Slashdot Mirror
Burn your genes on CD -- for $500,000
An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs.
It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "
If you bring your own disc, that'll only come to $499,990.00
And it doesn't cost me a penny!
Government of the people, by corporate executives, for corporate profits.
From this first post: "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500."
than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!
Just more proof that, one day, the RIAA will indeed own all of us.
cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.
"gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"
This has been done before. Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major. Then they would just "play" a dna sequence and see what came out... Unfortunately, I have no links to post, I lost wherever I first heard mention of this (discover magazine, maybe?) and haven't found it since. Anyone?
I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.
1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?
2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)
3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.
Remember, this is the guy who swapped HIS OWN DNA with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?
Humpty Dumpty was pushed.
Chromosome 1:t tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc
atgcgcctagtttatagcgagcgtatgctgatcagtctggtatgg
Linux - Because Mommy taught me to Share.
Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
This website says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.
Could i get my genome sequenced onto vinyl?
"Sic Semper Tyrannosaurus Rex."
burning individual human's entire DNA sequences onto shiny compact discs
I can do that for less than $500k:
Ingredients:
One CD (make use of an AOL one for a change).
A skin or blood sample.
Preperation:
Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.
A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!
Are you local? There's nothing for you here!
Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.
Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
Cheers,
-----[0_o]-----
We are not amused.
This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.
I think one would need reference info to put the code to use. It is kind of like having the machine code of an app without knowing the machine language.
Table-ized A.I.
""Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome."
Even though it's you, you know they will copyright it.
And even though it's you, you know they will prevent you from copying and sharing it.
Bad what people do for money.
Why pay $500,000 for my genetic code on CD when I can just get it off of kazaa or gnutella for the cost of bandwidth? I mean really.
You see? You see? Your stupid minds! Stupid! Stupid!
I dunno. . . put a throbbing techno beat behind it, you might have something. Esepcially since so much of our genomes is actually repeated motifs like SINEs or Alu sequences. Music to clone by. Even better, take some real genes or even just the DNA encoding protein fragments, and see if you get anything interesting. (I think "Leucine Zipper" would be a badass song name.)
I'm a bioinformaticist- maybe I'll try this if I get bored some evening.
Yes and no. I just tried gzipping chromosome 22 (one of the smallest) - it goes from 35MB to 10MB. The entire genome is about 3.5GB. However, keep in mind that the repetition isn't perfect, because from what I understand repeat motifs are more like regex's than simply the same sequence over and over again. A custom compression scheme could probably do much better than gzip.
It's alway good to have a backup copy of your genes in case you have to reformat / reinstall yourself.
Ideology is for ideots.
Actually it's pretty unlikely, I would guess. It depends strongly upon how the brain has been preserved - if it's in a strong formalin solution then the DNA is largely unrecoverable. There are methods for getting some DNA out of formalin-fixed tissue, but it wouldn't be an easy job.
I don't think the information would be a lot of use anyway until a LOT more is understood about brain development, and that's still assuming that whatever made Einstein's brain so brilliant was completely genetic in anyway. In utero environmental factors and probably lots of other factors we don't even know about yet might play a role. Make a complete DNA copy of Albert and you might just end up with an unusually bright kid, but not a world-class genius.