Slashdot Mirror
Longest Email Disclaimer Awards
evilandi writes: "The Register have announced the results of their Longest Email Disclaimer awards (2001 Daftas). The winner was financiers UBS Warburg with 1081 words, adding nearly seven kilobytes to every email they send." Any really good examples? Post them below. Law firms seem to be the worst offenders.
Last year I had all my email blocked for "inappropriate content" until I spoke to an administrator. I called the person listed for more information and was told that "encrypted text is not allowed for security purposes." I told them it wasn't encrypted, it was compressed, it was a ZIP file! The idiot told me, "We know, we unzipped it and we couldn't read it so it's still encrypted. You'll have to send it as plain text."
I tried to explain to the idiot that the file was a code dump from a 2M EPROM chip being sent back to the manufacturer to be checked for errors and modified. THERE WAS NO PLAINTEXT! But she still wouldn't listen to me. "We have strict security policies regarding encrypted content. NO EXCEPTIONS!"
Called the manufacturer and they suggested I do a hex dump and try sending that. It also was blocked as "inappropriate content." Then tried to FTP it to the manufacturer's site but found that FTP was also blocked.
Ended up having to use Laplink to transfer the file to a borrowed laptop, sneak the laptop out of the building, take it home and Laplink it into my home machine just so I could email the file to the manufacturer. By the time the modified file was sent back to me at home I had found a program called Split that would break the file up into pieces small enough to fit on a floppy. Would have worked great except I couldn't install Split on the NT machine at work without administrator privileges. (@%#%$#$%!!!) Still had to laplink it over from a borrowed laptop.
Now I've learned my lesson and moved the development/programming system over to a machine not on the network with it's own free (Bluelight) Internet service. All of this is against company policy; no non-networked machines, no OS except NT, no modems, no open (non-passworded access) machines... Sheesh!
However, we have no problem accepting any and all viruses through Outlook (or LookOut! as we tend to call it), crippling out email 3 times in the last 2 years. Is your company being run by idiots, too?
...if someone would post some kind of small reply to this article, and then, get this, make some kind of funny disclaimer at the end of his message! Hilarious! I wonder if anyone else has though of that?!
:)
WWJD? JWRTFM!!!
E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses
:-)
Even worse than M$ saying that outlooks sending of worms is a positive feature...
Your sig bugs me.
Bad commentry *is* worse than nothing. Even better than good comments, is code which needs less commentry.
Perfection would be attained when no comments are necessary at all, but this, like most forms of perfection is unattainable.
http://rareformnewmedia.com/
That area is a little murky at best. On one hand they can claim copyright to whatever they wrote and hence tell you what can and cannot be done with it.
On the other hand there was some mention early this year (during the cucat fiasco) of a section in the postal code prohibiting such restrictions on stuff you send unsolicited. But alas, that's a snail main regulation.
--= Isn't it surprising how badly I spell ?
Agreed. Legal disclaimers are a nightmare dreamed up by lawyers to keep themselves in a job. If they absolutely have to be there (and it's my view that they don't), then they should simply be a reference to the full small print:
"The invisible and the non-existent look very much alike." -- Delos B. McKown
Apart from the obesity of this particular disclaimer, has text of this nature ever been used successfully as a defense against any type of legal action, be it a civil suit or a government enforcement action? Can anyone point to any examples of disclamiers being accepted or rejected by a court?
sPh
We are dealing with a group within UBS Warburg at work at the moment, and not only do they have the huge disclaimer, but whatever mail software they use structures mails thusly:
1) Plain text section - big-ass disclaimer only
2) 1 or more arbitrarily name RTF files for the body, and possibly the message being replied to
I think it's HP OpenMail, but whatever it is, it really sucks.
"don't fall into the fallacy of believing that Perl can solve social problems. Maybe Perl 6 can, but that's a ways off"
Opinions expressed may not even be my own, let alone
those of any organisations, nations, species or
schools of thought to which I may be affiliated.
The frightening part is, I know an awful lot of librarians who would implement it. (The people who run html verifiers against their web pages and then proudly display a logo indicating they have end of paragraph tags.)
Speed of light. Conservation of mass. Bureaucracy. Some things are just constant...
Rob
Even if you did forward it and violate copyright, they wouldn't win anything as damages, a private message email has almost negligent value. (The actual message has almost no value, instead of the information, which you can give away anyway.)
-David T. C.
If corporations are people, aren't stockholders guilty of slavery?
The most sensible analysis (from a UK perspective) of email disclaimers is on the Stupid Email Disclaimers web site. Its contains a bit of logical (and legal) analysis, some sample disclaimers and some parodies as well.
Someone pointed it out on an email list when the Registers story first came out.
Notice in the "Most PC Disclaimer" award:
Employees must never send or store e-mails or attachments that are obscene, indecent, sexist, racist, defamatory, abusive, in breach of copyright, encrypted or otherwise inappropriate.
(emphasis mine)
Does this strike anyone else as unusually facist? They are lumping privacy into the list of "naughty" types of email. Has anyone else heard of a company that forbids using encryption?
What about SSL or SSH?
Looks like they expect everyone to have a T1. I suppose there is no such thing as a short message from this company. If you did write a short two line e-mail, I suppose the content would get lost with the legal spam added to the end of the e-mail.
Jumpstart the tartan drive.
And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot
Some facts:
McDonald's coffee was hot enough to cause second and third degree burns. McDonald's serves hundreds of thousands of cups of coffee per day. No human being is perfect.
Conclusion: an accident will occur, and someone will be severely burned.
When this happened, the woman asked McDonald's to cover part of her medical expenses. Not all of them, just part - she was willing to accept that she was partially responsible for the accident, and she wasn't asking for compensation for 'pain and suffering.' McDonalds repeatedly and disrespectfully refused.
So she sued. She got her medical bills paid, she got her 'pain and suffering', and McDonalds was penalized for giving customers a product that they KNEW their customers would hold in their laps and that they KNEW could cause severe tissue damage.
I do not feel that they were negligent in not telling people that boiling water is hot.
True. They were negligent in not telling people that they were being served boiling water. Rational people don't drink boiling water. I understand completely McD's reasons for serving ultra-hot coffee, but they need to be prepared to pay for the consequences of their actions.
While I would agree that she had a case for medical expenses, I do not feel that the US courts should serve the same purpose as the lottery.
Yup. Gotta agree with you there. ACTUAL damages should be paid; compensation for pain and suffering and emotional distress is iffy. Punitive damages are right out.
If a company has done something wrong and deserves to pay punitive damages, then those damages should go to a charity, or the local community, or the Federal treasury. But there is NO reason for a company to pay ME punitive damages. If someone robs my house and the judge sentences them to $a 50,000 fine and five years at hard labor, do I get the cash and the results of his work? Should I? Why then should civil damages be different?
Digital signatures would be useful, but not many companies use them/ they aren't as widespread as they should be.
On a different note, anyone know whether those disclaimers would stand up in court, like you can't forward it blah...blah...
Like postal mail, noone can tell me what I can or cannot do with stuff which lands in my mailbox. If its so important, then why are you stupid enough to send it to me? Anyone a lawer?
Translation: Make the bozo that established the policy approve the transmission of every copy of every email sent with the disclaimer.
This is exactly the kind of information that should be encoded according to RFC 1437.
www.timcoleman.com is a total waste of your time. Never go there.
Code commentary is like sex.
If it's good, it's VERY good.
My office has been taken over by iPod people.
From UBS AG's (AKA UBS SA, AKA UBS Warburg) disclaimer:
So wrong, so wrong... How can information contain viruses? It cannot. It is the carrier which contains those viruses, and only certain specific carriers at that. If they really cared about not sending out those viruses, they would use a carrier which does not allow executable content. Like, say... ASCII text.
Of course, they're in the financial sector, so they're probably shackled and tied to the upgrade vortex from Redmond. Bummer, I say.
--frank[at]unternet.org
Ah, everyone has DSL these days. That RFC is out of date :-)
nosig today
Actually, it's even worse now that flat rates are the norm. You pay what amounts to a tax on your Internet connection. It's not called out on any bill or otherwise made clear, but when an ISP has a .1-.5% load from crap like vcards, signatures, etc (I don't know the stats either, so I could be way off), they have to buy larger pipe a little bit sooner, and you pay a little bit more.
Ok, so perhaps it ammounts to a fraction of a dollar a month for the average home user. But, why should I be taxed for your footers? Just slap a URL on your messages and make the page as beefy as you like.
I've always been the champion of RFC 1855 AKA the nettiquite guidelines. And I quote:
I attach this to all my personal messages. IANAL but I married one...
No disclaimer shall be read or observed. Any person (either corporate or individual) making any statement shall be held civily and criminally liable as a party to any act I may do while following the intentional, implied or inferred (whether correctly or not) directions from said statement. So there.
That way it's your fault if you reply to it and I screw up.
--
A friend of mine works for an insurance company in Italy (AXA Assicurazioni), and the disclaimer is printed in Italian, English and French:
Questo messaggio è riservato; il suo contenuto non rappresenta
in nessun caso un impegno da parte di AXA Assicurazioni, AXA SIM,
od AXA REIM, ad eccezione di quanto previsto in accordi conclusi
per iscritto tra voi ed AXA Assicurazioni, AXA SIM o AXA REIM.
Qualsiasi pubblicazione, utilizzo o diffusione, anche parziale di
questo messaggio, deve essere preventivamente autorizzata. Nel
caso in cui non foste destinatari del presente messaggio,vogliate
cortesemente avvertire immediatamente il mittente.
Ce message est confidentiel; son contenu ne represente en aucun
cas un engagement de la part de AXA Assicurazioni, AXA SIM ou AXA
REIM sous reserve de tout accord conclu par ecrit entre vous et
AXA Assicurazioni, AXA SIM ou AXA REIM. Toute publication,
utilisation ou diffusion, meme partielle, doit etre autorisee
prealablement. Si vous n' etes pas destinataire de ce message,
merci d'en avertir immediatement l'expediteur.
This message is confidential; its contents do not constitute a
commitment by AXA Assicurazioni, AXA SIM or AXA REIM, except
where provided for in a written agreement between you and AXA
Assicurazioni, AXA SIM or AXA REIM. Any unauthorised disclosure,
use or dissemination, either whole or partial, is prohibited. If
you are not the intended recipient of the message, please notify
the sender immediately.
"It is more complicated than you think" (The Eighth Networking Truth from RFC 1925)
I saw this on the other site yesterday.
Best Slashdot Co
It's fun to point out spelling errors, (forumns) in posts from a grammar nazi.
Best Slashdot Co
Working in the Health care field that disclaimer is Required to be attached to all fax/mail documents. We don't email documents (yet), so it's not on the outgoing email yet.
...this is from someone who uses 32-bit encryption. I hope that's not your *private* key ;-)
Think of how many spams could have been sent with all that wasted bandwidth!
Reading this message assumes you've read http://...
That's funny anyway. Basically, emails disclaimers are saying "warning : maybe the content of this message has been modified by a third party" .
But well... why would the third party modify the message body but leave the disclaimer ?
That's pointless.
To send a message that has to be trusted :
But of course, spammers may use this to validate addresses they have sent fake important messages to. Fighting spammers stupidity is an endless war.
{{.sig}}
Under US Code Title 47, Sec.227(b)(1)(C), Sec.227(a)(2)(B) This email
address may not be added to any commercial mail list with out my
permission. Violation of my privacy with advertising or SPAM will
result in a suit for a MINIMUM of $500 damages/incident, $1500 for
repeats.
Or maybe there's a large conspiracy against the poor man by Slashdot, Intel, Microsoft, and the Bavarian Illuminati. Well, maybe not. But there could be!
OK, I'll get get some sleep now. But not after I link to Mike's new page.
Among other things, this page has an earlier and much shorter version of the UBS warburg disclaimer. Apparently it has been growing -- run away! run away!
DO NOT LEAVE IT IS NOT REAL
Why the hell did this get marked as redundant?
Aside from the fact that moderators are generally clueless. Either that or Michael is on the loose again.
In Soviet Russia...michael would be rotting in Siberia!
This was at the end of an email sent to me from an outside firm. It's not my companies (thank god(s)) but I figured it should be added to the mix:
This electronic mail message and any attached files contain information intended
for the exclusive use of the individual or entity to whom it is addressed and
may contain information that is proprietary, privileged, confidential and/or
exempt from disclosure under applicable law. If you are not the intended
recipient, you are hereby notified that any viewing, copying, disclosure or
distribution of this information may be subject to legal restriction or
sanction. Please notify the sender, by electronic mail or telephone, of any
unintended recipients and delete the original message without making any copies
As long as we're on the subject of emails, though, I should point out that even worse than HTML mail and 7K legal mumbo-jumbo is:
embedded Flash sig files!
I kid you not:
http://www.cetan.com/flash-email/flash-email.html
There are 3 screen shots from this flash embedded email.
In Soviet Russia...michael would be rotting in Siberia!
This e-mail is confidential and solely for the use of the intended
recipient. If you are not the intended recipient, you are obligated to
kill yourself and others who might have seen it immediately. Thank you.
This message has been scanned for memes and dangerous content by MindScanner, and is believed to be unclean.
</Sarcasm>
And people wonder why we need faster routers....
www.eFax.com are spammers
By reading this comment, you agree to sell your first-born to Jacob Lee of Cincinnati, OH.
This comment must be destroyed within 30 minutes of reading under full penalty of U.S. law. The editors of this site shall be held responsible if this comment is not removed at the end of the appropriate time period.
This agreement is not applicable in the states of New Jersey, Maryland, and Delerium.
All Your First Born are Belong to Us
--
Friends don't let friends misuse the subjunctive.
The .sig says: 'You have received email, but your system must first be restarted before this feature can be used.'
I'm waiting for the day I see: Shutdown and Restart: your system must first be restarted before this feature can be used. Almost as bad as when you get the End Task box for an unnamed task (the shutdown process); ending the task halts the shutdown process and you're right back at the desktop so you hit the pwr and then Win9x blames you for not shutting the system down properly.... you know the drill. Grrr.
Give me my freedom, and I'll take care of my own security, thank you.
This is so true. I love reading the small print on products to find exactly what some stupid people have done with them. "Do not insert forcibly into body cavities","Not to be used for drying pets", etc.
My favorite disclaimer was from a local brewery who were giving out scratch cards to win a free T-shirt. It said something like:
This offer valid until we
"What I look forward to is continued immaturity followed by death."
This product is meant for educational purposes only. Any resemblance to real persons living or dead is purely coincidental. Void where prohibited. Some assembly required. List each check separately by bank number. Batteries not included. Contents may settle during shipment. Use only as directed. No other warranty expressed or implied. Do not use while operating a motor vehicle or heavy equipment. Postage will be paid by addressee. Subject to CAB approval. This is not an offer to sell securities. Apply only to affected area. May be too intense for some viewers. Do not stamp. Use other side for additional listings. For recreational use only. Do not disturb. All models over 18 years of age. If condition persists, consult your physician. No user-serviceable parts inside. Freshest if eaten before date on carton. Subject to change without notice. Times approximate. Simulated picture. No postage necessary if mailed in the United States. Please remain seated until the ride has come to a complete stop. Breaking seal constitutes acceptance of agreement. For off-road use only. As seen on TV. One size fits all. Many suitcases look alike. Contains a substantial amount of non-tobacco ingredients. Colors may fade. We have sent the forms which seem right for you. Slippery when wet. For office use only. Not affiliated with the American Red Cross. Drop in any mailbox. Edited for television. Keep cool; process promptly. Post office will not deliver without postage. List was current at time of printing. Return to sender, no forwarding order on file, unable to forward. Not responsible for direct, indirect, incidental or consequential damages resulting from any defect, error or failure to perform. At participating locations only. Not the Beatles. Penalty for private use. See label for sequence. Substantial penalty for early withdrawal. Do not write below this line. Falling rock. Lost ticket pays maximum rate. Your canceled check is your receipt. Add toner. Place stamp here. Avoid contact with skin. Sanitized for your protection. Be sure each item is properly endorsed. Sign here without admitting guilt. Slightly higher west of the Mississippi. Employees and their families are not eligible. Beware of dog. Contestants have been briefed on some questions before the show. Limited time offer, call now to ensure prompt delivery. You must be present to win. No passes accepted for this engagement. No purchase necessary. Processed at location stamped in code at top of carton. Shading within a garment may occur. Use only in a well-ventilated area. Keep away from fire or flames. Replace with same type. Approved for veterans. Booths for two or more. Check here if tax deductible. Some equipment shown is optional. Price does not include taxes. No Canadian coins. Not recommended for children. Prerecorded for this time zone. Reproduction strictly prohibited. No solicitors. No alcohol, dogs or horses. No anchovies unless otherwise specified. Restaurant package, not for resale. List at least two alternate dates. First pull up, then pull down. Call toll free number before digging. Driver does not carry cash. Some of the trademarks mentioned in this product appear for identification purposes only. Objects in mirror may be closer than they appear. Record additional transactions on back of previous stub. Unix is a registered trademark of AT&T. Do not fold, spindle or mutilate. No transfers issued until the bus comes to a complete stop. Package sold by weight, not volume. Your mileage may vary. Known as Hellman's east of the Rockies. Beware of greeks bearing gifts. Beware of gifts bearing greeks. This side up. Don't take any wooden nickels. Don't take candy from strangers. Void where prohibited. Caveat Emptor (Buyer beware) Caveat Vendor (Beware of street people). Donde esta el bano. Beware of DOS. Look both ways before crossing the street. Always wear safety belt. Always wear deodorant. Don't forget to breathe. If you park, don't drink...accidents cause people. This supersedes all previous notices. This disclaimer may not be copied without the expressed written consent of whoever I stole it from.
Ant(Dude) @ Quality Foraged Links (AQFL.net) & The Ant Farm (antfarm.ma.cx / antfarm.home.dhs.org).
Are we to hail this as the start of a new beautiful friendship between Slashdot and El Reg? Will we see an end to the bitchy backstabbing on both sides (but that was blatently started by Slashdot, The Reg being a better quality and funnier news site and all that)?
One can dream I suppose.
xxx Stuii!
Dude...you married a fruit fly (Drosophila melanogaster)! At least that's according to the BLAST search at NCBI...
....are nearly as annoying as people who span their comments over the title and body of their posts.
NOTE: The information in this post is confidential and may be legally privileged. If you are not the intended recipient, you must not read, use or disseminate that information. Although this post and any attachments are believed to be free of any virus, or any other defect which might affect any computer or IT system into which they are received and opened, it is the responsibility of the recipient to ensure that they are virus free and no responsibility is accepted by NTSwerver for any loss or damage arising in any way from receipt or use thereof.
NTSwerver is a bored person. A list of the names of bored persons is open to inspection in your dreams.
This message has been checked for all known viruses by UUNET delivered through the MessageLabs Virus Control Centre. For further information visit http://www.virus.net/products/security/virus/
----------------------------
-----------------------
Moderator's essentials
A few months ago I received an e-mail with the following disclaimer:
The sender believes the e-mail is free from viruses? Considering most of the recent virus and worm outbreaks are spread without the sender addressing any messages at all, that doesn't offer much consolation. It is even more ridiculous to say that an e-mail "could have been infected during transmission"--like someone is going to intercept a message, infect it, and pass it right on?
The disclaimer was actually forwarded to me from of my supervisors--thankfully it didn't take much of a debate for me to explain that our company didn't need to tag all of our outgoing mail with the same text.
---
What I should have said was nothing.
Law firms seem to be the worst offenders.
Wouldn't you seize the opportunity to advertise your work in every email you send?
And everyone who replaces "-----BEGIN PGP MESSAGE-----" with "-----my network admin is an idiot-----" can send out confidential information...- ----
---------------------------------
I hate long disclaimers...
--
This post has been prepared by the division, group, subsidiary or affiliate of ralmeida AG ("ralmeida") identified herein. In certain countries ralmeida AG is referred to as ralmeida SA, which is a translation of ralmeida AG, its registered legal name. ralmeida Warburg is a business group of ralmeida AG. This post is for distribution only under such circumstances as may be permitted by applicable law, including the following: This post has no regard to the specific investment objectives, financial situation or particular needs of any specific recipient. The post is published solely for informational purposes and is not to be construed as a solicitation or an offer to buy or sell any securities or related financial instruments. The securities described herein may not be eligible for sale in all jurisdictions or to certain categories of investors. The post is based on information obtained from sources believed to be reliable but is not guaranteed as being accurate, nor is it a complete statement or summary of the securities, marketsor developments referred to in the post. The post should not be regarded by recipients as a substitute for the exercise of their own judgement. Any opinions expressed in this post are subject to change without notice and ralmeida is not under any obligation to update or keep current the information contained herein. ralmeida and/or its directors, officers and employees may have or have had interests or long or short positions in, and may at any time make purchases and/or sales as principal or agent, or ralmeida may act or have acted as market-maker in the relevant securities or related financial instruments discussed in this post. Furthermore, ralmeida may have or have had a relationship with or may provide or has provided corporate finance, capital markets and/or other financial services to the relevant companies. Employees of ralmeida may serve or have served as officers or directors of the relevant companies. ralmeida may rely on information barriers, such as "Chinese Walls," to control the flow of information contained in one or more areas within ralmeida, into other areas, units, divisions, groups, or affiliates of ralmeida. Options, derivative products and futures are not suitable for all investors, and trading in these instruments is considered risky. Past performance is not necessarily indicative of future results. Foreign currency rates of exchange may adversely affect the value, price or income of any security or related instrument mentioned in this post. Clients wishing to effect transactions should contact their local sales representative. ralmeida accepts no liability whatsoever for any loss or damage of any kind arising out of the use of all or any part of this post. Additional information will be made available upon request. EEA: This post has been issued by ralmeida Warburg Ltd., regulated in the UK by the Securities and Futures Authority. In the UK this post is for distribution to persons who are not UK private customers. Customers should approach the analyst(s) named on the cover regarding the contents of this post. For investment advice, trade execution or any other queries, customers should contact their London representative. Switzerland: This post is being distributed in Switzerland by ralmeida AG. Italy: Should persons receiving this research in Italy require additional information or wish to effect transactions in the relevant securities, they should contact either Giubergia ralmeida Warburg SIM SpA, an associate of ralmeida SA, in Milan or ralmeida Warburg (Italia) SIM SpA, a subsidiary of ralmeida SA, in Milan or its London or Lugano Branch. South Africa: ralmeida Warburg Securities (South Africa) (Pty) Ltd. (incorporating J.D. Anderson & Co.) is a member of the JSE Securities Exchange SA. United States: This post is being distributed to US persons by either ralmeida Warburg LLC or by ralmeida PaineWebber Inc., subsidiaries of ralmeida AG; or (ii) by a division, group, subsidiary or affiliate of ralmeida AG, that is not registered as a US broker-dealer (a "non-US affiliate"), to major US institutional investors only. ralmeida Warburg LLC or ralmeida PaineWebber Inc. accepts responsibility for the content of a post prepared by another non-US affiliate when distributed to US persons by ralmeida Warburg LLC or ralmeida PaineWebber Inc. All transactions by a US person in the securities mentioned in this post must be effected through ralmeida Warburg LLC or ralmeida PaineWebber Inc., and not through a non-US affiliate. Canada: This post is being distributed by ralmeida Bunting Warburg Inc., a subsidiary of ralmeida AG and a member of the principal Canadian stock exchanges & CIPF. A statement of its financial condition and a list of its directors and senior officers will be provided upon request. Singapore: This post is being distributed in Singapore by ralmeida Warburg Pte. Ltd. Hong Kong: This post is being distributed in Hong Kong to investors who fall within section 3(1) of the Securities Ordinance (Cap 333) by ralmeida Warburg Asia Limited. Japan: This post is being distributed in Japan by ralmeida Warburg (Japan) Limited to institutional investors only. Australia: This post is being distributed in Australia by ralmeida Warburg Australia Limited in relation to fixed income securities, and ralmeida Warburg Australia Equities Limited in relation to equity securities. New Zealand: This post is being distributed in New Zealand by ralmeida Warburg New Zealand Ltd in relation to fixed income securities and ralmeida Warburg New Zealand Equities Ltd in relation to equity securities. + 2001. All rights reserved. No part of this post may be reproduced or distributed in any manner without the written permission of ralmeida. ralmeida specifically prohibits the re-distribution of this post, via the Internet or otherwise, and accepts no liability whatsoever for the actions of third parties in this respect. Visit our website at http://www.ubswarburg.com This message contains confidential information and is intended only for the individual named. If you are not the named addressee you should not disseminate, distribute or copy this e-mail. Please notify the sender immediately by e-mail if you have received this e-mail by mistake and delete this e-mail from your system. E-mail transmission cannot be guaranteed to be secure or error-free as information could be intercepted, corrupted, lost, destroyed, arrive late or incomplete, or contain viruses. The sender therefore does not accept liability for any errors or omissions in the contents of this message which arise as a result of e-mail transmission. If verification is required please request a hard-copy version. This message is provided for informational purposes and should not be construed as a solicitation or offer to buy or sell any securities or related financial instruments.
--
This space left intentionally blank.
what would happen if A LOT OF people sent them an email saying this disclaimer sucks and included the disclaimer in it?
Seriously, I tried looking for it but that's quite a popular group and I don't have the time, so if anyone can tip me off to the thread name I'd appreciate it (in case I need to cover my @$$). Better yet would be a link to the thread on groups.google.com (work won't let me install a newsreader). Cheers. Dr Cheeks.
All thoughts expressed within this message are those of The Church of Scientology and in no way represent the free will of the sender of this email. The Church of Scientology doesn't approve of using nuclear weapons to attack The Church of Scientology. The Curch of Scientology reserves the right to take part of that last sentence out of context in a court of law if this email is delivered to anyone not affiliated with The Curch of Scientology. If you are not the intended recipient of this email we will sue.
Balls! If your policy needs 7kB to summarise, you need a new policy. How about this? "UNDER NO CIRCUMSTANCES WHATSOEVER shall email transactions of any sort be considered authoritative or legally binding with respect to (the company), regardless of statements to the contrary." Maybe tweak a few words, but it says pretty much all that has to be said. Hell of a lot less than 7kB, too.
"People who do stupid things with hazardous materials often die." -- Jim Davidson on alt.folklore.urban
As for the other guy, who thought the disclaimer was stupid, these brokers are not terribly computer savy, and so they frequently pass along things like I Love You to their huge several hundred person client lists. Without that disclaimer, UBS Warburg could potentially be liable for any damages caused (despite the fact that the recipient would have to be as stupid as the sender in order to get infected). They still could be, but if they can avoid liability, they will.
My views may not necessarily reflect those of UBS PaineWebber :)
The only "intuitive" interface is the nipple. After that, it's all learned.
"The question of whether a computer can think is no more interesting than that of whether a submarine can swim" -EWD
And how about the serious grammatical error concerning the last two sentences: they should be joined as one.
http://blog.grcm.net/
After reviewing the first contract, I was impressed by the attorney's disclaimer, and his insight into ways in which his client could be screwed. Surely, I had not foreseen those factors. The next contract had a similarly insightful disclaimer, although it pointed out very different issues to be disclaimed.
Having now reviewed scores of these contracts over many years, I have learned several things:
- Every disclaimer was new and different from any prior disclaimer
- Each disclaimer represented a particular way in which an attorney's client had previously been screwed
- There are an infinite number of ways in which to screw somebody without violating the letter of a contract
All this gives way to an important truth about contracts: the words only stand up by the goodwill of the parties behind them, and similarly, cannot withstand the force of an able party who wants out. In the fast-paced exchange of internet communications, it amazes me that attorneys don't realize that their technical disclaimers zoom by without any real meeting of the minds, and therefore, create no basis for a meaningful contract.<bart
It's a EULA!
I'm fully aware of my sig:text ratio...
...Time is the best teacher, unfortunately it kills all of its students.
By posting this, you've not only not kept /. free of spelling and grammatical errors, but you've introduced your own spelling and grammatical errors.
Text Ganked from: http://www.geocities.com/SunsetStrip/Alley/8069/pr oduct.html
Product not included. Product may differ from illustration. Not intended for use. Prices may vary. Selection may vary by location. Sales tax will be added to the retail price of all taxable items. Product has been shown to cause Cancer in laboratory animals. The makers of Product are not responsible for loss of hair, injury, or death resulting from the use of Product. Do not put product in mouth, nose, eyes, or other orifices. If contact occurs rinse immediately. If ingestion occurs induce vomiting. Do not place Product in direct sunlight or clean with harsh solvents, as deformation may occur. Dry clean only. Product not fit for human consumption. In countries abiding by the Geneva Convention, Product may not be legal. Product is manufactured by slave labor in such countries where slave labor exists. Product may not function as described. Other Products available. Product may induce epileptic seizures. Street price may vary. All refunds must be accompanied by sales receipt. Not all standards upgradable. Product subject to blackout dates. Receipt of purchase required for purchase. Company is not responsible for omissions or errors in typography or photography. Other Product names are trademark of their respective companies. Product may emit radiation. Not intended for use by children. Extended use may cause blindness or even death. Provided by the management for your protection. If empty please call attendant. Store in a cool dry place. Does not comply with FCC class B radiation emitting device. Authorized for use in military applications. Not for export. Export of product may be considered treason. Do not use Product with prescription drugs. Other capacities available. Optional accessories available. Product shipped in sealed lead case. Product escorted by U.S. military personnel. Specifications may be changed without notice. 1 week return. Allow 6-8 weeks for delivery. 30 day warranty begins on day of shipment. Supply of product may be limited. Taste, Color, and Smell may vary. Contents flammable. Contents under pressure. Contains CFC's. Product contents do not comply with EPA standards. Product eligible for parole in 6-8 months. No animals were harmed in the making of product. Product contains 50% animal fatty tissue. Offer only applies to new offers. Contains one or more of the following: Albatross, Beryllium, Carcinogens, Dung, Excrement, Funk, Guam, Hallucinogens, Igneous Rock, Joe, Korn, Lumber, Mike, Narcotics, Orange #5, Pork, Something Starting with a Q, Rust, Stool, Tubers, Unsanitized Waste, Velcro, Walrus, Xylophone, Yak, Zirconium. Product not responsible for conduct of Product. Late Night prices may vary. Product not sold after dark. Product ends at Date, or until supplies last. Only available at participating locations. With Approved Credit. Pricing available to qualifying commercial organizations. Estimated street prices. Product may not be for those who use Product on a regular basis. Not recommended for pregnant women. Proof of citizenship required for purchase. Use product at own risk. Damage may occur during shipment. Packaged by weight, not volume. Contents may settle during shipment. Other models available. 10% restocking fee on returned Product. Some assembly required. Syntax error in 105. For full functionality optional part #105 must be purchased. Part #105 not available in U.S. Part #105 may only be purchased in U.S. Do not use near heat or flame. Do not smoke until product is dry. Product is not associated with Product(TM) of Company. Product imported by Product Importers, Denver , Co. All major credit cards accepted. Product contains 3.2% alcohol by volume.
The only thing I don't get is why anybody should consider it incomprehensible. The language is a bit beaurocratic, but I can understand it.
"If you want to buy or sell stuff, don't use e-mail to tell us, cos we'll probably ignore it. Also, we might want to check up that it is you if you ask us to do anything by e-mail.
"If you want us to give your stuff to other people or change your own details, write to us on real paper.
"If you ask us to do stuff, it will be assumed you asked us at the time we first looked at your instructions. Even then, we might not do it straight away (and you won't complain). If you want us to do something quickly, or you don't want anybody else to know about it, don't use e-mail. Don't use e-mail for anything illegal.
"If you do use e-mail, you realise that other people could read it or tamper with it, something could go wrong, you might get a virus, or it might just be late (if our inbound e-mail server is broken, for example)."
Seems quite clear to me.
All I want is a secure system where it's easy to do anything I want. Is that too much to ask ~~ Randall Munroe
Actually, it's simpler than that. If people use PGP or S/MIME encryption, you cannot scan their e-mails for all that nasty un-PC stuff, or viruses or confidential information or libellous comments and so on.
There has been at least one case (in the UK) of somebody using their company e-mail system to distribute defamatory material to his/her friends. The person who was the subject of the defamation sued the company for libel (which was deemed to be responsible for "publishing" the e-mail) and won.
All I want is a secure system where it's easy to do anything I want. Is that too much to ask ~~ Randall Munroe
I suspect this is less a matter of ignorance and more a matter of possible liability for the Council under the lovely, fluffy, entirely-for-the-greater-good save-the-little-children draconian monstrosity that is the Regulation of Investigatory Powers Act. Remember that under UK (insane) law, non-disclosure of a password to any law-enforcement official who decides to ask for it, for any or no stated reason, can land someone with a 10 year prison sentence.
And forgetting a password, or having never known it in the first place, or refusing to give it as the 'encrypted file' inquestion is not yours/not encrypted/a bunch of lost clusters, is implicitly stated in the Act to be no defence at all. Which is of course perfectly sane, reasonable, mature, civilised and a total affront to sanity.
TomV
My boss sent me an email that was 365 lines of message source for 20 lines of text.
Now, that's what I call community building.
M.
Email disclaimers are a good thing, IMNSHO, but there seems to be a sort of haughtiness arms race when it comes to them, ESPECIALLY lawyers. It seems to me that they assume everyone in the world is out to steal their data, or misquote them, or misdirect their oh-so-vital documents.
Are emails, from lawyers in particular, important?
Yes.
Is everything a lawyer says a pearl of wisdom?
No
If something is so important, either MD5 hash it for veracity, or encrypt it for privacy! This seems like an archaic solution to a new problem.
I want to delete my account but Slashdot doesn't allow it.
Saw this once somewhere. I'm paraphrasing but...:
---
This messages is copyright by me. License to distribute this message in part or in whole is $10,000 US. Permission is hereby given for everyone to distribute this message free of charge, excluding Microsoft.
By reading, sending, copying, forwarding, or distributing this email via mean electronic or physical, by person or automatically by computer system/network you automatically agree to these terms.
Just think, one day this will be -1, Redundant. :)
---
Hammer of Truth
Although, i guess many licence agreements are not ment to be read, just used as backup when something goes wrong, something to fall back to if problems occur. Take napster as an example, they dont care if people copy music illegaly, because when they are used, they are not responsible.
(KISS = Keep It Simple Stupid)
Probable impossibilities are to be preferred to improbable possibilities.
Aristotele
And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot set a precedent (both in peoples minds and in a very legal sense) that ridiculous lawsuits could be won, even if there was no lasting damage.
Don't beat around the bush, say what you really think. The issue as I see it is that common sense doesn't apply anymore -- and I blame the Kennedys for starting this crap. Clinton just added fuel to the fire. Let's look at how common sense has become a rare commodity in the United States of America:
A farmer sets up a stepladder, a common tool used in homes and businesses by the millions. This is not the first time the farmer has used this tool. The purpose of using the tool was to fix a door on his barn. What the farmer failed to realize is that two legs of this common tool were on solid ground, while two legs were on a pile of manure he had built up over time. When he climbed the ladder, the manure gave way, the ladder pitched forward, and threw the farmer off. The result of his short flight was a broken leg.
The farmer then sues the ladder manufacturer for negligence! It seems there was no warning on the ladder to ensure that all four legs are sitting on a firm surface. Result: $40K settlement in favor of the farmer.
Now do you understand why so many products have so many labels that state the obvious to people with common sense?
Your tax dollars at work.
krystal_blade
It will be easy to motivate our fellow man; there is hardly anything people treasure more than not being annihilated.
The disclaimer goes out only to mail sent outside the bank. And yes, it's huge.
Why? 'Cause when you deal w- transactions that range in the millions of dollars you need to keep all your legal ducks in a row. And the swiss love ridicouslly complex and detailed things. (watches, legal disclamers, Army knives)
This one's from Christian Antkow of id Software (don't sue me please, if you sue me you will feel the power of MY disclaimer ;)
:-)
Don't know why, but I like it
Here it is:
*** Disclaimer: Opinions are my own and in no way reflect those of id Software
This disclaimer does not cover misuse, accident, lightning, flood, tornado,
tsunami, volcanic eruption, earthquake, hurricanes and other Acts of God,
neglect, incorrect line voltage, improper or unauthorized use, broken antenna
or marred cabinet, missing or altered serial numbers, removal of tag,
electromagnetic radiation from nuclear blasts, sonic boom vibrations, customer
adjustments that are not covered in this list, and incidents owing to an
airplane crash, ship sinking or taking on water, motorvehicle crashing,
dropping the item, falling rocks, thieving lawyers, crazy ex-girlfriends,
leaky roof, broken glass, Y2K bug, mud slides, forest fire, or projectile
(which can include, but not be limited to, arrows, bullets, shot, BB's,
paintball, shrapnel, lasers, napalm, torpedoes, or emissions of X-rays, Alpha,
Beta and Gamma rays, knives, stones, etc.).
Two Worlds - One Sun [Spirit]
The contents of this message do not reflect the views of Maximegalon University, Sirius Cybernetics, the Vogons or Natalie Portman. Content may be considered factual in all or part within the context of an off camera utterance by George "Wooster" Bush in any or all parallel universes. All or part of this message may not be re-used without persimmon, under penalty of death, dismemberment, renoberation, a good firm spanking, a stern letter to your parents, or a poetry reading by Paula Nancy Millstone Jennings. Incidently, the attached virus, which is working its way through your hard-drive, scrambling its brains as only a Zygorthian space raider death-ray can closely simulate. Have a nice day.
-- .sig are belong to us!
All your
A feeling of having made the same mistake before: Deja Foobar
A friend of mine (ok, my ex-wife!) is a genetic engineer... her sig file read:
c gc
c ga
a tc
a gg
c gc
c ga
a tc
a gg
c gc
c ga
a tc
a gg
Jane Doe
Office: 770.555.1212
Mobile: 770.555.1213
DNA Seq :
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
tcgactgactgactggcgcgatcgacgagctcgatcgagaggctacg
gactgactgactggcgcgatcgacgagctcgatcgagaggctacgcg
gcgcgatcgacgagctcgatcgagaggctacgcgcgatattatcgcg
tatcgcgatcgactgactgactggcgcgatcgacgagctcgatcgag
...
You get the idea.
---
WWJD! WWJD! WWJD!
Well they sure have most spammers beat!
Spammers almost always include a disclaimer that says that it isn't spam because you were on the opt-in list they bought, it's okay by non-existant U.S. laws, it's a one-time mailing, it's a one-time mailing, it's a one-time mailing, and how to remove yourself from their list by sending "REMOVE" in the subject line to a (usually non-existant) email address, etc.
But Warburg's disclaimer makes them all look like the pikers they are.
The really sad part is that I actually understand why they have to CYA like that. (Not sad that they have to do it, but that I understand it. I have gazed too long into the abyss...)
One line blog. I hear that they're called Twitters now.
I'm waiting for an ingenious lawyer to decide to use a complex disclaimer, crammed with legal jargon in every email he sends, as advertising where, he hopes to drum up business by demonstrating his extraordinary grasp of legal language. I have a feeling that must have been what the guy who drafted the UBS Warburg disclaimer was thinking. I'm suprised that I didn't find a URL ana paragraph at the bottom advertising legal services.
(laugh, it's funny)
--
--Got Lists? | Top 95 Star Wars Line
Um, no.
To paraphrase somebody else, "Lawyers don't sue people, plaintiffs sue people." Frivilous lawsuits exist because ordinary people bring idiotic things to court.
Plaintiffs are allowed to pres idiotic charges because any attempt to weed out "idiotic" lawsuits would be instantly and vehemently attacked by many people (in all likelihood, yourself included) as an attempt to strip ordinary people of their rights (which it would be.)
Now go on out and play in the street like a good little troll.
Obliteracy: Words with explosions
I once received a worm-generated email with links to p0rm sites along with a lengthy disclaimer. Quite funny actually.
====
Codeala - Just another mindless drone
Their legal disclaimer on every page of their site makes no sense, and neither does their epic television commercials... can anyone explain them to me?
I wonder if the person who wrote that tome of a sig for Warburg ever wrote EULAs for Microsoft. Can you imagine what would happen if they ever sent out spam? Or if somebody in the office got an email worm, and started jamming that one on the wires? Locusts would surely swarm...
political_news.c: warning: comparison is always true due to limited range of data type
Nice sig. :-)
--
"I'm not downloaded, I'm just loaded and down"
Southwark Council includes encrypted mail along with rascist, sexist, defamatory content in their list of inappropriate content. Say *what*?? The world's general ignorance of PGP and encruyption is very depressing. Someone (a C++ programmer, no less!) even asked me why my mail sig is "SHA1" ...
--
"I'm not downloaded, I'm just loaded and down"
am I the only one who reads it with a voice in their head, not unlike the 'quick spoken disclaimer at the end of tv commercials for crappy products'?
What's your black-and-white take on lawyers working pro bono then? Vested interest, surely?
If you were blocking sigs, you wouldn't have to read this.
Pissedoff.com has some very...interesting disclaimers. If you can connect, that is.
--
Caveat Emptor is not a business model.
When adding a disclaimer to a signed mail, the singature is made invalid. ... guess... yeah, OUTLOOK.
Adding the disclaimer the right way (mime encapsulation) then the signature is useless
in
It still works fine in Netscape.
So our signed mails have no disclaimer because of outlook.
No comment on MS compliance with mime standards or any other standard.
George
Atari rules... ermm... ruled.
Congrats, I guess. My sister did her law degree there.
-----------------
www.lucernesys.comHorizon: Calendar-based personal finance
To paraphrase somebody else, "Lawyers don't sue people, plaintiffs sue people." Frivolous lawsuits exist because ordinary people bring idiotic things to court.
... do not drink out of it .
I take it that your position is that lawyers never encourage their clients to exaggerate the damage done to them by telling them that they can make a lot of money? While I do believe in the client taking personal responsibility for their action (taking it to court) the fact is that the lawyers often advise ppl that would otherwise not bring it to court to do so. And as for the judges, the judge that found McDonalds liable for not warning some (fully grown and presumably employed) idiot that coffee is hot set a precedent (both in peoples minds and in a very legal sense) that ridiculous lawsuits could be won, even if there was no lasting damage. Or what about the chipped glass beverage (that the person saw, and decided to drink out of anyway) container cutting someone's lip. If a glass beverage container is chipped
Plaintiffs are allowed to pres idiotic charges because any attempt to weed out "idiotic" lawsuits would be instantly and vehemently attacked by many people (in all likelihood, yourself included) as an attempt to strip ordinary people of their rights (which it would be.)
I do not advocate silencing anyone, or ignoring due process of law (despite my personal belief that the law does not work). Is it not the mark of a troll to make an attack on the and call someone a hypocrite after making false conclusions from the post and then declaring the poster to be in favor of the false conclusions? I do not believe that idiotic lawsuits should be "weeded out". I believe that when the idiotic lawsuit comes to a court of law, that court should not reward someone (esp. not to that degree) for being an idiot.
Anyway, you completely missed the main point. To put it in less humorous terms: Lawyers have a vested interest in keeping the cycle going, since their livelihood depends on it. I take it as a given that most people feel a dedication an loyalty to a process that supports them their entire life. Thus, I feel that most judges will have an interest in keeping the cycle going as well.
-CrackElf
"Blake is an idealist, Jenna. He cannot afford to think." - Kerr Avon, Star One, Blakes 7
Yes. But, if I recall correctly, she made millions off of that lawsuit. She can retire. She never has to work again. She can take cruises in the Caribbean every year. She can buy a small mansion. Disability does not pay that much. If I am in an accident at work, and I get paralyzed from the neck down, I do not get that much money. While I would agree that she had a case for medical expenses, I do not feel that the US courts should serve the same purpose as the lottery. I do not feel that they were negligent in not telling people that boiling water is hot .
What, should we sue god for making fire hot? or perhaps we should sue wood stove makers for not holding seminars on how to use one without burning oneself?
(btw: I was around back when she sued, and almost everyone that I knew at the time was completely surprised. Not that she won. But that she made a killing off of it.)
-CrackElf
"Blake is an idealist, Jenna. He cannot afford to think." - Kerr Avon, Star One, Blakes 7
I do not discriminate. Although I agree that common sense does not apply any more, I do not blame the Democrats. On most issues I either agree with the democrat or libertarian platforms, rarely the republican. I believe that most politicians, by their nature, are rather untrustworthy. (btw, did you know that many politicians are ... x-lawyers!) ok, enough about the lawyers and politicians. The truth is that everyone that is involved is to blame. From the plaintiff, right up to the politicians that make the laws to support this crap. Some have legitimately good intentions, some have self-serving intentions ...
The only thing that I can honestly say for certain is that I believe that there is abuse of the system. And that it should be stopped. Or at least kept in check.
-CrackElf
"Blake is an idealist, Jenna. He cannot afford to think." - Kerr Avon, Star One, Blakes 7
I must have been remembering the original figure if what you say is true. Or perhaps I am remembering another case. There have been many of them that caused me to become disillusioned with the legal system, and I tend to focus more on those that deny ppl personal rights, like freedom of speech and the right to privacy from corps and government.
... if they have it in their minds that they can make 2700k for suing, they are more likely to sue over something that did not really matter to them than if they just received their tangible losses back. Thus the likelihood of putting time and effort into pursuing 'justice' is not dependent upon the plaintiff's belief in the 'justice', but in the plaintiff's greed.
The fact that I am focusing on is that these things have fostered the idea that one can receive a lot of money out of a lawsuit. I can not quote you (and I am not a lawyer, nor have I ever wanted to be one so I am not going to dig up the cases) but I do remember that there was more than one case where ridiculous amounts of money was awarded to plaintiff(s).
As for the two days of coffee sales, wether the company can afford it is irrelevant to encouraging ppl to sue
Trust me when I say that on an emotional level, I am all for 'sticking it to the man (or the big corp)'(read my bio) But, if one chooses to work within the social structure, one has to think of what is good for society as a whole, and not just focus on vengeance against an evil corporation (not that there is any other kind of corporation). Is the law a means of recovering what is rightfully the plaintiff's, or a means for plaintiffs to enact revenge (at a healthy profit) against a corp. I am more in favor of mandating that all $ won in a lawsuit above and beyond tangible loss was given to a charitable organization to prevent a reoccurrence of the offence (such as lung cancer research in the class action vs the tobacco industry)? Or funding and independent safety regulatory comity for firestone (the ones with the faulty tires).
I do not believe that public resources should be used to enact personal vengeance or to satisfy personal greed. How many tax dollars a year are spent on litigation? (judges, courtrooms, investigations, etc). And how much money is spent in defining and refining laws (politicians, buildings, paper, investigations, etc.) And, more in my vein of thinking, what finite societal resources (manpower, money, space, energy, computers, paper, etc.) that could be used elsewhere are being taken up by this litigation?
-CrackElf
(BTW: I was a teen in the eighties, and some of the ppl on this board are quite young, some even born in the late eighties, and were not capable of having observed the world at 7 or 8 years of age in the early nineties or younger in the eighties. I was heading off that argument before it started.)
"Blake is an idealist, Jenna. He cannot afford to think." - Kerr Avon, Star One, Blakes 7
Without all of the frivolous lawsuits abounding, disclaimers would not be necessary. Frivolous lawsuits exist because judges (x-lawyers) allow lawyers to bring idiotic things to court and win. The only way to be sure that you are not open to litigation from a lawyer is to hire another lawyer to look over your correspondence (and write disclaimers). No matter what, a lawyer gets money. It is a pretty good self perpetuating scam. Maybe I should have been a lawyer.
-CrackElf
"Blake is an idealist, Jenna. He cannot afford to think." - Kerr Avon, Star One, Blakes 7
Yay for my university winning the bi-lingual award :)
How? Under what law? What precedent cases have there been?
You can hardly expect people to believe a single wishy-washy sentence.
THL.
--
Keeping
Favorite Sig Ever: "Dress for success, wear a white penis"
Favorite Disclaimer: Author shall not be bound within the limits of any consumers ability to read.
--
Innocent people shouldn't be forced to pay for inferior software development.
--"Code Complete" Microsoft Press
Lets get all the disclaimers of the world and put them all in one place, that way people can just point to this one place when they want tot disclaim something
Some international standards board should come up with a standard all inclusive disclaimer and then all businesses could just put a link to it at the end of the email instead of spamming the end of the email.