Slashdot Mirror
Japan to Allow Human-Nonhuman Mixed Cloning
Sara Chan writes: "Japan has decided to allow combined human-animal embryos to be produced through cloning, which could result in mixed-species creatures. The intended purpose is to permit transplant organs to be produced in specially-bred animals. The original story is in a Japanese newspaper, but you can get an English summary here."
We got too many trolls already.
That soon we'll be seeing Spiderman, Wolverine and The Thing roaming the streets?
This just smells bad.
Bart: "How would I go about creating a half-man, half-monkey-type creature?" Ms. Krabapple: "I'm sorry, that would be playing God..." Bart: "God schmod. I want my monkey man!"
I'm a signature virus. Please copy me to your signature so I can replicate.
How else are they gunna make all that anime into live cinema. You need animal-human hybrids.
A rabbit in the hand is worth 4 in the cage
Is this a step forward for mankind, or a step backward?
Sig (appended to the end of comments you post, 120 chars)
I find it fascinating that in America, people freak out when they hear about human cells being cloned. But in Japan, they're discussing mixing animal cells with human cells. I wonder how Americans would react to such a combination? I don't think the Religious Right would handle this issue very well.
I find this disturbing. And I'm one of the people who can't understand at all why people are bothered by the idea of 'regular' cloning; I mean it really makes no sense to me. But allowing chimeras to be created? That's just something I never thought anyone would do.
Or am I misunderstanding what's actually going on. Are they simply doing things like creating human hearts in monkeys and the like? As with the tobacco plants we rigged up to create hemoglobin or insulin or whatever? I don't really see a problem with that, I guess.
I do see that they plan to ban 'regular' cloning, so I guess they don't want the whole 'mad scientist' thing going on. If it could really be used to ultimately cure sick people and make people more healthy then really (imo) it would be unethical to disallow it.
autopr0n is like, down and stuff.
My roomate has a thing for cat-girls and he's pretty excited right now. I however don't like this idea one bit. I mean most wild animals can kick a human's ass. Imagine a lion/man or and elephant/man. Smart and powerful. They'll take over. Just like exo squad, if you've ever seen it.
The GeekNights podcast is going strong. Listen!
*grunt* Yes, *snort* I agree *squeal*
Pig Organs: squeal when you say that.
-- @rjamestaylor on Ello
IANAGeneticist, but my understanding is that insulin for diabetics is produced by injecting human genes into e. coli bacteria. So, aren't we already making human-nonhuman (in this case, bacteria) hybrids?
I think this is the scariest frontline documentary I've ever seen:
Organ Farm
Should not be allowed to? Don't you think it is remotely possible that opposition to a given technology may be based on ignorance and superstition? A great example of this might be your mentioning Three Mile Island. You may not be aware of this, but Three Mile Island was not a disaster. The safety systems worked as designed, and very little radiation was leaked. The Chernobyl accident has been shown to have been caused by incompetency on the parts of the plant operators. This is far from any "intrinsic" danger in nuclear power. In fact, nuclear power is economical. It is also the most environmentally clean power source in places where space limitations prevent things like hydroelectric and wind power. Further, the irrational fear of nuclear-anything means that most Americans miss out on some important technologies: for example, all of the E coli outbreaks of the last decade could have been prevented through irradiation. Restaurants could serve medium rare burgers again.
Karma: Good (despite my invention of the Karma: sig)
Japan's first transplant procedure in 1968 resulted with the doctor being charged with murder because it wasn't clear if the donor was brain dead.
Aparently the taboo has something to do with Japan's Shinto and Buddhist beliefs. Here's a link: Japan Legalized Organ Transplants from Brain-dead.
Superficial reading of the Ananova article would give one the impression that they are talking about a partly human chimera (it is hard to read "combined human-animal embryos" any other way); which would be a horribly unethical monstrosity.
What they're undoubtedly talking about (though I can't verify it since I can't read Japanese) are transgenic animals which express human proteins which is nothing new and posses no real ethical challenges (other than those involving the safety issues of xenotransplantation such as the real posibility for introducing various pathogens into the human population).
Apocryphal.
HIV is a chimpanzee virus, well established in wild populations, and one which apparently causes them little trouble, Well adaped to its wild hosts, it spreads among them easily while maintaining a balance between surviving in their bodies and not damaging the host which are its natural home; this is why chimpanzees experimentally infected with HIV do not develop AIDS.
The most credible theory for transfer of the virus to humans involves a person hunting chimpanzees for food who had a cut or sore which came in contact with the blood of an infected chimp they killed.
Of course, this does nevertheless support your conclusion.
Here is the English version of the same newspaper article.
From the article:
The hope is that human organs could be grown in other species and later transplanted into humans.
However, some said the decision opens the door to the risk of creating mixed-species organs, or possibly even creatures.
The article is about the publication of guidelines on research into human cloning. While allowing the cloning of aggregate embryos, the Wednesday announcement bars all other embryo cloning, citing insufficient debate about the ramifications of such cloning.
The research hasn't even begun yet. Maybe its possible to grow aggregate embryos, maybe its not. Maybe it will result in mixed-species, maybe not.
What the hell are you talking about? Oh wait, you don't know either.
Developing and testing vaccinations in animals is and has been a very common practice in medical research. It also has absolutely nothing to do with cloning.
All nuclear reactors in the US were built with negative temperature coefficients. They are the safest reactor designs in the world. Chernobyl had a positive temperature coeffecient, this is true, but the meltdown was due to operator error, not poor reactor design. And the US reactors, even with their failsafe designs are not completely immune to accidents.
It is also important to note that it is cheaper to build reactors with positive temperature coefficients. Reactors are built this way because of politics, not because scientists don't know what they are doing. BTW, there was plenty of anti-nuke propaganda in the 50's and 60's.
As for the bit about geneticists not knowing what they are doing... how do you think science works? Pop culture tends to lead people to believe that scientists sit around blackboards with nonsense mathematical equations surrounding them until they come to some epiphany and boom, we have a warp drive. That is not how science works people! Science is a lot of experimentation, trial-and-error, and guesswork. A lot of things are discovered by accident. Mapping of the human genome doesn't suddenly mean that we know everything about human genetics. There is a lot of stuff we don't know, and we are only going to be able to further our knowledge if we experiment and try new things.
You say that opposition should not be allowed to be disregarded as ignorance and superstition. Well, all I have to say is that maybe the opposition should come up with some intelligent and coherent arguments. It is easy to be disregarded as reactionary if you don't sound like you know what you are talking about.
You see, Whatever created us gave us the ability to create life, and gave us the abilities we have by evolving us.
So anyone here who believes in god but isnt blinded by the bibles description of god, can understand that.
If we program a computer to do something the computer does what its created to do, whatever created us obviously created us to create and to destroy.
Thats basically our job.I belive theres supposed to be a balance in creation and destruction but right now we destroy more than we create due to greed.
If you use Linux, please help development of Autopac
Oh hell... now this is going to give all those greasy Otaku one more thing to fantacize about: real-life catgirls.
(Catgirls, a.k.a. "Nekomimi", are a popular fetish amongst Otaku. If you hadn't noticed, of course.)
Does it make you happy you're so strange?
"I tell you the truth, this generation will certainly not pass away until all these things [end of the world, etc.] have happened." - Jesus, Luke 21:32, c. 2000 YEARS AGO
This is one of the hardest verses in the gospels to interpret. Various views exist for what generation means.
Some take it as meaning "race" and thus as an assurance that the Jewish race (nation) will not pass away. But it is very questionable that the Greek term geneav (genea) can have this meaning.
Two other options are possible:
Generation might mean "this type of generation" and refer to the generation of wicked humanity. Then the point is that humanity will not perish, because God will redeem it.
Or generation may refer to "the generation that sees the signs of the end" (vv. 25-26), who will also see the end itself. In other words, once the movement to the return of Christ starts, all the events connected with it happen very quickly, in rapid succession.
All of the above commentary was taken from Bible.org.
I have a PhD in Nuclear physics and I am a chartered engineer.
Three mile island came within seconds of a melt down. It demonstrates conclusively that the nuclear industry was nowhere near as safe as it had claimed. I don't accept the spin from the PR flaks of the nuclear industry that we have to trust them until they kill 5,000 people for real.
If the dice had rolled only slightly differently, the operators at Cherobyl might have succeeded in shutting down the reactor, had the three mile island operators not been lucky the reactor might have gone. The design flaw at Chernobyl was one that could not have been predicted with the design tools available in the USSR or the US when the plants were built. It was an area of positive feedback in the control regime that could only be detected using 3d modelling. That did not become possible until the introduction of the first CRAY series - and even then it took quite a long time for the simulation software to appear.
Moreover, the placement of any potentially hazardous industrial complex on three mile island should never have been allowed, let alone a nuclear plant. The bridges to the island simply cannot support an evacuation in an acceptable time. Building a nuclear plant that close to manhattan was gross negligence.
I used the term 'intrinsicaly safe' in a technical sense, no light water design is intrinsically safe, there is a critical mass that is damped down to prevent runnaway. If the safety systems fail and do not fail safe as planned you get a heck of a bang.
The Canadian CANDU heavy water system is intrinsically safe. It employs heavy water as the moderator, if there is a failure of the pressure vessel etc, etc the glass containers shatter and the moderator drains away shutting down the reaction. In pebble bed each fuel element is encapsulated in a moderator shell, again no critical mass, no chance of a big bang.
Do not assume that because there are some ignorant critics of nuclear power that all critics are ignorant. If the nuclear industry had not told so many blatant and deliberate lies in the 60s and 70s there might have been fewer ignorant critics today.
Jim Cramer (The Street.com) has a rule - financial irregularities means sell. Basically when ypou have been lied to by the management of a company it is time to take the exit door (e.g. Enron). In the UK the Thatcher govt. discovered during their privatization of the electricity industry that far from being low cost, the nuclear stations were barely economic on an operating basis - there was no possibility of paying of the original capital costs or eventual decommissioning costs. As a result a government that started ideologically committed to nuclear power discovered that the books had been cooked and they could not sell the plants to anyone at any price.
Further, the irrational fear of nuclear-anything means that most Americans miss out on some important technologies: for example, all of the E coli outbreaks of the last decade could have been prevented through irradiation.
Irradiation is banned for good reason. If you irradiate food you kill off the bugs but not the toxins they create. If technology allows food that is unfit for human consumption to be passed of as fresh you can be 100% sure that it will happen in the US.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
A country has the guts (and yes, I'm not surprised it's Japan), to go about ignoring the stupid religious morals set by the US in regard to cloning animals/humans with the specific end of using them for organ harvesting.
I'm one step closer to being able to have a genetically perfect pancreas transplant, which means I'm a step closer to being able cease these stupid insulin injections 4-8 times a day.
Looks can be deceiving. Or CAN they?
here's a link saying why that's crap. Basically, the vaccine makers never used chimps in their research (there's no chimp DNA in the results). There is no SIV in the results.
The most telling line is this one though: Hooper argues that that theory lacks scientific proof and that no one has as yet produced scientific evidence to contradict his theory
In other words, "no one can disprove this, so it must be true!", or, in other words "It's total crap!". No legitimate scientist would ever say that, Its the same kind of crap spouted by people who don't believe in evolution or global warming.
autopr0n is like, down and stuff.
Japan today voted to change the official name of the island to "The Island of Dr. Moreau"
-
In genetics we use somatic cell hybridization for genetic analysis and chromosome mapping. It is the process of fusing human mouse cells and culturing them in a lab.
Transgenic animals have already been created in many countries. Pigs with human genes to prevent rejection of heart valves come to mind.
In my opinion, the article was poorly translated and the initial post was misleading. People are having images of werewolves and such. At this point in time it would be impossible to successfully create a hybrid of this type. In 10 or 20 years this might actually be a problem. Until then, it's science fiction.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
Human cloning? Far from being the "Attack of the Clones", nothing is more misunderstood than medicinal human cloning. Please, don't confuse the goals of The Human Cloning Foundation, the federation of misanthropes bent on finding a country willing to host their young Frankenstein adventures, with Medicinal Human Cloning.
The idea behind Medicinal Human Cloning (MHC) is to clone human cells at the cellular level, before cell differentiation. Cell differentiation occurs 2 weeks into the life of an embryo, when all the cells in the embryo stop being homogenous and, all at once, establish their own identities. Some become hand cells, some feet cells, some brain cells, some blood cells. This "magic" event is the point at which human life begins. MHC is the process of cloning human cells before this event.
The point of being able to harvest unlimited quantities of undifferentiated human cells is that these cells can become any cell in the body; they are "undecided", yet genetically matched to the recipient. The applications here are as numerous as you can imagine: tissue replacement, skin replacement for burn victims, manufactured organs custom-matched to the recipient. This is the promise we are debating; the lives of millions who could be saved by this procedure, from burn victims to heart attack victims.
This advance promises to revolutionize medicine. Not just technically, but from a societal perspective as well. If we understand anything about MHC, it is that it will be prohibitively expensive to apply to an entire population. An order of magnitude costlier than even heart transplantation, we are dealing with sums of millions of dollars per regenerated organ. And unlike transplantation, this technique will be able to prolong the life of anyone, indefinitely. As a society, we will soon be in the position of deciding the lifespan(s) of each of our citizens. Not because we control death; not euthenasia, but because we control life.
We've already seen this paradigm emerge with the "list" for heart transplants. The pathetic attempt at a "meritocracy" for deciding who receives a new heart has been a total failure, as evidenced by the case of David Crosby. The system is weighted in favor of the rich, against the poor. Will this paradigm dominate the field of Medicinal Human Cloning? Will only the rich live forever? Will money become the force of life? Not if we can help it. We will need to act decisively as events are set in motion.
We must establish a true meritocracy for the Immortality Revolution ushered in by advances in Medicinal Human Cloning. Like the Slashdot Moderation system, we could create a system of random "Moderators", if you will, who are picked secretly and randomly and given the ability to tag their fellow citizens as deserving or undeserving of the scarce asset of Organ Regeneration, financed by the state. You could rate your neighbor (-1 Stupid) for abusing his spouse, or your coworker (+1 Insightful) for fixing your printer connection. Those with the highest scores would receive the greatest medical benefit: Immortality.
Imagine a world where we never lost an Einstein, never killed a Bohr. Where great leaders like George Bush could advise us forever; where people like Noam Chomsky were but a temporary nuisance. This is the promise of cloning: not reproducing the husks of people but giving the gift of life to the greatest among us.
We must act swiftly when the time comes.
If guns kill people, then CmdrTaco's keyboard misspells words.
I don't know. This idea that men are the wimps of the animal world is a bit overdone, I think. Pre-human North America was chock full of huge critters that would make the Serengeti look like a suburban park. Then people got here and wiped 'em all out in a geologic wink of an eye. Let's face it -- even armed with weapons made from sticks and flint chips man is the most dangerous animal on Earth.
Of course it's the giant brain, opposble thumb and social cooperation that makes man really formidable, but it's hard to imagine a chimera that takes full advantage of human and, say lion capabilities. Can you have the lion's formidable claws and still keep dexterity? Or its powerful killing jaws and a mouth capable of articulating language?
Even some characteristics that at first seem like liabilities aren't. Our lack fur, scales, and general light build for example. On one hand, it leaves us relatively defenseless. On the other hand, it makes us offensively more formidable. A well trained runner can chase most game animals until they collapse of heat prostration.
Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
Genetically Engineered...
Bansai Anime Pleasure Drones.
I bet there's some species of animal where the female copulates and then leaves immediately. (without killing the mate, if you please)
Once again, I'm looking to the porn industry to lead the way into this new technological realm.
My opinions are my own, and do not necessarily represent those of my employer.