significant difference in the rate of depression for adults (9.5% of all adults have this in a given year) and the rate for adolescents (6% of all adolescents in a given 6-month time frame, also shown as 8.3% but without specifying a time frame). Certainly this completely blows the statement made that "most teenagers are depressed".

Also interesting to note is that while women, according to the NIMH, experience depression at twice the rate that men do, men are four times more likely to commit suicide (if you believe this).

Take some code, say the tinest known CSS descrambler in C. Maybe compress it into a nice tight zip/.gz binary. Now convert it to a DNA sequence (It seems you could actually make a couple possible sequences by switching around the letters) I wonder what the odds are of finding one of these sequences in the billions of combinations currently being sequenced? W
-------------------

So an example of why this is insidious... the human genome is supposed to be free for mankind to use... but what do you want to be the database that holds the information about the entire sequence will be copyrighted by someone? And anyone who tries to provide a free version will be DMCA'd to death?

The National Center for Biotechnology Information, home of Genbank and the public draft human sequence, is run by the National Institutes of Health. They're not gonna get DMCAed any time soon, especially since the participating public centers generated the data. The public sector Human Genome Project data is free for anyone to use...even Celera.

(Disclaimer: I work for one of the HGP sequencing centers.)

In regards to your first point... I've done a pretty large amount of work with Medline. Certainly the technique does to some extent rely on a standard nomenclature. This is probably not such a hurdle, though. Each citation indexed in Medline is tagged with particular MeSH headings. MeSH is a controlled vocabulary of medical terms, with quite extensive supplements that include genetic and chemical information. The most relevent part here is that each heading is associated with a number of synonyms. So in addition to each article being indexed against a controlled vocabulary (by a trained human indexer), that vocabulary itself provides relationship information between various terms, both internal and external to the actual vocab. Also, there's the whole Unified Medical Language System, but I'm not really up to speed on that. It's pretty much independent from MeSH, and it's not used directly in Medline, AFAIK.

In regards to your first point... I've done a pretty large amount of work with Medline. Certainly the technique does to some extent rely on a standard nomenclature. This is probably not such a hurdle, though. Each citation indexed in Medline is tagged with particular MeSH headings. MeSH is a controlled vocabulary of medical terms, with quite extensive supplements that include genetic and chemical information. The most relevent part here is that each heading is associated with a number of synonyms. So in addition to each article being indexed against a controlled vocabulary (by a trained human indexer), that vocabulary itself provides relationship information between various terms, both internal and external to the actual vocab. Also, there's the whole Unified Medical Language System, but I'm not really up to speed on that. It's pretty much independent from MeSH, and it's not used directly in Medline, AFAIK.

Also, a paper in Bioinformatics was published recently which tries to extract protein interactions. They used a dictionary of words related to interactions, and then look for proteins which are mentioned in the same sentence that contain one of those dictionary words, along with part of speech analysis to improve accuracy.

Something like that.

Hehe, not to diminish what you did (very cool project that I thought about writing myself last year) but just that we're heading in to major league waters here, and it's pretty exciting. Punnet squares are an important part of genetics because of inheritance, but the stuff now is all gene expression and interaction. It's pretty terrifying, because that's where the real work is all going to be, but it's also incredibly exciting, because bio is going to be the science of this century.

If you're interested in slightly higher level concepts, I just found this website at my college's webserver (it's a class I had to take, intro to Molecular Bio) and it looks like it's got some good info through the flash animations. If you want the hardcore stuff, go to the NCBI site where you can browse the genome, search for proteins and genes, and do all the stuff real biologists do :-) If you're at a University that's paying online fees, you can read journal articles that they link to from University IP's as well.

"I may not have morals, but I have standards."

Sadly, given Celera's past history, it will almost certainly be proprietary. Although they have benefited immensely from government funded research and data collection, they have refused to make their sequence data publicly available in GenBank. Most journals require you to publish your sequence data in GenBank as a condition for publication of papers related to the sequence data. Celera was granted a special exemption to this policy by Science when they published their paper on the human genome recently and I anticipate a similar special exemption will be allowed for the mouse data as well, though I haven't closely followed what's going on with the mouse genome, since I work on Acetabularia Acetabulum (this is my professor's web page, not mine, the views expressed here are not ...and so on)

If you want to analyze publicly available gene sequence data, you can use GenBank at NCBI and software from Bioinformatics.org. There is also a great directory of online molecular biology tools and information here

As far as I can tell, this database is mostly abstracts and citations. The real articles that the abstracts point to are still in books or periodicals owned by large publishing houses. It is a very useful source, but it hasn't freed up computer science. You still need to pay for most of the articles unless you have access to a research library.

This is like the Medline medicine database (11 million abstracts) except the citation analysis is more advanced for the CS database. Also, I think that medical abstracts are more useful as they usually feature the results from a testable hypothesis that describes an existing biochemical or physical mechanism. Much computer research involves the development and exploration of logical systems - this can't be boiled down to a paragraph. Proof of concept is a valid way of doing research, but five or six sentences is not enough to thoroughly describe the ideas that were proved. (see example from researchindex.com below):

Abstract: Models of Qualitative Spatial Reasoning (QSR), built according to the \make only as many distinctions as necessary" belief, partition the universe of values into a finite number of regions; elements lying in a same region are qualitatively equal, i.e., indistinguishable. The purpose of this work is not to tackle the foundational arguments of QSR, in which I strongly believe; rather, I believe as well that some application domains need a representational model based on a partition of the universe of values as ne-grained as possible: that is to say, a quantitative model. I investigate such a model, which is a constraint-based model of ternary relations on triples of 2D points; a relation of...

link 2

link 3

link 4

Infact i remember doing a Cell biology paper way back in 1995 and summarizing several articles on Programmed cell death (apoptosis). And it is NOT usefull for cancer. Cancer cells in general are cells that are divind more rapidly (except for a few slow growing tumors such as small cell carcinoma of the lung etc) and DO NOT respond to the bodies commands/attempts to regulate them. In most cases they do not respond to signals to begin apoptosis.

Sure this is a problem, but it's more an example of applying the wrong tool. Google was never intended for comprehensively finding every scrap of information about a particular topic; it was designed to find the few most relevant and interesting sites discussing a particular topic. Using a general purpose tool for a highly specific task is a wonderful way of getting frustrated but not an efficient approach to solving your problems.

In fact, there are specialized search engines for dealing with specific topics. There are engines specifically for looking for images, ones for looking at specialized topics, and so on. There are also specialized, classified catalogues of information of exactly the kind you suggest are needed out there for people who need to know about them. If, for instance, I want to learn about a specific topic in biology, I might very well start out by looking at PubMed, a special purpose index of biological research articles. You just have to know where to look for the special purpose tools.

Just what I need... Thoracic Outlet Syndrome (carpel tunnel of the neck)!
---

The study I linked to above as "Effect of mobile phone on life-saving and life-sustatning systems" concluded:

"Our results permit the conclusion that the ban on mobile phones in hospitals is based not on actual events, but on theoretical considerations in the absence of any practical information on the actual susceptibility of devices and their reaction to the electromagnetic fields involved."

We would therefore recommend that all life-saving and life-support systems that can also be used outside the hospital should be made mobile phone-proof. When apnoea monitors and respirators are protected from such interference, hazardous situations could be avoided by establishing the rule: "No portables, and mobile phones only at a distance of at least 1 metre from medical devices". With regard to emergency telephones, the minimum distance to medical devices should be at least 1.5 metres."

--- [DrPsycho] Coping with reality since 1975.

Something I wrote elsewhere once upon a time:

This year, I've been wearing a pager in hospital, while my digital PCS phone sits either freezing or melting in my car... stashed safely in the parking lot. It's due to the familiar fact that hospitals have those gigantic signs posted everywhere, screaming about how any device that transmits RF might cause a massive explosion or result in patient deaths. We commonly have this explained to us by the fact that "cellular phones and other RF transmitters may interfere with sensitive medical equipment." Aren't these sensitive pieces of equipment RF shielded in any way to prevent this, let alone to prevent the multitude of walkie-talkie conversations and telemetry broadcasts permeating the hospital hallways from upsetting the various electronic doodads? I've even seen docs answer their mobile phones right in front of me, ON HOSPITAL PROPERTY, thumbing their noses at the dictum that "PHONE IN HOSPITAL BAD."

I, procrastinating my own reading, did a quick search online for an answer to this question which has plagued me and my colleauges for some time now. Here are a few highlights from different points of view:

Digital Cellular Phone Interference with Cardiac Pacemakers
Is There an Effect of a Cellular Phone on Pacemaker Function?
Is it time for Cellular Bill of Rights?
Medical Center Goes Wireless
EM interference of external pacemakers... study
Effect of mobile phone on life-saving and life-sustatning systems
Interference to medical equipment form mobile phones.
Initial experience with a wireless PDA as a teleradiology terminal...

--- [DrPsycho] Coping with reality since 1975.

Something I wrote elsewhere once upon a time:

This year, I've been wearing a pager in hospital, while my digital PCS phone sits either freezing or melting in my car... stashed safely in the parking lot. It's due to the familiar fact that hospitals have those gigantic signs posted everywhere, screaming about how any device that transmits RF might cause a massive explosion or result in patient deaths. We commonly have this explained to us by the fact that "cellular phones and other RF transmitters may interfere with sensitive medical equipment." Aren't these sensitive pieces of equipment RF shielded in any way to prevent this, let alone to prevent the multitude of walkie-talkie conversations and telemetry broadcasts permeating the hospital hallways from upsetting the various electronic doodads? I've even seen docs answer their mobile phones right in front of me, ON HOSPITAL PROPERTY, thumbing their noses at the dictum that "PHONE IN HOSPITAL BAD."

I, procrastinating my own reading, did a quick search online for an answer to this question which has plagued me and my colleauges for some time now. Here are a few highlights from different points of view:

Digital Cellular Phone Interference with Cardiac Pacemakers
Is There an Effect of a Cellular Phone on Pacemaker Function?
Is it time for Cellular Bill of Rights?
Medical Center Goes Wireless
EM interference of external pacemakers... study
Effect of mobile phone on life-saving and life-sustatning systems
Interference to medical equipment form mobile phones.
Initial experience with a wireless PDA as a teleradiology terminal...

--- [DrPsycho] Coping with reality since 1975.

Something I wrote elsewhere once upon a time:

This year, I've been wearing a pager in hospital, while my digital PCS phone sits either freezing or melting in my car... stashed safely in the parking lot. It's due to the familiar fact that hospitals have those gigantic signs posted everywhere, screaming about how any device that transmits RF might cause a massive explosion or result in patient deaths. We commonly have this explained to us by the fact that "cellular phones and other RF transmitters may interfere with sensitive medical equipment." Aren't these sensitive pieces of equipment RF shielded in any way to prevent this, let alone to prevent the multitude of walkie-talkie conversations and telemetry broadcasts permeating the hospital hallways from upsetting the various electronic doodads? I've even seen docs answer their mobile phones right in front of me, ON HOSPITAL PROPERTY, thumbing their noses at the dictum that "PHONE IN HOSPITAL BAD."

I, procrastinating my own reading, did a quick search online for an answer to this question which has plagued me and my colleauges for some time now. Here are a few highlights from different points of view:

Digital Cellular Phone Interference with Cardiac Pacemakers
Is There an Effect of a Cellular Phone on Pacemaker Function?
Is it time for Cellular Bill of Rights?
Medical Center Goes Wireless
EM interference of external pacemakers... study
Effect of mobile phone on life-saving and life-sustatning systems
Interference to medical equipment form mobile phones.
Initial experience with a wireless PDA as a teleradiology terminal...

--- [DrPsycho] Coping with reality since 1975.

Something I wrote elsewhere once upon a time:

This year, I've been wearing a pager in hospital, while my digital PCS phone sits either freezing or melting in my car... stashed safely in the parking lot. It's due to the familiar fact that hospitals have those gigantic signs posted everywhere, screaming about how any device that transmits RF might cause a massive explosion or result in patient deaths. We commonly have this explained to us by the fact that "cellular phones and other RF transmitters may interfere with sensitive medical equipment." Aren't these sensitive pieces of equipment RF shielded in any way to prevent this, let alone to prevent the multitude of walkie-talkie conversations and telemetry broadcasts permeating the hospital hallways from upsetting the various electronic doodads? I've even seen docs answer their mobile phones right in front of me, ON HOSPITAL PROPERTY, thumbing their noses at the dictum that "PHONE IN HOSPITAL BAD."

I, procrastinating my own reading, did a quick search online for an answer to this question which has plagued me and my colleauges for some time now. Here are a few highlights from different points of view:

Digital Cellular Phone Interference with Cardiac Pacemakers
Is There an Effect of a Cellular Phone on Pacemaker Function?
Is it time for Cellular Bill of Rights?
Medical Center Goes Wireless
EM interference of external pacemakers... study
Effect of mobile phone on life-saving and life-sustatning systems
Interference to medical equipment form mobile phones.
Initial experience with a wireless PDA as a teleradiology terminal...

--- [DrPsycho] Coping with reality since 1975.

Mesenchymal Stem Cells (MSCs) can be isolated from bone marrow, are easily expanded outside of the body, and can be converted into a variety of tissues, including fat cells, muscle cells, bone cells and cartilage cells. Unlike adipocytes (fat cells), they are easier to grow, easier to isolate, less delicate and more naturally converted into cartlidge cells.

A company, Osiris is working on developing technology around these cells.

There is also a Science paper on these cells.

Full Disclosure: I work with these cells, and can routinely convert them into fat, bone and cartilige cells.

if they complete the Human Genome Project. I prefer KDE anyway. Oh wait, nevermind....

"We have known for some time that adult cells could be used to create stem cells (although not quite as easy)"

That quite true. For those interested in reading further, the NIH has published an article, "Stem Cells: A Primer". You may be especially interested about the section towards the end about stem cells in adults, especially the section, "Why not just pursue research with adult stem cells?"

"...but all of the focus has been on the controversial method of using embryos as the source. I don't see that changing."

Mind if I borrow your sentence and rearrange it a bit? I'd instead say all of the controversy has been focused on the method of using embryos as the source. If you look around, you'll find that adult stem cell research is going on, busily and quietly. Since there's nobody attacking the research, there's also nobody hyping as part of a defense. Embryo stem cell were discovered first, so of course the research is further along. What's more, it's both promising and threatened, so that's where the resources are going first.

Adult Stem cell research is NOT BEING IGNORED. Rather, it is impossible to predict which avenues of research will eventually pan out, and so scientists are loathe to close off any possibilities. One, maybe both of these paths may prove to be a dead end. But we won't know until we look.

It's nice that the genome has been "sequenced in its entirety" and is presently undergoing "error checking" which should "continue for the next year".
Last time i checked at ncbi the genome was at 30.4% finished. and the rough draft assembly is in 148307 pieces according to the golden path.
And of course the finished target for the human genome is three years from now!

Sorry, I'm too lasy to annotate this myself :-):

Link to NCBI

FASTA looks remarkably like the example given in the article.

Quicky description of FASTA (just one of many schemes but one of the most popular and oldest.

Perhaps rather than writing a trendy article trying to get buzzwords like genomics and bioinformatics together with geek speak, he should have done a tad more research.

Not to say there can't be huge improvements and trying to show the interplay (temporally AND physically) between genes. But don't do a half-assed job by ignoring what has already been used for decades.

``Since most solid tumors take 10 to 15 years to develop, it is probably too soon to see an effect,'' Lai said.

I know very little about cancer (except for a bit about Gliomlastoma Multiforme), but experience suggests that there are some quite deadly forms of cancer (brain and otherwise) that take significantly less than a decade to develop.

Some life-threatening tumors can form in less than a month or so, and others in less than six months.

I guess what bothers me, is that I am less concerned about the impact of the 10-15 year growth tumors. That suggests to me that they are very non-aggressive and could be discovered early and effectively treated.

What frightens me are the highly aggressive forms of cancer that that appear out of nowhere, and can cripple or kill someone within six months.

I'm not sure what my point is, really, and I have no reason to doubt Dr. Lai's credentials, but I feel like his closing statement in the article subtly suggests that the risk of cancer is pretty low and if it does strike, it is a slow process.

In some cases, it's not.
-----
D. Fischer

I just finished with a class that touched on the genome mentioned here. Most of the gene functions are, as has been mentioned earlier, deduced by comparison to other genes of known function in other species. This is usually done using algorithms like BLAST/PSI-BLAST/Gapped BLAST (Basic Local Alignment Search Tool) that compare sequences in question to data stored in a large database like GenBank. More information on these topics can be found at the National Center for Biotechnology Information, run by the National Library of Medicine at the National Institutes of Health.

My suspicion would be that after the human, mouse & fugu are finalized that the next genome to sequenced will be the Chimpanzee. Then the question is -- what genomes do you sequence after those? I've argued that since aging is the disease that everyone has, that genomes of non- or slowly aging organisms would provide a great deal of information about what improvements need to be made to the human genome to allow us to live indefinately (longvity limited by our accident rates). The genomes that would provide interesting insights include elephants, whales, tortises, lobsters, giant clams, bats and parrots or maccaws. The genomes of all of these species have been tuned for extended longevity, perhaps in quite different ways. The genomes of species such as geckos, starfish, crabs and other animals that have the ability to regrow limbs would provide us with information on how nature has organized genetic programs to regrow complex tissues (something humans lack). Those who would like to push the NIH in this direction should send letters about this to the Office of the Director of the NHCGR. See this link.

For those interested, I maintain a page with a semi-current status of many of the genome projects here.

Genbank lets you do this sort of thing, although it is not too user-friendly.

I happen to work with these cells in a reseach lab at Johns Hopkins. Beyond neurons, researchers have claimed these cells can become
- Fat Cells
- Cartilage Cells
- Bone Cells
- Muscle Cells (smooth, skeletal and cardiac)

The ability to produce new caridac muscle cells is also particularly important, as like neurons, they cannot be repaired or naturally replaced in adults. With a reliable source of Cardiac muscle cells heart failure, a disease millions of people develop each year, could possibly be cured.

If you are curious about reading more, try out these urls:


A nice graphical depiction from a biotech company.


An Importance Science Article (Requires account for full text access.)

Additionally,
Osiris Theraputics is a biotech company which is doing work on these cells.

Klinefelter's Syndrome is where a male is XXY instead of XY. Most such men are infertile, but according to NIH some can father children.

So, if a female tetrachromat passes the gene to a Klinefelter child, and that man fathers a son, could the son be a "normal" tetrachromat male?

Of course we are talking about multiplying several very small percentages together, so the odds are very low, but it's still interesting.

I think it's far more likely that someone will hack the genes to create a male tetrachromat. Imagine what it would be like if DaVinci, Van Gogh, or some other great artist had the capability. Then again, imagine what it would be like if they screwed up and caused his testes to produce the Ebola virus instead of sperm.

www.ebi.ac.uk

It is open source :) thats the point of the Human Genome Project. www.ncbi.nlm.nih.gov www.ebi.ac.uk

Syllepsis wrote:
BTW, better check yourselves for this: TAGCTAGCTAGCTTTACAGCTACCGCTAGCTTAGCTGA GCTTCTGATCGATCGAAACGATCAGCTGATCGGCTAGCTTA GGCTTAGCTAGCTTAGCGAGACTAGCGATCGACTAGGCGCG CTAGCGGCTAGCTATTATTATATGCGGCCTTAATAGAGAGG AAATATCGACTGACTACTAGCTACGCGCGTACGCT

The sequence you are claiming shares a 20 nucleotide region near the 3' end (ccttaatagagaggaaatat) with the protamine p1 gene. Check for yourself here. It has one start and six stop codons and only one four codon (whee!) open reading frame (ATGCGGCCTTAA). So, it doesn't appear to be that interesting/useful/keep it/hope you aren't selling the farm enforcing your claims (grin)...

That's the general rule. The person or group that discovers a new taxonomic group- living or extinct- and first demonstrates it to be taxonomically distinct gets to name it. So if it's a new species, you get to give it a new species name, but not the genus name. If you discover a species in a whole new philum, you'd get to give it philum, class, order, family, genus, and species. In practice, though, I suspect that intermediate taxonomic groupings (between genus/species and the highest classification that holds) would be considered provisional until some related groups were found. The neat part is that there are so many species out there that all of the obvious names have been taken and almost everything new gets the kind of (often funny) phony-latin names that they used to make jokes with on Road Runner.

On a more serious note, there's a wealth of on-line taxonomy data at the National Center for Biotechnology Information. They have a lot of information about taxonomy in general, as well as a heirarchical database of every species (including some extinct ones, though no dinosaurs) for which any DNA or Protein sequence has been published. Even if you're not interested in the data there for professional reasons, the NCBI web page is a fantastic example of how to make Gigabytes of data accessable on-line.

That's the general rule. The person or group that discovers a new taxonomic group- living or extinct- and first demonstrates it to be taxonomically distinct gets to name it. So if it's a new species, you get to give it a new species name, but not the genus name. If you discover a species in a whole new philum, you'd get to give it philum, class, order, family, genus, and species. In practice, though, I suspect that intermediate taxonomic groupings (between genus/species and the highest classification that holds) would be considered provisional until some related groups were found. The neat part is that there are so many species out there that all of the obvious names have been taken and almost everything new gets the kind of (often funny) phony-latin names that they used to make jokes with on Road Runner.

On a more serious note, there's a wealth of on-line taxonomy data at the National Center for Biotechnology Information. They have a lot of information about taxonomy in general, as well as a heirarchical database of every species (including some extinct ones, though no dinosaurs) for which any DNA or Protein sequence has been published. Even if you're not interested in the data there for professional reasons, the NCBI web page is a fantastic example of how to make Gigabytes of data accessable on-line.

What's wrong with D.A.R.E.?

Over the last several years, ever-louder questions and criticisms about the merits and wisdom of D.A.R.E. have emerged. This section attempts to share those that have come to the attention of authors of this web page.

1. Efficacy. Despite its huge popularity, and hundreds of millions in tax revenue and private contributions, no evidence exists that D.A.R.E. keeps kids off drugs. A large, developing body of studies documenting this conclusion is referenced in the accompanying list of references and other resources. The bottom line is that at best, in the words of the Justice Department-sponsored study by the Research Triangle Institute (338k), D.A.R.E. has a "limited to esentially nonexistent effect on drug use."

   The U.S. General Accounting Office reported, "There is little evidence so far that [D.A.R.E. and other "resistance training" programs] have reduced the use of drugs by adolescents" (U.S. GAO/GGD-93-82, "Confronting the Drug Problem," page 25).

   D.A.R.E.'s official response to this growing body of research is disdain for science. "Scientists tell you that bumblebees can't fly, but we know better," declared D.A.R.E. Executive Director Glenn Levant upon release of the government-sponsored report that D.A.R.E. doesn't work (USA Today, October 11, 1994). The local D.A.R.E. officers we talked to also claim that the anecdotal evidence is convincing that D.A.R.E. is working extremely well, citing the warm reception they have received by schools and parents. "Besides," they often add, "even if we are reaching only one kid, it's worth all the effort."

   (It is not clear why their standard of success is so low. We would hardly declare a math curriculum successful if only one kid learned to add.)

   In an editorial October 15, 1993, The Chapel Hill (North Carolina) Herald observed, "If D.A.R.E. isn't doing the job it's supposed to, we owe it to fifth- and sixth-graders to find out why."

   Curiously, the web site of the National Institute on Drug Abuse, the nation's preeminent anti-drug abuse agency, doesn't even mention D.A.R.E.

2. Content. The content of the D.A.R.E. curriculum is raising a variety of concerns about what D.A.R.E. is actually teaching our children. These concerns include:
   • D.A.R.E.'s message to children is muddled and confusing. It doesn't tell kids that they must not use drugs. Instead, D.A.R.E. tells them that they have the "right to say no," implying that they have the "right to say yes." Despite the term in its name, D.A.R.E. doesn't teach kids what "drug abuse" actually is, or how it can be identified.
   • D.A.R.E. is not respectful of parents and other civilian adults. The D.A.R.E. video, called "The Land of Decisions and Choices," shown to students as part of Lesson 2, portrays all adults as drunks or other drug abusers, or senile...other than the D.A.R.E. officer. Parents find this film a bizarre, brazenly exaggerated depiction of drug use. Although each child is given a D.A.R.E. "workbook," students are encouraged to leave them at school and not take them home. Some parents worry that the heavy emphasis on "resistance skills" subverts their own authority with their children.
   • It is a well established fact that children's greatest drug risk is with alcohol and tobacco, yet D.A.R.E. is soft on those drugs, hammering almost exclusively on illicit drugs. As a condition of "participation" in D.A.R.E., children are expected to abstain from all drugs. D.A.R.E. officers themselves are not required to meet that standard.
   • D.A.R.E. is based on unproven, and likely false, educational hypotheses, the most notorious one of which is that using drugs is a sympton of low self esteem, or of high stress. Thus casual, responsible use of any drug (alcohol, caffeine, tobacco) by parents or anyone else is to be seen as pathological, i.e., "abuse." From this dubious premise, it is alleged that self-esteem can be "built" by reciting state-sponsored catechisms. These catechisms consist of claims of "rights" which are said to have been conferred on fifth grade D.A.R.E. students. They include the "right to be happy" and the "right to be respected."

   Many parents take issue with the emphasis on "self-esteem" in schools these days, and the notion that it can be readily "taught." Lillian Katz, Professor of Early Childhood Education at the University of Illinois, put it this way: "Self-esteem and self-confidence don't come from being told you are great. You get them by facing challenges and mastering them through hard work and persistence." (Readers Digest, April 1994, "Are We Demanding Enough of Our Kids?)

   To determine if students are experiencing a low, medium or high level of stress, students are given a test, in Lesson 8, called "My Stress Level." Among the causes of "high stress" are said to be: taking a test, being late for something, meeting someone new, being the first one to do something, or helping to plan a special event. In an earlier version, even "doing your chores" was said to cause stress.

3. Undermining the role and credibility of police. The role of police is to protect the public safety, and to respond to emergencies. It is neither fair nor reasonable to expect them to take on the job of teaching mental health and attitudes. Nor it is helpful for civics education for children to be taught fictitious "rights." When a child grows up and learns that she was lied to about her "right to be happy," how will she feel about the officer who taught her otherwise, or the school in which she was so taught?

4. Not fair to professional teachers. D.A.R.E. mocks their years of study, by asking them to step aside for a high school graduate with two weeks training to come in and teach mental health and psychology. If police officers have the education and training necessary to be good teachers, what is the point of requiring years of study and teaching certificates?

   If Johnny can't read, teachers bear accountability. If Johnny doesn't stay off drugs, will the police take responsibility for the failure of drug education in schools, and protect teachers from any attribution of blame?

5. Sacrifices excessive academic time. D.A.R.E. consumes approximately seventeen hours of academic time that would otherwise be available for science, math, reading or some other academic subject. In the absense of any proof that D.A.R.E. works, this is a substantial sacrifice of valuable school time.

6. Perpetuates the war. To many people, D.A.R.E. represents the strongest commitment our nation can make to curb drug abuse by young people, and that it deserves to be pursued, even when we know it isn't working. By thus deceiving America into thinking that we are doing something serious about keeping kids off drugs, D.A.R.E. is impeding the nation's efforts to find more efficacious ways to achieve the broader goals of national drug policy, viz., to protect the public health and safety, to prevent abuse, and to eliminate the crime and violence associated with illicit drug trafficking.

   Peter G. Arlos, a Pittsfield, Massachusetts, city councillor, put it this way:

   "The tragic truth that the nation is spending $700 million a year on a program that may not work has not sunk in on the local or the national levels. A large D.A.R.E. bureaucracy has grown up that feeds on itself. The public raises no uproar because it needs the comfort of its delusion that something is being done to protect children from drugs."
   Letter, Sunday Republican (Springfield, Mass.), November 21, 1993

7. Subverts public education by transforming schools into instruments for the propagation of prohibitionist doctrine and the perpetuation of the war waged in its defense. Although a national debate is growing over whether prohibition, enforced by war, can reasonably be expected to achieve the goals listed above, D.A.R.E. defends prohibition zealously, disputing that the distinction between legal and illegal drugs is based solely on historical anomaly. ("Drug legalization: surrender is not the answer!," National D.A.R.E. Officers Newsletter, January, 1995). Looking at history, especially pre-war Germany, some parents compare D.A.R.E. to previous instances of installing uniformed, sometimes armed, agents of the state in classrooms to tell children what their attitudes ought to be, and to obtain information about family home life which may be of interest to the state.

   
   This van, pictured on a web site maintained by a DARE officer, was seized by the government under a controversial program known as asset forfeiture, in which drug defendants can lose their property even if they are never found guilty of any crime.

   It is widely known that D.A.R.E. officers are instructed to put a "D.A.R.E. Box" in every classroom, into which students may drop "drug information" or questions under the pretense of anonymity. Officers are instructed that if a student "makes a disclosure related to drug use," the officer should report the information to further authorities, both school and police. This apparently applies whether the "drug use" was legal or illegal, harmless or harmful. In a number of communities around the country, students have been enlisted by the D.A.R.E. officer as informants against their parents.

8. D.A.R.E. costs a lot of money. Glenn Levant, the D.A.R.E. executive director, states that D.A.R.E. consumes some $750,000,000 per year. The money goes to purchase paraphernalia--T-shirts, bumper stickers, caps, pens, pencils, etc.--from D.A.R.E. -licensed vendors, as well as for training and overtime salaries for police." It is important to realize that every dollar spent on D.A.R.E. is a dollar not available for a useful, educationally sound drug education program in schools. The overwhelming preponderance of federal "Drug-Free Schools" money goes into the D.A.R.E. program.
   • How much money is spent on D.A.R.E.?
   • Who gets the money?
   • Who really pays for D.A.R.E.?