Slashdot Mirror
Japan to Allow Human-Nonhuman Mixed Cloning
Sara Chan writes: "Japan has decided to allow combined human-animal embryos to be produced through cloning, which could result in mixed-species creatures. The intended purpose is to permit transplant organs to be produced in specially-bred animals. The original story is in a Japanese newspaper, but you can get an English summary here."
We got too many trolls already.
That soon we'll be seeing Spiderman, Wolverine and The Thing roaming the streets?
This just smells bad.
Bart: "How would I go about creating a half-man, half-monkey-type creature?" Ms. Krabapple: "I'm sorry, that would be playing God..." Bart: "God schmod. I want my monkey man!"
I'm a signature virus. Please copy me to your signature so I can replicate.
How else are they gunna make all that anime into live cinema. You need animal-human hybrids.
A rabbit in the hand is worth 4 in the cage
I was wondering when the Japanese would take the logical next step and transform cat girls from an anime fantasy to creepy reality.
-- This and all my posts are in the public domain. I am a lawyer. I am not your lawyer, and this is not legal advice.
On a more serious note, I think this could be really usefull; like they mention, the prospect of growing pigs with fully compatible organs for humans could be VERY usefull indeed.
We do not live in the 21st century. We live in the 20 second century.
Mix a human with an octopus.
Perverted tenticle fetish!
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
Is this a step forward for mankind, or a step backward?
Sig (appended to the end of comments you post, 120 chars)
I find it fascinating that in America, people freak out when they hear about human cells being cloned. But in Japan, they're discussing mixing animal cells with human cells. I wonder how Americans would react to such a combination? I don't think the Religious Right would handle this issue very well.
I find this disturbing. And I'm one of the people who can't understand at all why people are bothered by the idea of 'regular' cloning; I mean it really makes no sense to me. But allowing chimeras to be created? That's just something I never thought anyone would do.
Or am I misunderstanding what's actually going on. Are they simply doing things like creating human hearts in monkeys and the like? As with the tobacco plants we rigged up to create hemoglobin or insulin or whatever? I don't really see a problem with that, I guess.
I do see that they plan to ban 'regular' cloning, so I guess they don't want the whole 'mad scientist' thing going on. If it could really be used to ultimately cure sick people and make people more healthy then really (imo) it would be unethical to disallow it.
autopr0n is like, down and stuff.
This puts a new twist on the phrase, "You are what you eat."
-
ping -f 255.255.255.255 # if only
My roomate has a thing for cat-girls and he's pretty excited right now. I however don't like this idea one bit. I mean most wild animals can kick a human's ass. Imagine a lion/man or and elephant/man. Smart and powerful. They'll take over. Just like exo squad, if you've ever seen it.
The GeekNights podcast is going strong. Listen!
If I had sex with a human-animal hybrid would it beastality? What If I hunted and killed one of them would it be murder? If I ate one would it be cannibalism? Think about it.
We can argue indefinately whether genetic manipulation like this is moral or is not. But either way, it is going to happen. I think we have to acknowledge that.
Got friends?
IANAgeneticist, but what if these animal-halves that you start creating are sentient?
Join the Slashcott! Stay away entirely Feb 10 thru Feb 17! Close all tabs to prevent autorefresh!
Yomiuri Shimbun has an excellent English edition, which has an English version of the article in the Science section.
IANAGeneticist, but my understanding is that insulin for diabetics is produced by injecting human genes into e. coli bacteria. So, aren't we already making human-nonhuman (in this case, bacteria) hybrids?
I think this is the scariest frontline documentary I've ever seen:
Organ Farm
Should not be allowed to? Don't you think it is remotely possible that opposition to a given technology may be based on ignorance and superstition? A great example of this might be your mentioning Three Mile Island. You may not be aware of this, but Three Mile Island was not a disaster. The safety systems worked as designed, and very little radiation was leaked. The Chernobyl accident has been shown to have been caused by incompetency on the parts of the plant operators. This is far from any "intrinsic" danger in nuclear power. In fact, nuclear power is economical. It is also the most environmentally clean power source in places where space limitations prevent things like hydroelectric and wind power. Further, the irrational fear of nuclear-anything means that most Americans miss out on some important technologies: for example, all of the E coli outbreaks of the last decade could have been prevented through irradiation. Restaurants could serve medium rare burgers again.
Karma: Good (despite my invention of the Karma: sig)
If a being "receives" its soul independent of sexual conception (clearly this would have to be true, since sex is proven to not be required in the making of a child), then it is possible that these home-made creatures would receive their sould by the same process.
And the inability to create sentient creatures could be due to errors in the science, not due to a "soul" -- You couldn't take a failure here and say, "Well, it must be because of God." It proves nothing at all.
Japan's first transplant procedure in 1968 resulted with the doctor being charged with murder because it wasn't clear if the donor was brain dead.
Aparently the taboo has something to do with Japan's Shinto and Buddhist beliefs. Here's a link: Japan Legalized Organ Transplants from Brain-dead.
Is this a step forward for mankind, or a step backward?
That is a good question. I guess the only way to figure it out is if we try it and see what happens. The scientific method demands experiments! There is no other way to know.
It does sound scary and rather gross, but it will definitely answer a lot of questions we have about nature and human life. Plus if it turns out that intelligence is inherited then we will have quite the future ahead of us. Can anybody say Uplift?
Humand have been eating monkeys in that part of the world for millenia. What changed to cause HIV to hop from one species to another?
Maybe it has before and the conditions were not right for it to spread. You jump to conclusions without considering a simple possibility.
These issues are vastly more complex than the glib statements made by the genetics industry would have people believe.
They're also far more complex than your child like treatment of them.
Superficial reading of the Ananova article would give one the impression that they are talking about a partly human chimera (it is hard to read "combined human-animal embryos" any other way); which would be a horribly unethical monstrosity.
What they're undoubtedly talking about (though I can't verify it since I can't read Japanese) are transgenic animals which express human proteins which is nothing new and posses no real ethical challenges (other than those involving the safety issues of xenotransplantation such as the real posibility for introducing various pathogens into the human population).
Apocryphal.
HIV is a chimpanzee virus, well established in wild populations, and one which apparently causes them little trouble, Well adaped to its wild hosts, it spreads among them easily while maintaining a balance between surviving in their bodies and not damaging the host which are its natural home; this is why chimpanzees experimentally infected with HIV do not develop AIDS.
The most credible theory for transfer of the virus to humans involves a person hunting chimpanzees for food who had a cut or sore which came in contact with the blood of an infected chimp they killed.
Of course, this does nevertheless support your conclusion.
Here is the English version of the same newspaper article.
From the article:
The hope is that human organs could be grown in other species and later transplanted into humans.
However, some said the decision opens the door to the risk of creating mixed-species organs, or possibly even creatures.
The article is about the publication of guidelines on research into human cloning. While allowing the cloning of aggregate embryos, the Wednesday announcement bars all other embryo cloning, citing insufficient debate about the ramifications of such cloning.
The research hasn't even begun yet. Maybe its possible to grow aggregate embryos, maybe its not. Maybe it will result in mixed-species, maybe not.
If your statements were at all logical, in vitro fertilization would have settled the issue years ago. However, most people who believe in "souls" don't think that sex is a prerequisite for creating one.
What the hell are you talking about? Oh wait, you don't know either.
Developing and testing vaccinations in animals is and has been a very common practice in medical research. It also has absolutely nothing to do with cloning.
All nuclear reactors in the US were built with negative temperature coefficients. They are the safest reactor designs in the world. Chernobyl had a positive temperature coeffecient, this is true, but the meltdown was due to operator error, not poor reactor design. And the US reactors, even with their failsafe designs are not completely immune to accidents.
It is also important to note that it is cheaper to build reactors with positive temperature coefficients. Reactors are built this way because of politics, not because scientists don't know what they are doing. BTW, there was plenty of anti-nuke propaganda in the 50's and 60's.
As for the bit about geneticists not knowing what they are doing... how do you think science works? Pop culture tends to lead people to believe that scientists sit around blackboards with nonsense mathematical equations surrounding them until they come to some epiphany and boom, we have a warp drive. That is not how science works people! Science is a lot of experimentation, trial-and-error, and guesswork. A lot of things are discovered by accident. Mapping of the human genome doesn't suddenly mean that we know everything about human genetics. There is a lot of stuff we don't know, and we are only going to be able to further our knowledge if we experiment and try new things.
You say that opposition should not be allowed to be disregarded as ignorance and superstition. Well, all I have to say is that maybe the opposition should come up with some intelligent and coherent arguments. It is easy to be disregarded as reactionary if you don't sound like you know what you are talking about.
You see, Whatever created us gave us the ability to create life, and gave us the abilities we have by evolving us.
So anyone here who believes in god but isnt blinded by the bibles description of god, can understand that.
If we program a computer to do something the computer does what its created to do, whatever created us obviously created us to create and to destroy.
Thats basically our job.I belive theres supposed to be a balance in creation and destruction but right now we destroy more than we create due to greed.
If you use Linux, please help development of Autopac
Like the mosquitoes they're trying to develop that have a malarial protein in their saliva, naturally immunizing those they bite instead of spreading the disease?
Oh hell... now this is going to give all those greasy Otaku one more thing to fantacize about: real-life catgirls.
(Catgirls, a.k.a. "Nekomimi", are a popular fetish amongst Otaku. If you hadn't noticed, of course.)
Does it make you happy you're so strange?
"I tell you the truth, this generation will certainly not pass away until all these things [end of the world, etc.] have happened." - Jesus, Luke 21:32, c. 2000 YEARS AGO
This is one of the hardest verses in the gospels to interpret. Various views exist for what generation means.
Some take it as meaning "race" and thus as an assurance that the Jewish race (nation) will not pass away. But it is very questionable that the Greek term geneav (genea) can have this meaning.
Two other options are possible:
Generation might mean "this type of generation" and refer to the generation of wicked humanity. Then the point is that humanity will not perish, because God will redeem it.
Or generation may refer to "the generation that sees the signs of the end" (vv. 25-26), who will also see the end itself. In other words, once the movement to the return of Christ starts, all the events connected with it happen very quickly, in rapid succession.
All of the above commentary was taken from Bible.org.
The theory that AIDSs was created via a polio vaccine which used Monkey tissue and from which AIDS developed is highly likely to be false.
Here is one link that discusses it. At the end of this article there is reference to work being done on earlier AIDS cases. I even recall reading something that said this had been done, but I could be wrong.
The point about Nuclear Energy is interesting, however presumably there has also been concern about the creation of huge electronic brains that would rule the earth. What if people had banned research on computers because of these fears ?
I have a PhD in Nuclear physics and I am a chartered engineer.
Three mile island came within seconds of a melt down. It demonstrates conclusively that the nuclear industry was nowhere near as safe as it had claimed. I don't accept the spin from the PR flaks of the nuclear industry that we have to trust them until they kill 5,000 people for real.
If the dice had rolled only slightly differently, the operators at Cherobyl might have succeeded in shutting down the reactor, had the three mile island operators not been lucky the reactor might have gone. The design flaw at Chernobyl was one that could not have been predicted with the design tools available in the USSR or the US when the plants were built. It was an area of positive feedback in the control regime that could only be detected using 3d modelling. That did not become possible until the introduction of the first CRAY series - and even then it took quite a long time for the simulation software to appear.
Moreover, the placement of any potentially hazardous industrial complex on three mile island should never have been allowed, let alone a nuclear plant. The bridges to the island simply cannot support an evacuation in an acceptable time. Building a nuclear plant that close to manhattan was gross negligence.
I used the term 'intrinsicaly safe' in a technical sense, no light water design is intrinsically safe, there is a critical mass that is damped down to prevent runnaway. If the safety systems fail and do not fail safe as planned you get a heck of a bang.
The Canadian CANDU heavy water system is intrinsically safe. It employs heavy water as the moderator, if there is a failure of the pressure vessel etc, etc the glass containers shatter and the moderator drains away shutting down the reaction. In pebble bed each fuel element is encapsulated in a moderator shell, again no critical mass, no chance of a big bang.
Do not assume that because there are some ignorant critics of nuclear power that all critics are ignorant. If the nuclear industry had not told so many blatant and deliberate lies in the 60s and 70s there might have been fewer ignorant critics today.
Jim Cramer (The Street.com) has a rule - financial irregularities means sell. Basically when ypou have been lied to by the management of a company it is time to take the exit door (e.g. Enron). In the UK the Thatcher govt. discovered during their privatization of the electricity industry that far from being low cost, the nuclear stations were barely economic on an operating basis - there was no possibility of paying of the original capital costs or eventual decommissioning costs. As a result a government that started ideologically committed to nuclear power discovered that the books had been cooked and they could not sell the plants to anyone at any price.
Further, the irrational fear of nuclear-anything means that most Americans miss out on some important technologies: for example, all of the E coli outbreaks of the last decade could have been prevented through irradiation.
Irradiation is banned for good reason. If you irradiate food you kill off the bugs but not the toxins they create. If technology allows food that is unfit for human consumption to be passed of as fresh you can be 100% sure that it will happen in the US.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
You assume that we allow everything until it is proven to be dangerous.
US medical ethics assumes the opposite, it is the duty and responsibility of the researchers to prove that their plan is safe and that there is no possibility of unexpected side effects.
For your information, transgenic implantation is prohibited in the US for precisely the reasons I stated. The risk of viruses moving from one species to another is not considered to be acceptable.
My original point was that the people who shriek 'science' tend not to be scientists, equally those who invite people to talk to statistics teachers tend not to know what statistics can and cannot tell you.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
A country has the guts (and yes, I'm not surprised it's Japan), to go about ignoring the stupid religious morals set by the US in regard to cloning animals/humans with the specific end of using them for organ harvesting.
I'm one step closer to being able to have a genetically perfect pancreas transplant, which means I'm a step closer to being able cease these stupid insulin injections 4-8 times a day.
Looks can be deceiving. Or CAN they?
I find it fascinating that in America, people freak out when they hear about human cells being cloned. But in Japan...
Read the article, they are banning outright 'normal' human cloning. So obviously they share the same fears that people here do.
autopr0n is like, down and stuff.
... and got cheese and quackers.
Bantam Dominique roosters crow a four-note song. Once you've heard it as "Happy BIRTHday" you can't NOT hear it that way
If the experiments are able to produce human-like creatures without coitus and traditional conception, the only reasonable conclusion that can be drawn is that the "soul" does not exist, and that humans are no more sophisticated than the most advanced carbon-based machine we can invent.
I'm not aware of any major religious leaders who argue this point in the first place, so you're just knocking down a straw man. To argue this position would be to argue that babies conceived through in-vitro fertilization - already a common practice - do not have souls. I'm not aware of any major religious leaders having argued this.
In addition, producing "human-like creatures" is not akin to producing humans. If the hypothesis is that humans have souls and animals do not, the mere fact that you are able to produce a human-like creature does not refute this hypothesis - it is entirely possible that this human-like creature has no soul, while "real" humans do have souls (and thus the "human-like" - the similarity being only physical).
Mind you, I don't believe in the existence of souls, human or otherwise, but I don't see how this research could disprove their existence.
10 PRINT CHR$(205.5+RND(1)); : GOTO 10
With all these references to getting a tail, let me disspell the myth. No, you won't turn into a gigantic ape that's 10's more powerful JUST because you have a tail like Gokuu. Freaks. ;)
-
ping -f 255.255.255.255 # if only
Cross-clone humans with octopii, what do you get?
Hilary Rosen!
Napster-to-go says "Fill and refill your compatible MP3 player", which is a lie. It's not MP3. It's WMA with DRM.
Shrug.
You wouldn't have to genetically manipulate a pig, or for that matter most mammals, to create someting which to the naked eye, intelligence tests, et cetra could not be distinguished from a (genetic) human being. Merely subject the embryo involved to substances that would that would link up with the homeobox genes and cause them to be expressed in the same way as a human's are, and you'd have an ersatz human.
Of course, if two of them tried to have children they would need the same treatments, or would end up with an ordinary piglet or whatever as an offspring.
Heh. While I'm agnostic/atheist/apathist, that's stupid. That is, to say that a person wouldn't be aware/wondering about god(s) unless they were told about it? How was the concept invented, if it takes someone else to inform another about it for the idea to exist? ALIENS?
Working toward a usable PDA environment in the spirit of Newton OS: Dynapad
That made sense. You obviously wandered onto the wrong message board.
Napster-to-go says "Fill and refill your compatible MP3 player", which is a lie. It's not MP3. It's WMA with DRM.
...is that of thousands of rabid Furries creaming their shorts after reading this news story.
- A.P.
"Remember when the U.S. had a drug problem, and then we declared a War On Drugs, and now you can't buy drugs anymore?"
meltdown was due to operator error, not poor reactor design
Um, if a reactor can melt down to operator error, then it is a poor design. There are designs that cannot melt down without violating the laws of physics (IE excess heat causes the reaction to stop working).
Depending on an operator, fallible by the fact of being human, in a situation where many human lives may be at stake, is a horrendous design flaw.
autopr0n is like, down and stuff.
most people who believe in "souls" don't think that sex is a prerequisite for creating one
Sure is a perquisit, tho'.
Geez. I want to conceive my kids the old fasioned way.
Libertarianism is rich wolves and poor sheep playing gambler's ruin for dinner.
The most credible theory on the origin of HIV is that it jumped species after a bunch of vaccinations with a trial vaccine that had been incubated in monkeys
Umm, NO.
The most credible theory is that someone got infected with this simian virus by failing to properly cook a monkey befor eating it.
The "vaccinination gone awry" theory is no more credible than the "HIV escaped from the CIA" story that the Soviets used to toss around.
Now, don't you have some X-Files reruns to examine for messages from the Martians?
-jcr
The only title of honor that a tyrant can grant is "Enemy of the State."
here's a link saying why that's crap. Basically, the vaccine makers never used chimps in their research (there's no chimp DNA in the results). There is no SIV in the results.
The most telling line is this one though: Hooper argues that that theory lacks scientific proof and that no one has as yet produced scientific evidence to contradict his theory
In other words, "no one can disprove this, so it must be true!", or, in other words "It's total crap!". No legitimate scientist would ever say that, Its the same kind of crap spouted by people who don't believe in evolution or global warming.
autopr0n is like, down and stuff.
Japan today voted to change the official name of the island to "The Island of Dr. Moreau"
-
As I said in the original post, people have been hunting and eating chimps for millenia. If there was the potential for the virus jumping species why did it wait until the 1950s to do so?
Of course, this does nevertheless support your conclusion.
If we accept the cut hunter theory then the probability of diseases jumping speies is very high. But it does have the advantage of shifting blame from the intervention of western medicine to the ignorance of native hunters.
My biggest concern over the 'cut hunter' theory is that when the theory was the behavior of the field when the theory was challenged. There were calls to have the proponents dismissed from their posts, their research grants terminated, people tried to link them to the loony who is still trying to prove HIV does not cause AIDS. In short a witch hunt, not a discourse.
I am not a geneticist. However I have worked in enough academic disciplines to be able to use a certain degree of meta-logic. If you see a discipline that responds to criticism with certain tactics you can make a pretty good guess as to the quality of their work. Science is a process, Engineering is a profession. Problems tend to arise when scientists start trying to do engineering and end up following the principles of neither field.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
In genetics we use somatic cell hybridization for genetic analysis and chromosome mapping. It is the process of fusing human mouse cells and culturing them in a lab.
Transgenic animals have already been created in many countries. Pigs with human genes to prevent rejection of heart valves come to mind.
In my opinion, the article was poorly translated and the initial post was misleading. People are having images of werewolves and such. At this point in time it would be impossible to successfully create a hybrid of this type. In 10 or 20 years this might actually be a problem. Until then, it's science fiction.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
I gathered in brief synopsis on xenogenic (foreign species) transplants that the biggest risk is that of 'dormant' virus DNA, as all the species that were once ravaged by pandemics survived but retained considerable portions of the pandemic virus DNA in their own, and as such it remains dormant. Xenogenic (do not believe that's quite the same as transgenic) transplants would therein be a source of pandemic virus DNA, which could be potentially reanimated. That and Murphy's Law seem should stimulate us to believe that that this is a risky proposition.
Being paralysed in fear, unable to progress because of some fucking superstition is stupid. I'm not calling for the wholesale abandonment of ethics but we should never take the next step because it might offend some creature that may or may not even exist.
Besides which, humanity is just an evolutionary step to a silicon based interstellar intelligence. Anything us meat monkeys do up until that point doesn't really matter.
I'm trying to teach myself to set people on fire with my mind... Is it hot in here?
Well nobody would build a nuclear reactor if they thought it had a positive temperature coefficients. The Russians discovered that they had not the hard way.
I wrote some of the basic simulation packages that are used to model chemical and nuclear processes. Until the 1980s the computing power did not exist to model any of the reactor designs in sufficient detail to discover the particular bug in the Chernobyl design.
The Russian designers performed a 2d model and used standard techniques to extrapolate to 3d using experimental results on test reactors. They simply did not have the option of doing 3d modelling because the none of the computer systems in existence at the time were capable of that.
Science is a lot of experimentation, trial-and-error, and guesswork. A lot of things are discovered by accident
Oh dear we have just accidentally created a black hole, awfully bad luck, see you in future lives.
Accidental discoveries are one thing, unintended consequences of an intentional act are another. There are plenty of medical experiments that are rejected as being too dangerous to risk trying.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
Well the pebble bed reactor starts off with the fuel already encased in an inert moderator so you can simply mix the balls up in cement and drop them down a mine shaft.
However the chances of getting pebble bed off the ground are small to none, this is largely because of the lies told by the established nuclear industry, both then and now. Few politicians are going to risk their careers for the sake of an industry that lied to them and to the people.
The biggest risk of premature Xenotransplants is that any failure will give the religious reich an excuse to close down theraputic cloning to allow organs to be grown for transplantation.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
So are they "cold hearted" because they're not religious or because they're coming up with new ways to save lives?
-Legion
HIV is a not-easily transmitted disease, but mutates quickly. You might as well ask, since the Chinese have been raising ducks and pigs in close proximity for centuries, why the bird/mammal flu combination that apparently took place in swine took place in swine "waited" until the time of the 1918 influenza pandemic. As it happened, it didn't.
I am not a geneticist. However I have worked in enough academic disciplines to be able to use a certain degree of meta-logic.[...]
Bing!
Self-styled expert on everything outside his field alarm just went off...
Sorry, I've seen that too many times when, to support their oddball theories, someone combines their lack of technical knowledge, use of speculative and proven-false statistics (like your "vaccines correspond to the spread of HIV" - if you continue to believe early 1990's claims of African governments that it doesn't exist in their countries...), disbelief in the Law of large numbers and other simple concepts of probability, etc, etc...
Sorry, I'm tired of reading anti-atomic energy diatribes packed with technical nonsense written by PhD's in "Education", and of petitions to ignore global warming where most of the scientific "Dr."s who signed turn out to be medical doctors, with a few veternarians thrown in, et cetra. Yeah, a little learning can be a dangerous thing.
Whats even more interesting is that your posts are modded up and left there for an extended period, just to draw them in. Very much like nighttime catfishing with floodlights that I've done in East Texas.
I stand in admiration of your ability to say exactly what a worried and angry population wants to hear, and reply to in frustration, or sometimes even anger. You demonstrate excellent rhetorical prowess.
Now, with all that said, will you please stop? Your intellect is clearly beyond this type of crap. You should be over in Science right now with the rest of your NASA buddies, not here making NASA look like, well, trolls.
Human cloning? Far from being the "Attack of the Clones", nothing is more misunderstood than medicinal human cloning. Please, don't confuse the goals of The Human Cloning Foundation, the federation of misanthropes bent on finding a country willing to host their young Frankenstein adventures, with Medicinal Human Cloning.
The idea behind Medicinal Human Cloning (MHC) is to clone human cells at the cellular level, before cell differentiation. Cell differentiation occurs 2 weeks into the life of an embryo, when all the cells in the embryo stop being homogenous and, all at once, establish their own identities. Some become hand cells, some feet cells, some brain cells, some blood cells. This "magic" event is the point at which human life begins. MHC is the process of cloning human cells before this event.
The point of being able to harvest unlimited quantities of undifferentiated human cells is that these cells can become any cell in the body; they are "undecided", yet genetically matched to the recipient. The applications here are as numerous as you can imagine: tissue replacement, skin replacement for burn victims, manufactured organs custom-matched to the recipient. This is the promise we are debating; the lives of millions who could be saved by this procedure, from burn victims to heart attack victims.
This advance promises to revolutionize medicine. Not just technically, but from a societal perspective as well. If we understand anything about MHC, it is that it will be prohibitively expensive to apply to an entire population. An order of magnitude costlier than even heart transplantation, we are dealing with sums of millions of dollars per regenerated organ. And unlike transplantation, this technique will be able to prolong the life of anyone, indefinitely. As a society, we will soon be in the position of deciding the lifespan(s) of each of our citizens. Not because we control death; not euthenasia, but because we control life.
We've already seen this paradigm emerge with the "list" for heart transplants. The pathetic attempt at a "meritocracy" for deciding who receives a new heart has been a total failure, as evidenced by the case of David Crosby. The system is weighted in favor of the rich, against the poor. Will this paradigm dominate the field of Medicinal Human Cloning? Will only the rich live forever? Will money become the force of life? Not if we can help it. We will need to act decisively as events are set in motion.
We must establish a true meritocracy for the Immortality Revolution ushered in by advances in Medicinal Human Cloning. Like the Slashdot Moderation system, we could create a system of random "Moderators", if you will, who are picked secretly and randomly and given the ability to tag their fellow citizens as deserving or undeserving of the scarce asset of Organ Regeneration, financed by the state. You could rate your neighbor (-1 Stupid) for abusing his spouse, or your coworker (+1 Insightful) for fixing your printer connection. Those with the highest scores would receive the greatest medical benefit: Immortality.
Imagine a world where we never lost an Einstein, never killed a Bohr. Where great leaders like George Bush could advise us forever; where people like Noam Chomsky were but a temporary nuisance. This is the promise of cloning: not reproducing the husks of people but giving the gift of life to the greatest among us.
We must act swiftly when the time comes.
If guns kill people, then CmdrTaco's keyboard misspells words.
DMT1 is thought to be an autoimmunedisease in which case you'd have to recieve a pancreas with non-immunogenic beta-islet cells, considering they don't even know why they're immunogenic (ie which protien, but their best guess is it's a pre-insulin product in the pathway to insulin production, which of course is bad) i, unfortunately, wouldn't expect a foolproof pancreas in your lifetime... but if we could "cure" DMT1 in our grand-children's generation then i would consider it a battle won.
it's unfortunate that religion must so often stand in the way of actually helping people in the name of ethics, seems a bit of an oxymoron to me...
With a few exceptions, secrecy is deeply incompatible with democracy and with science. --Carl Sagan
If the experiments are able to produce human-like creatures without coitus and traditional conception, the only reasonable conclusion that can be drawn is that the "soul" does not exist, and that humans are no more sophisticated than the most advanced carbon-based machine we can invent.
If the experiments are not able to produce creatures that demonstrate free will, emotions and feelings, and other characteristically human qualities, the inevitable conclusion will be that a soul does exist in each of us, and the religious will most likely be able to use this as a rationale for banning abortion, stem cell research, and other procedures that involve the sacrifice of young human life.
I have some problems with what you just said. Things like free will, emotions, and feelings are not sufficient proof of a soul. My dog has all of these, but I can't prove or disprove the existence of his (let alone my) soul. IMO, there's really no way to prove or disprove a soul exists. It's really an issue of faith, which is why so many people have a problem with it.
If all you have are silver bullets, everything looks like a werewolf.
Geez. It's been bilingual as long as I can remember. Here's the link to the english artcle: Here
-- your Web browser is Ronald Reagan
but here it is
http://www.yomiuri.co.jp/newse/20011130wo72.htm
-- your Web browser is Ronald Reagan
Where does this unnatural -> degraded implication come from? It's certainly not the case in my experience--if anything, the lesbian couples I know are much more loving and thoughtful in the upbringing of their children than many of the heterosexual couples I know. (I suspect this is due to several things: First, it's currently much harder to legally become a parent if you are in a gay couple, so only the truly dedicated gay couples become parents... contrast that to the situation amongst heterosexual couples, where being thoughtless and unmotivated makes it more likely you will become a parent. Also, gay couples tend to be more open-minded about allowing their child to be him/herself and not forcing any predetermined societal roles on him/her... for obvious reasons)
In any case, as far as I can tell a lot of people arguing this fact have never taken an honest look at gay families compared to traditional ones. Gay couples certainly aren't perfect, but life in the traditional family can be pretty damn disfunctional as well, even if it is more "natural".
BTW, pain is how you grow stronger, ask any athlete, ask any mature person.
I did, and they all agreed that exercise and hard work is the way to grow stronger. Pain (chronic or above moderate levels) is an indicator that something is wrong, not that you are growing stronger.
When asked in an interview why most of the evidence for creationism
Why did God hide all those fake dinosaur bones anyway? What a joker, that guy... ;^)
I don't care if it's 90,000 hectares. That lake was not my doing.
...to create my four-assed baboon.
grumble.
I don't know. This idea that men are the wimps of the animal world is a bit overdone, I think. Pre-human North America was chock full of huge critters that would make the Serengeti look like a suburban park. Then people got here and wiped 'em all out in a geologic wink of an eye. Let's face it -- even armed with weapons made from sticks and flint chips man is the most dangerous animal on Earth.
Of course it's the giant brain, opposble thumb and social cooperation that makes man really formidable, but it's hard to imagine a chimera that takes full advantage of human and, say lion capabilities. Can you have the lion's formidable claws and still keep dexterity? Or its powerful killing jaws and a mouth capable of articulating language?
Even some characteristics that at first seem like liabilities aren't. Our lack fur, scales, and general light build for example. On one hand, it leaves us relatively defenseless. On the other hand, it makes us offensively more formidable. A well trained runner can chase most game animals until they collapse of heat prostration.
Post may contain irony: discontinue use if experiencing mood swings, nausea or elevated blood pressure.
My ex girlfriend is a cross beteen a human and a total cow... and she didn't have a heart,
:)
now not only will she get one, but she'll get shipped to japan since it's the only place it'll be legal. Everybody wins
--- Metamoderating abusive downgraders since my 300th post.
Something I've always wondered is if humans and some other primate species - chimps, gorillas, orangs - could cross breed with each other. (Go ahead, insert crude joke here - I'm serious). Horses and donkeys can mate to produce mules and there are other examples. How do we know unless we try? Who knows if somebody already hasn't tried this? And if it/he is a cross breed with a gorilla, would it be eligible for the NFL draft?
I will never look at the words "CowboyNeal" quite the same way again....
It was not to be taken literally, but more of a question. What defines "human" under law? Lets assume they succeed and these "life forms" become introduced into society. Will human-animal hybrids have the same rights of a full-bred human/animal? Currently both species are governed in one form or another.
Unfortunately you'd only get excited over 'ponygirls' ;)
Japan has just taken one great leap forward ethically and morally. Plus, Japan stands to reap huge profits as the boby boomers need some meds which will be comming only from Japan. I tend to invest heavily in biotech and I will be seriously looking at Japan's biotech industry.
The Christian religion has been and still is the principal enemy of moral progress in the world. -- Bertrand Russell
The problem with this sort of rationalization of the bible is that there's no support in the text for any of these odd interpretations of "this generation". If I were to go willy-nilly through your Sacred Text, and add qualifiers like "this kind of thing", who knows what weird religion you'd soon be following!
On the other hand, it's quite common for religious leaders to predict the End of the World within their lifetime---and they're invariably wrong! Some of them just slink off into a hole somewhere, others convince their followers that they were actually predicting a different End of the World all along.
I think the person we're talking about here is one of the more slick-tongued variety.
Hate stupid software on freshmeat? Laugh at
Maybe this will allow "directed evolution" of humans, just like Linux evolves (microcreation, but macroevolution). As long as the mods are Open Source, so that the species doesn't fork, that is. Unfortunately, the laws in most countries will push the research into the proverbial "back alley"....
[100% ISO 646 Compliant]
SVM, ERGO MONSTRO.
Very similarly, the flaw in the argument is that it is not possible to have a new thought or to invent anything. which is of course silly.
unless you subscribed to the idea that all thoughts come from some god, in which case everyone was a robot. This is the same flaw as in the argument that everything has been thought of before. pure bunk.
Now some people Steal their Ideas, but that is something else indeed.
What I am concerned about is the quality of life for human animals hybrids.
I am not enamored with the idea of a race of morons created for our pleasure and to do our bidding, despite what certain very big companies and politicians might aspire to. How would you like to live that life? Would you wish it on anyone, well, besides Bill Gates?
"It is a greater offense to steal men's labor, than their clothes"
Fascinating redux on nuclear power; its nice to hear from non-ignorant people.
.50 cents, including refining the uranium, using it, and disposing of it. The majority of the total (a few cents) was amortized cost of the construction of the plant.
I have one question though; I've heard that much of the operating costs and construction costs of a plant are unrelated to actual expenses, but rather related to regulation and innumerable scientific studies, Not related to the safety systems, but paperwork defending the safety systems.
I'd read an article that clocked up the cost per kilowatt hour as being about
True, false, or you don't know?
Eh well, Nuclear sucks. The question is, does it suck more or less than the alternatives? (really, coal)
I'll agree that evolution seems about as safe a bet as newtonian mechanics.
I'll even consent that there *may* be a small trend of the planet getting warmer since the 'little ice age' 300 years ago.
But, I won't agree that that trend is long term (See the 'medieval warming' period just before the little ice age; apparently it was somewhat warmer then than it is now.)
But, I won't agree that humanity has affected any such warming trend, if it exists, more than an unmeasurable epsilon.
At least without proof from non-cranks. (I note that most climate models have huge fudge factors, and don't take into account such things as clouds. I do not consider them anything more than mental masturbation.) Note, I am asking proof for anthropogenic caused global warming of more than a trivial amount.
I think I remember of once hearing about a study that found HIV antibodies in samples taken from people who died in the very early part of this century.
Furthermore, there is such a thing as chance and coincidence and unexpected correlations. For example, the influenza epidemic of 1918 might have been very little, had there not been the transport architecture we have now in place. It also was probably a chance mutation that just happened to get a whole lot nastier all of the sudden.
Similarily, smallpox presumabely started off as a case of the more mild cow-pox that mutated into the scourge that killed tens (hundreds?) of millions (billions?) of people. This also happens to predate modern medicine by a long shot.
Genetically Engineered...
Bansai Anime Pleasure Drones.
I bet there's some species of animal where the female copulates and then leaves immediately. (without killing the mate, if you please)
Once again, I'm looking to the porn industry to lead the way into this new technological realm.
My opinions are my own, and do not necessarily represent those of my employer.
One day, a new disease will crop up and wipe us all out because there's no variation in our species
Aside from the fact that nobody is suggesting we all give our children the exact same DNA, don't you think one of the nice little bonuses we could conceivably give our genomes would be a vastly improved immune system? There's animals that rarely ever get sick (Sharks come to mind); why spent billions on treatment and lost worktime if we can preempt nearly every kind of illness? I have no problems giving such a gift to my descendants.
anyone out there know why farmers plant different strains of corn in different fields
Very good. So this little aspect which every Farmer John out there is keenly aware of is somehow going to be ignored by every geneticist, biologist, proteologist, etc in the future? 100% is an awfully high rate of incompetence among any profession; even lawyers and politicians can't make that claim.
Dyolf Knip
You Write: My ethics ascribe nothing special to the state of being human
Some people eat cows, pigs, chickens, and other animals. I'm one of those people. How many human genes in a pig before it becomes cannibalism?
Is this a question of taste?
--- -- - -
Give me LIBERTY, or give me a check.
The list of faults that occurred at three mile island is very long. One of the worst of these is the fact that the plant management denied to reporters that there was any problem several hours after they had reported that there was a serious problem to the govenor.
Having begun by lying to the press, the plant management contined to try to lie their way out of it until the NRC took over the media relations and told metropolitan edison to shut up.
The actions of the plant management were not compatible with a concern for public safety, they were however compatible with a desire to protect the reputation of nuclear power by covering up incidents.
TMI is an example of what happens when a company puts its bottom line before safety. Metropolitan Edison had massive tax and rate hike incentives for getting TMI commissioned before the end of 1978. The Washington Post has a retrospective that gives the side of the story the nuclear industry PR flaks try to play down.
The response to TMI was not irrational or unfair. It is not superstition that made it impossible to deploy new reactors after TMI. The regulatory regime had failled.
We understand nuclear physics a lot better than we do genetics. Nobody has any means of predicting the outcome of DNA modifications. This is science, but the experimenters want to do engineering.
Every time a new scientific field gets to the point genetics has there are people who stampede towards production use. They did it in the victorian era building long bridges before they understood resonance, they did it in the aviation industry, building jet planes before they understood the consequences of metal fatigue. But resonance and metal fatigue were both known about long before bridges collapsed and planes started to fall out of the sky.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
It is never justified on economic grounds, it is for the French an issue of national pride. France has little coal and no oil so energy policy there is a little out of whack.
The French power system is 100% state owned and the finances are secret. This is a country where until it was discovered a few months ago, the President used to receive several million dollars a week in cash, delivered by armored lorry that was used to fund the secret service, tax free bonuses for everyone in the office, mistresses, holidays, etc.
The French power system is notoriously inefficient economically. 70% is simply too high a percentage for any country to generate from a capital intensive source. As a result the French sell their surplus off-peak power at very heavy discount rates while having the highest domestic tarrifs in Europe.
As for the British nuclear industry being corrupt, of course it was. But the UK is like Germany, corruption of that kind is pretty rare. The corruption was the result of self-deception, cowardice and the result of trying to live up to the promise of 'power too cheap to meter'.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
Mine is in Nuclear physics, what is yours in?
and of petitions to ignore global warming where most of the scientific "Dr."s who signed turn out to be medical doctors
I missed that particular one, but the Bush rationale for ignoring global warning appears to be based on an economist, not a medical doctor who told him that the Internet takes 26% of the energy of the US. A somewhat surprising figure given that energy usage per capita has been declining even in California since the 1990s.
That is missing the point however, the anti-global warning 'research' is funded by the oil companies, as are their 'astro-turf' anti-Kyoto campaigns. I don't think anyone disputes the sincerity of the anti-nuclear lobby which in any case has plenty of people with bona-fide qualifications to support their case.
The point is that no sicentific discipline has the right to conduct experiments that may be dangerous to the public at large. When it comes to assesing those risks the onus is on the researchers to prove that their experiment is safe. It is like building a bridge, you have to prove it will stay up, the planning authorities do not have to demonstrate it will fall down to reject you an safety grounds.
While it is no longer possible to be a polymath on the scale of Sir Thomas More, there is no scientific discipline that can claim to be so specialised that only they can understand it.
Certainly we are all well qualified to judge when a field does not poses an understanding of the fundamental principles that are acting. If I believed that such a model existed in genetics I would probably be working in the field.
Getting back to the original topic. There are two approaches that are possible. One is to do the job properly and to grow organs from human stem cells. The other is to take a possible short cut and to develop xenotransplants.
Off the two paths the first does not appear to carry significant risks and has the beneficial side effect of pissing off the religious reich. The other has intrinsic risks that the researchers cannot hope to prove have been controlled.
Thus far the US and UK research bodies have prohibited xeno-transplants for precisely the reasons that I gave. Moreover it appears that the Japanese group has only got permission to grow the organs, not to actually implant them. The only group that appears to be going ahead with human xenot-transplants at present is a latin-american outfit that is looking to cure diabetes. Even then it may prove to be the case that their ability to conduct research has more to do with the lax regulatory regime in which they are operating.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
Among all species
My God, it's Full of Source!
OUTSIDE_IP=$(dig +short my.ip @outsideip.net)
So is the evidence that smoking causes cancer. All evidence in the public health field is circumstantial.
My field is security. You do not refuse to act until a hypothesis is proven beyond doubt. The issues are 'what is the most likely hypothesis' and 'is it a credible hypothesis'. If there is a credible hypothesis that suggests there might be a major threat to public health you don't allow the research to proceed.
The fact that scientists don't wish to investigate the hypothesis may be troubling, but it says nothing about the truth value of the hypothesis
'Don't wish to investigate' is not exactly the reaction the hypothesis received. It was a couple of degrees worse than the initial reaction to Folkman's theory of angiogenesis. The field made it clear early on that it did not wish to hear the theory and would not tolerate any discussion in the forums they controlled.
I came across the polio virus theory as the attacks on the proponents grew nastier, including libel actions to force reporters to withdraw their stories on the theory.
The point being that when a field begins to behave like that it is time for the rest of the sicentific community to step in and tell them that they have to earn the trust of the community generally before they do anything that might be dangerous to public health.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
You might not be aware of the fact but MIT also happens to have a large faculty and many non-faculty research staff. As is pretty well known on Slashdot I was a researcher there about ten years after I got my doctorate.
Your digression on statistics would have more weight if you were familliar with the material. The probability that one HIV strain would wait until 1952 to jump from monkey to human is not high, the probability that the first known case would be discovered in Kinshasa a year after one of the first polio trials occured there is also not high.
But HIV is not one virus, it is two, HIV-1 and HIV-2 are completely different strains. What is the probability of two money viruses changing species within the same narrow geographical area in the same time?
Yes, I have taken a statistics class, and am aware of what statistics can do. You insult my intelligence when you assume that I don't know what I'm talking about.
Pot, kettle, black. You attempt to dismiss statements on grounds of authority you do not posses.
As for the reasons we still operate Nuclear power plants, without them the lights would go out which would be very unsafe indeed. However the plants that are operating are being operated in a very different manner to before TMI. The high cost of maintaining that level of vigilance is the main factor that has changed the economics of nuclear power from cheap to expensive.
Looking for an Information Security student project suggestion?
Try http://dotcrimeManifesto.com/
How far are we allowed to manipulate genetics before we no longer allow a being human rights? For example, in the United States, how different does a being have to be from "human" before we don't allow them the opportunity to to become a citizen or to vote, before we stop allowing them in our public schools, before we don't allow them the opportunity to pursue life, liberty, and happiness?
Keep in mind that our laws today protect low-functioning humans (people with medical and mental problems that prohibit them from leading a "normal" life - some in near vegetative states) - how far will we be willing to go to protect these new beings?
Personally, I think our first impulse will be to treat these beings as test creatures, with no rights of their own. Our tendency will be to use them as a slave race, denying them their humanity. Would we ever find a Stephen Hawking within one of these created species if he existed, or would we have already destroyed him because he seemed to be incapable of living?
There is a VERY important question here. While religious, it is not ONLY religious - what IS a human?
I don't know, but I'm feeling a wee tad hungry. Must be lunchtime... Which part do you want?
That is all.
Most brilliant people ARE fools...
Contrary to popular belief, coding is not all free blow-jobs and beer. Those things cost MONEY!
Soon Monster Island will be a reality!
**>>BELCH
it's OK to grow human bits in animals (or animal bits in humans) but cloning human cells are not OK?
what kind of reasoning could accept the former and not the latter? Surely cloning human cells would bring more immediate medical benefits than trying to get the same to grow in a different animal?
Read what i said about people blinded by mans description of the creator of all there is.
If something creates all this is, and didnt want us to do something, it simply wouldnt be possible.
Can you avoid death? no you cant. can you read the future? no you cant. Can you travel deep into space? no you can.
To think that the creator of all there is, doesnt know exactly every single possibility there is, and exactly what we will do, I mean come on,
if something is god, it KNOWS everything the human race will ever do PERIOD.
Whatever we do is part of a plan.
If you use Linux, please help development of Autopac
First, who says the creator has to "APPROVE" of anything
Anything thats POSSIBLE is approved of.
Free will? If you created the universe, if the entire universe is just a thought in your mind, then technically, theres no such thing as free will, does a robot have free will? hell no.
Proof that we dont have free will? Destroy the universe and then you can prove we have free will. Literally BREAK the universe!
Oh right, you cant break the universe! Hey neither can anything else in the universe because its all perfect!! Hey I wonder why that is? I wonder why some super intelligent aliens experimenting milliosn if not billions of years before us didnt completely break the entire universe?
Because its IMPOSSIBLE.
Thats an ability we do not have and will never have.
We can destroy, we can create, but we cannot stop the cycle, we cannot END all creation and destruction. It will go on forever, as will the universe, no matter how smart we get, we will NEVER be able to stop the universe and destroy it.
The day we have that ability is the day we have free will.
Having the ability to choose right from wrong, is not free will, a computer can choose left and right, 1 or 0, even 1 AND 0, but a computer can never truely change the rules, even if it learns to reprogram itself, it can never change the fact that theres 1 and 0, the day computers can all of the sudden have free will is the day computers somehow take over the world like in terminator 2.
Free will means the ability to choose, but something is giving us the choices we are choosing from and until we have the ability to choose something which isnt given to us, like to stop the universe itself, then, we are no diffrent than a computer program which chooses between 1 and 0.
How do you know our bodies arent just, machinery, how do you know that conciousness is not god? Conciousness is not proven to be part of the physical body, if its proven to be beyond, then COnciousness is not following the rules of the universe, meaning conciousness may have free will but this doesnt change the fact that your body doesnt.
Conciousness could be the force of god itself, thats right making us all part of god.
Open up your mind, and accept the fact that anything is possible. You do not KNOW what god wants and does not want, do not assume you do, You do not even know WHAT god is!!! I dont know but i'm at least admitting it. I have opinions on what i think god may be, But i'm not sure.
So dont be so sure yourself. I say if something is possible, then something else in the universe has already done it. If whatever created the universe didnt want it to be possible until we reach a certain state, then like gravity, forces would prevent us from doing it until we are enlightened enough to maturely handle it. Just a few hundred years ago people thought men werent allowed to fly. Now they are in space, the forces prevented you from flying, whatever created the universe obviously created these forces with a purpose. To prevent idiots from doing what they arent ready to handle.
Give a monkey a gun and he wont know how to properly handle it, let the monkey create the gun and things may be diffrent.
If you use Linux, please help development of Autopac