Slashdot Mirror
Burn your genes on CD -- for $500,000
An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs.
It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "
If you bring your own disc, that'll only come to $499,990.00
Great, now I can pick and choose my good triats (I have those, right?) and sell them on EbaY! So long as can get past the copywrite burn protection, that is. Oh wait, I have a felt tip marker here. =]
-Valiss
what it would sound like. Take the data on the CD, convert it to MP3 or OGG and then have a listen. While most of our "songs" would sound the same, I suppose some filters could be applied to record only the major differences. It might make for some interesting electronica.
This article has been done before!
And it doesn't cost me a penny!
Government of the people, by corporate executives, for corporate profits.
From this first post: "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500."
This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.
The snow doesn't give a soft white damn whom it touches. -- ee cummings
Gives a whole new meaning to a "bug" in your software...
than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!
Or else it is a copy right issue. I can't wait to see people putting their genes on P2P networks.
I don't suffer from insanity, I enjoy every minute of it.
Just more proof that, one day, the RIAA will indeed own all of us.
Clever as he may be, his service does not provide a way that every detail about your DNA structure can be put onto CD. What will be on the CD is a large data file containing the pattern of how your DNA is built up, which chemicals are where, and so forth. However, what will be missing is the important data about how each chemical that forms your DNA is made up ITSELF.
So you'll get your CD alright, but the only people who could actually do anything productive with that data is the same company who made the CD for you! They have to keep the information about the chemical densities of DNA fragments on their own computers, since you need to have actual samples of the chemicals to do this, and you can't store chemicals on a CD.. only references to them!
It's like saying you can store a house on a CD. Sure, you can store the floor plan, and even the absolute position of every brick, but you can't store information about the chemical structure of the bricks or the glass. You take house plans and buy the parts from a building merchant.
Likewise, the genomes on the CD are just like architectural plans on building DNA, but you'd need to go to a 'DNA building merchant' like the scientist's fine company to actually find out what chemicals are referenced in the plans.
Unfortunately there's no way around this, and the guy offers a great service.. but just remember, while he's the only company out there, he pretty much has a stranglehold over the data you'll be taking away from him.
mogorific carpentry experiments
cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.
"gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"
How long till the RIAA finds out how this violates the DMCA?
I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.
1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?
2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)
3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.
other than interesting reading material (that is if you only know letters A,C,G and T)
Won't this infringe on the gene sequences that have been patented by various companies and institutions?
Remember it may be your body, but someone else 'owns' your genes!
-- Many men would appreciate a woman's mind more if they could fondle it
I don't remember too many details, but I do recall when the human genome was first completed, I recall reading somewhere that it would take something like 40 dual-layer DVD's to hold all the information.
Now since there is only 4 different pieces of data that need to be recorded, maybe it could be compressed. Thats two bits per letter instead of eight, right? That would still only bring it down to 10 dual-layer DVD's.
Ok, now this might sound ridiculous, but who would be suprised if the cd comes with a license agreement giving Mr. Greg Venter the copyright on the cd.
You could argue that the DNA is yours, and you can give a copy to as many people as you want, but let's say the data is in a proprietary format, hard linked with the software. Copying the software would be piracy and converting the data would be infringing the DMCA.
So, in addition to the large sum of 500 large US bills, you could be charged 10,000 for every extra copy. I'm not saying this is likely or even probable. Just possible.
Remember, this is the guy who swapped HIS OWN DNA with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?
Humpty Dumpty was pushed.
Sources say there's about 3 billion base pairs in the human genome. If we assume a reasonably efficient encoding scheme, we can get 4 base pairs into a normal 8-bit byte without compression. This gives us a total data size of a little over 700 megabytes, uncompressed. Run it through gzip, and you could probably fit it onto one cd, definitely 2.
But then again, I could be wrong.
Why does it cost half a million dollars to get your genes on a cd when you can get 'em put on a t-shirt for 50 bucks?
"Sic Semper Tyrannosaurus Rex."
"Each chemical that forms your DNA" is adenine, guanine, cytosine, or thymine, and we've known the chemical structure of all those for decades.
Chromosome 1:t tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc
atgcgcctagtttatagcgagcgtatgctgatcagtctggtatgg
Linux - Because Mommy taught me to Share.
Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.
/^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
This website says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.
Could i get my genome sequenced onto vinyl?
"Sic Semper Tyrannosaurus Rex."
burning individual human's entire DNA sequences onto shiny compact discs
I can do that for less than $500k:
Ingredients:
One CD (make use of an AOL one for a change).
A skin or blood sample.
Preperation:
Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.
A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!
Are you local? There's nothing for you here!
Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.
Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
Cheers,
-----[0_o]-----
We are not amused.
Come to think of it, it is a lot cheaper to yank off onto a CD than do it their way. Both contain the same info, one just smells better.
Table-ized A.I.
I wouldn't trust you with my genome considering you can't even do simple arithmetic.
A 100% discount means you'll do it for free. Anything over that and you'd be more than bankrupt.
blog
And it's more usable in a biological format too :)
"Backups are for wimps. Real men upload their data to an FTP site and have everyone else mirror it." -- Linus Torvalds
""Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome."
Even though it's you, you know they will copyright it.
And even though it's you, you know they will prevent you from copying and sharing it.
Bad what people do for money.
So humankind, in its death throes, would launch the first salvos of interstellar biological warfare.
Arthur C. Clarke is a terrorist!
It's a joke . . .
blog
@fbiTopTen = wget("http://www.fbi.gov/mostwant/topten/fugitives /fugitives.htm");
foreach $criminal (@fbiTopTen) {
1. Download $criminal iso image from Kaaza
2. Clone
3. Put $criminal in enhanced growth chamber.
4. Get Lunch
5. Take $criminal to FBI and collect ransom
}
Profit!
Live web cams
As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.
If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".
Look here at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.
Also one can FREELY browse the human genome and look for differences between your genome and those used to construct this draft of the genome.
What is the chance that you'll have an archaic CD-ROM drive in your computer to read it????
This looks like one of those old stories about "overcoming his death by sending a message to the future".
Presently the only good potential customer I could see would be the one that dreams on making a copy of himself when medicine gets to advanced to achieve what can't do today. This thing goes on the same wave as the frozen cadavers, frozen human cells and the frozen human DNA. However we know that all this risk to degrade in time. So the idea of writing up one's DNA would be an intersting solution to these drawbacks. Is it?
No. Because CD are also not eternal. And besides there is a huge difference between genes and what comes up after. We humans are the less genetic species on Earth, and every detail on character, behaviour and knowledge is mainly a product of our everyday experience. We are formed under the circumstances we grow up, the conditions of our family, society and the world in the whole. Besides every single piece of experience can be very fundamental to our character.
Let's remeber an old tale that many people used on several SF tales - Adolf Hitler's clones. Would Adolf Hitler revive from his genes? Absolutely not. His copies wouldn't ever seen his strict mother and his father with that very character of an austriac small burocrat. He wouldn't have suffered that poisoning in Ypres battlefield and wouldn't have seen the turmoil of the Russian October Revolution beating on the doors of Germany. He would not be the same racist bastard because his antecessor managed to wipe out a good piece of Jewish population in Germany and this populistic view that "jews are to be blamed for everything" is hardly to be overused today. Who would really be the new Adolf Hitler is hard to predict. However I would believe that his fate would not be shinny. Because he would not have parents, his artificiality would probably hunt him for the rest of his life and society, with its stupidities, faiths and superstitions would always mark him as the "Butcher of the World".
Well, probably soon we will have "an holographic image of your brain on DVD" together with instructions to reproduce it... But even then I would hardly believe that anyone may get ready for eternity. What would happen if I suddenly travel 1000 ahead from now? Well, let's take someone 1000 before us, and think the SHOCK he would get:
Boxes showing people or talking.
Mettalic tubes that spit fire and make huge thunders.
Big metallic things that move without horses, some EVEN FLY like birds.
People talking to each other on distance.
Fire that burns without wood.
Some strange boxes, made of metal and something like glass, where people write some strange symbols that look like letters and pass huge amounts of time on them. Some of these boxes even play songs or seem to talk. Others show demons, dragons and even trolls.
In other terms - The Hell...
Can I get mine on DVD or does that cost extra?
Comment removed based on user account deletion
1. Burn your genes on CD /dev/acd0c (or any other CD-ROM device ;-) | md5sum -
;)
1a. Insert the CD into your CD-ROM drive.
2. cat
3. share it, print it, do whatever you want. You could even make a barcode from it, which results in a quite fancy tattoo on your forehead.
- MD5 checksum mismatch. No, you're not my mom
Interesting. I had assumed the whole purpose was to make a back up. Compared to a contract with IBM it seemed like the price was justified.
$2000 - Getting your DNA mapped
$1 - Cost of CD-R
$10 - Burn Time Charge
$497,989 - Royalties that the RIAA says you owe the original artist (AKA Your Parents)
And out of that $497,989 --
$493,000 - RIAA Fees
$4,979.89 - Artist Royalty (1% of total Royalty Fee mentioned above)
$9.11 Actual RIAA loss due to P2P Network downloading of Gene Map ISO.
Cut to image of Brittany Spears selling her implants to prevent starvation...
Blog Prophyts - Right On, Man
does it have copy protection on it?
I'm not drunk, I just have a speech impediment. And a stomach virus. And an inner ear infection.
...willing girl to carry my genes, probably almost as much fun, too! :)
probably NOT, you definitely need to get laid my geeky friend!
Satanists get good grades too...suspiciously good grades
Human and chimp DNA are about 90% the same, they say. So all human DNA must be AT least 90% identical, if not 99%. Its only that last 1% which differentiates one human from another. Once the Human Genome Project is done, and all this DNA-in-common becomes public, you can burn 99% of your DNA on a CD for the cost of media, ie 10 cents.
People will complain that such general DNA is "not me!". But neither is "your" DNA you. A CD containing "your" DNA would be identical to a CD containing your twin brother's DNA. Are you your brother?
ps. Thanks for posting this story twice, I didn't get to comment the first time.
ggcacatcgacgatcgtacgtagcgcattatatttttcgatatcgtgcta gtcgtacgtatcgatgctgatgctagctagtcgatgctagtgctacgtag agtacgcatctcgatcgtagtgatctagctagctagtcgtgctagtcagc ttcgatgctagctaggcagtagcatctcgtagcacggattcgatgctagc tacgcatcgatgatcgatagtcgctcgctagatgatcgagcagcagctag a
If you burn this to a cd,send a check for 20$ to DNA,po box 23234,california
I never spellcheck and I freely admit it. Save your karma for more worthwhile "lol erorrs" replies
I think it's probably really easy to compress something consisting of 4 letters (it's 4, right?) in various sequences. I'm sure you could get it down to almost a quarter of its size...
I find it interesting to see the spin that CNN health put on this article (not that I'm suprised CNN would put some sort of spin on their news). Labeling Ventor as an Entrepreneur. The word many times denotes someone starting a business for profit. Though in the article it says this is a non-profit venture. Even the sentence that is said in though has spine see here..
"He said he has lined up several wealthy individuals, whom he declined to identify, who will pay to have their genomes mapped and thus kick off what he said would be a nonprofit project."
Using phrases like "He said" as if the reporter does not believe Ventor's clame of the venture being non-profit.
Maybe I'm just paranoid or I have a severe distrust of the media (both really I'll admit it). I know for a fact when writing news or anything in general, its not good practice to add good words unless you're trying to say something between the lines. In that quote.. "he said" is definately uneaded.. Of course HE SAID it.. the reporter is referenceing a quote.. Oh well thats my two cents.. Maybe the reporter is right.. but personally I'd rather find that sort of thing out from the facts and not be fooled into believeing it because of the SPIN some news outlet puts on a story because of their own hidden opinions. Editorials shouldn't be masked as clean straight forward news reports.. But hey thats just my opinion.
Who makes you Sig?
He's talking lossless compression. You could probably use some form of lossless compression on the base pair "string" (gzip, bzip2, rar, zip, etc). Your divx "compression" is actually a different encodeing that aims at dropping less signifigant information for the sake of being "close enough". This is the same idea as encodeing mp3/ogg from straight pcm.
DNA expresses a digital (quadrary) language.
I doubt that a human phenotype would fit onto 700 MB.
But it might well fit onto a future disc.
Consider some of the implications...
- p2p swapping of celebrity phenotypes - "psst, swap you a rare Marilyn Monroe for a Jucy Luicy"
- technology allowing us to create fertile eggs with any phenotype we happen to have in stock.
- a booming black market in stolen phenotypes.
- Clone Wars!!!
No thanks, I'll just copy my genes the old fashioned way.
Sig for sale or rent. One previous user. Inquire within.
I for one, cannot conceive of a better way for some rich moron to spend a half-million dollars than on another monument an over-inflated ego: "Fuck all the starving people in the world, I've got me a CD of my DNA sequence". And this appears under CNN's Health section, to boot. Shouldn't it be under their "What Dumb Assholes with Too Much Money Do" (or Investment) section?
Sigs are bad for your health.
Not quite. The estimate is 30000 *genes*, at an average size of 3 kbp apiece. That means ~90 Mbp of coding sequence.
You couldn't even make a bacterium with 30 kbp of coding sequence.
- This website [ornl.gov] says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.
Thanks for doing the calculation. Kind of magical in several ways:- Even including the junk - not very much by today's information-processing standards. Given some outrageous tech, it would be possible to re-create "a" human race with ten or twenty CDs.
- Talking about outrageous tech: a CD full of information squashed together in a space it takes an electron microscope even to see. We have some catching up to do
yes, we have no bananas
I can burn my genes on the stove for free. Heck I can burn my jeans too while I'm at it.
I think this would be one of the best investments a person could make.
Too bad it will be all of rich people, which will skew the results of any statistics that could pop out of the research.
All super rich people must have a gene or two that supplies an aggressive desire to spend money, and aquire stupid gold digging mates.
Saskboy's blog is good. 9 out of 10 dentists agree.
Some drink at the fountain of knowledge. Others just gargle.
Albert Eisteins' brain is kept in a jor (really!). And of course anyone we could dig up out of the ground that's less than a thousand years old might possibly have a retrievable DNA sample.
Some drink at the fountain of knowledge. Others just gargle.
The sequence probably compresses very well, too. My understanding is that human DNA sequences are relatively low entropy--significant portions of human DNA are repetitive sequences that don't encode a protein (i.e. they don't belong to a gene), and the fact that they're repetitive lends themselves well to lossless compression schemes like Huffman coding.
"It take 9 months to bear a child, no matter how many women you assign to the job."
You're confusing encoding with compression. Something composed from an alphabet of 4 letters is already essentially encoded in base 4, and can be encoded in binary using 2 bits per letter.
How much you can compress the resulting bit stream completely depends on the nature of the data, and without knowing something about the actual data patterns in the genome, it's not really possible to know in advance how much it'll compress.
IIRC, the accuracy on the current sequencing, while not awful, isn't perfect. Is the company liable for errors in the half-million dollar CD you're buying?
May we never see th
According to this little-known site.
Anyone who buys it won't find out they have the Sucker Gene until they get their disc.
If I wasn't so lazy, I'd have a sig.
More speculatively, there may be other things we dont know about yet that get a free ride from mother to child. To be very speculative, certain protein sets might very well influence the exprression of your genome. That is to say different developement.
This is not an unreasonable hypothesis, despite its high degree of speculation. Your and my Genonomes are so similar it is reasonable to suppose our differences arrise in part from HOW the genese are expressed. Expression is regulated by proteins in the cell that contains the DNA. Thus implanting your genome in another cell might not produce the same phenotype individual despite the common DNA.
Some drink at the fountain of knowledge. Others just gargle.
diff OpenGLFan.dna Einstein.dna > dna1.patch
cat dna1.patch | perl 'brain_only.pl' > dna2.patch
patch OpenGLFan.dna dna2.patch
And I could pass Tuesday's exam!
Midochondrial DNA has an extremely low mutation rate. I believe that as a result their geneic diversity is pretty small. The differences between your midochondria and mine would be slight.
"Never, never suspect the dreams within the dreams of dreaming children." ~The Amazon Quartet
Yeah? Well I can burn my DNA into a live human being with just a few pelvic thrusts.
eTrade SUCKS
I'm certain that genetics will have a great deal more to do with the field of medicine in the future. I'm not sure why you bring up drugs, except as an inference (there is no reference to drugs in the item). Anyway the "article" is not about drugs nor is it about Genetics, the science. It is a thinly veiled advertisement for Venter's business; a press release and sales pitch disguised as news. It is designed to appeal to the egos of the rich, while suggesting to everyone that it is for the good of all humankind. Bah.
Sigs are bad for your health.
Why pay $500,000 for my genetic code on CD when I can just get it off of kazaa or gnutella for the cost of bandwidth? I mean really.
You see? You see? Your stupid minds! Stupid! Stupid!
This of course brings up a different possibility - watching your gene map on TV. Dark room, techno music, maybe a little beer - quite the show.
Schnapple
Wouldn't it save a lot of cost to take a sample of your blood and have it frozen? Does that contain all of your DNA, or is it just part. Taking various samples and having them put on ice would probably preserve a lot more than having then on CD anyways.
What would they use this for? To make a clone-copy of you 100 years from now? That would be weird...
In the men's room:
Hey dude, you're like, missing something
I know, damn kids scratched the CD before I had it put in safety deposit
I'm going to donate some DNA in the old-fashioned way, it's much more fun - phorm
Yes and no. I just tried gzipping chromosome 22 (one of the smallest) - it goes from 35MB to 10MB. The entire genome is about 3.5GB. However, keep in mind that the repetition isn't perfect, because from what I understand repeat motifs are more like regex's than simply the same sequence over and over again. A custom compression scheme could probably do much better than gzip.
ANyhow the basic thrust of the comment was that DNA does not have everything on it. It's not clear what it is missing or how important that is at this point in time.
Some drink at the fountain of knowledge. Others just gargle.
Pretty soon, the pirates will leak some dna codes and i will finally be able to download Bob Costas over gnutella.
Disco Stu was talkin' to you.
Whose t-shirt? I'd fork over $50 to put my DNA on say, Charlize Theron's t-shirt.
"I think all foreigners should stop interfering in the internal affairs of Iraq"
-- Paul Wolfowitz, 7/21/2003
It's alway good to have a backup copy of your genes in case you have to reformat / reinstall yourself.
Ideology is for ideots.
But CD quality sucks! If you need to store your DNA, you definitely need to use vinyl, because of the better fidelity and the need to store all inaudible sequences and "junk DNA" too. It sounds warmer. You won't believe the difference until you see it yourself...
(And now probably some biologist will note that digital DNA mastering process has improved a great deal since early 1980s. Hmphf.)
And even better is if there were a standard template for the "average" human genome. Then you can just show where your genes differ, and that will uniquely identify you. And you'll cut the size into almost 1/1000th of storing the full data. Of course, you would have to have the standard human template to compare it to, to get your full genome. I just imagine people going to pharmacies or doctors and they swipe their DNA card to get their full genome. If the pharmacy/doctor kept a standard human template, you can cut down the data each person needs to carry by a huge amount.
yeah, i had a friend who partitioned himself wrong and went to unichs (unix)
Disco Stu was talkin' to you.
The backbone is made up of deoxyribose (a sugar) and phosphate. It is quite different from a protein, as you indicated..
Also - don't be scared off by the 3.5GB figure - that is probably encoded as a text file which gives 8 bits per base (so that is 4X space waste right there). Plus it probably has carriage returns and position indexes intersperced, which is some more overhead.
Man, when Jr. destroys that CD (as he has many others), the propagation of my DNA will be halted...
Love many, trust a few, do harm to none.
While the data-density of DNA is pretty high keep in mind that the fidelity of replication is VERY LOW by computer-standards (though quite impressive by just about any other standard). Mutations happen all the time - usually in non-critical regions. Computers are not very fault-tolerant - you would need a lot of error-correction overhead if you wanted to use DNA for data storage. And it doesn't store very well. You can't just take some DNA and stick it on a shelf for 5 years and expect it to make it unharmed. When scientists extract DNA from dead animals it is quite fragmented, but certainly good enough for identification/ classification purposes. Individual strands of DNA are quite fragile. Just moving it around without shearing it is difficult. (Picture a piece of spaghetti a million miles long and try to move it without breaking it - you're talking a length-thickness ratio along those lines.)
Before I plop down 500k, does anybody actually know if this sounds good? I mean, I could pay a lot less for bad music.
I read that wrong at first. Although, that's about what it would cost if you got caught burning lots of your games to CD...
Tcl my Pico! There are 10 kinds of people in the world: Those who understand binary, and those who don't.
Yeah, "burn your genes"! Now!
Now if they'll come up with some kind of genetic assembly language, we could debug our own genome. Anyone want to write a genetic emulator to test the code on? :)
*It's not what you can do for the Dark Side but what the Dark Side can do for you!*
So, you take a pinch of mommy, a dash of daddy, and after 9 months... [dips finger into beakers and licks it]... Mmmm... that's good Billy!"
After you have burned your genes on CD put the CD into the microwave.
Oh what fun.
What's the point of having a backup of my genes if there's no meatspace-burner available yet ? Adaptec Easy DNA Creator on a 8x TDK BioBurner, then I can sell warez copies of famous pornstars as mail-order-brides. I'm gonna be rich!
-Billco, Fnarg.com
Think of it! Someday we'll be able to warez Jack Valenti himself off of gnutella! =:)
Great, now we can fuck the latest $BIG_EVIL_CORP and our partners simultaneously!
Probly the closest most geeks are gonna come to a 3some...
Ali
Ph33r m3!!!
Evey time I pic up a cd I leave one or more skin cells on it, so I have my DNA on cd so why should I pay someone 500k to do it for me.
which after compression should fit comfortably on a standard CD.
We're assuming lossless compression, right?
Don't want to lose any important bits....:)
Another small step on the road to Frank J.Tipler's Omega Point.d ex-2.htm l#Omega
http://www.aleph.se/Trans/Global/Omega/in
N/A
Anyone serious about preservation of his/her DNA would best save $498,000 and bank their blood or other bodily fluids for 10 or so years. Some companies even offer payment plans on that $2000 charge.
In ten years time the technology to sequence quickly will allow for this operation to be done at 1% of today's cost. (Yes, I will put money on that prediction.)
Of course when the time comes, if you really want to keep the sequence a long time, I wouldn't suggest CD-ROM. With a shelf-life of 50-200 years under optimal conditions, you'd be better with a book printed on acid-free paper. There you're looking at a shelf life of half a millenium or more under the same conditions.
Mad scientists create an amusement park with the theme of cloning a post-neanderthal whose DNA was discovered during the government recall of all "Boy Band" music.
When the experiment goes awry, a young female tourist saves the day with her knowledge of Unix workstations*.
*UNIX is a registered trademark of William H. Gates DCXVII
WTF sense does this make. You want mt DNA? OK scratch some skin, take some blood.
Right, I'm not taking the small character set into account, and in this case there are newlines (but not position indices)- which might reduce the apparent repetition as far as gzip is concerned, but doesn't do much to the file size. However, there are not _really_ just four characters in any of the files, because the genome still has so many gaps. Centromere regions are a bitch to sequence, and right now the small arms of even the well-covered chromosomes are virtually blank (as far as I know), mainly because they're mostly rDNA and not as interesting. So you need to add the 'N' character, because for the time being you'll never get a completely sequenced chromosome. Even considering that sequencing technology is getting better and better, some stuff is just a pain in the ass and not really worth the extra effort in most cases.
I guess the obvious snide in joke to make here would be that since Venter's talking about this, we can assume that everyone who goes for this will end up with quite a few N's in their sequences. (sorry, I've heard a few too many Cato Institute types use Celera as an example of why we should eliminate the NIH. morons.)
...last time I burned my jeans it only cost me a new pair of pants and my dignity at the bon-fire.
PR
This is in fact how this data is currently envisioned as being used. You walk into your doctors office and give some blood for a genome screen.
The entire genome isn't sequnced...only the regions shown to be linked to a disease or to a drug response/lack of response (cytochrome P450 genes in particular). This data is then put on a mag strip card which you carry with you. when you go see another doctor with certain symptoms (weakness and persistent infections for instance), they run your card through their computer and see that you have a genetic predisposition to megalocytic anemia. Diagnosis made...we can all go home. But wait a second, your card also says that you have a mutation in one of your Cytochrome P450 genes that leads to you metabolizing drug X (whatever is used to treat megalocytic anemia 5 years from now or whenever this technology is widespread) so fast that you can't get an effective dose of it stably in your body. So rather than wasting time and money on drug X, they give you drug Y...a little more expensive perhaps but not as expensive as giving you a useless 4 week treatment of drug X followed by 4 weeks of the useful drug Y. Voila...you're diagnosed, treated and on you way to a healthier life in a matter of minutes instead of hours, days or longer.
Of course there are a whole host of scary, Gattaca-type things that could come of this data and legislation (in the US anyway where we're prone to do stupid shit at the drop of a hat) needs to be put in place and tested in the courts early to prevent discrimination based on this information. In the end however (as someone who's currently working on the research end of this stuff as a PhD student, soon to return to the clinics on the diagnostic end as a med student) this will do far more good than harm IMHO.
E
There's one thing computing teaches you, and that's that there's no point to remembering everything.
--Doug Copland
this is pretty close
http://www.ncbi.nlm.nih.gov/UniGene/
and as for the poster 2 up -- over 98% ov genetic material between humans is the same. current estimates are that only 30-50megabases differentiate any one huamn from another.
what I'd love to see is the "create a kid" feature:
Pop in your CD and one from a potential mate -- then push the button and have the software generate the array of potential vital stats on offspring. propensities, diseases, height and weight, correlations. as long as I'm dreaming, a good face shot too would be nice too.
it's a long way off. probably not in my lifetime, but it'll be here within 100 years.
(the rest is the mysterious "junk dna")
:)
Until we become collectively aware of its purpose, anyway.
Do you like German cars?
Oh, yeah and "shiny disks". Man! That justifies the price. No use putting it on those dull disks.
"I used to have that really cool,funny sig
Could this be the latest expression of what the selfish gene?
consider this: just burn your genome to cd, and lable the disk(s) "Microsoft paladium crack" and give them to an asian cd pirate and you suddenly have thousands of copies of your genome out there in the world.
It's the cheapest way to clone your genome, and no toilet training, or college educating required.
Wake me up when they can burn LIFE EXPERIENCE to a CD. Then and only then can you even come close to approximating what we are as human beings.
A stored DNA sequence is about as relevant to our desire for immortality as a camera. What does a snapshot of you say about who you are and the way you think?
What a fucking joke.
Yes, but *besides* that ... :)
... (hahhh ... I love how easy that is to say). Which would put a spin on today's handshake story. " *zzzp* ... there's my email addy, and as an added bonus, I didn't wash my hands, so you get my MP3s as well. DonotinhaleDonotallowcontactwitheyesIfyoudowashout withcopiousamountsofwaterLegaldisclaimer..."
... *crunch*. How close might this analogy be to cells?
OK, considering the points you bring up, and which I neglected, I wonder how good DNS would do for MP3s. That might actually be a good way of illustrating how fragile DNA is: encode sound on DNA; expose it to non-fatal radiation; listen.
As for storage: yes, another aspect I neglected. Maybe keep in in an engineered bacterium
Oh yes: a reason to post a response, Rich0. One thing I sporadically wonder about is the "dormant" or "trash" DNA. Sometimes it seems to me a bit like analysing a machine, say a car, and coming to the conclusion that actually, it's only the engine, drive train, wheels, steering system and breaks, plus the seats that ever get used. So: we cut out the "superfluous" parts, and
yes, we have no bananas
it's a very interesting way to get your research financed and have no strings atached by other companied who want to share in the knowledge.
Privacy is terrorism.
A lot of people are discussing the file format
:-)
:
/note="5S ribosomal RNA" //
and the practical problems (would it fit on
a CD etc).
I actually have a copy of all GenBank primates
in gzipped form and it takes roughly 1.0 GB.
That's primates and not just homo sapiens (it
is mostly homo sapiens, though).
There is a plain text format used (flat) and
it is pretty well documented. Look for
GenBank flat file in ncbi.nlm.nih.gov. I think
that they have migrated to a "linked" format
similar to html to allow better indentation.
The flat format is great for Perl
A sample of the actual source is
LOCUS AAURRA 118 bp ss-rRNA RNA 16-JUN-1986
DEFINITION A.auricula-judae (mushroom) 5S ribosomal RNA.
ACCESSION K03160
VERSION K03160.1 GI:173593
KEYWORDS 5S ribosomal RNA; ribosomal RNA.
SOURCE A.auricula-judae (mushroom) ribosomal RNA.
ORGANISM Auricularia auricula-judae
Eukaryota; Fungi; Eumycota; Basidiomycotina; Phragmobasidiomycetes;
Heterobasidiomycetidae; Auriculariales; Auriculariaceae.
REFERENCE 1 (bases 1 to 118)
AUTHORS Huysmans,E., Dams,E., Vandenberghe,A. and De Wachter,R.
TITLE The nucleotide sequences of the 5S rRNAs of four mushrooms and
their use in studying the phylogenetic position of basidiomycetes
among the eukaryotes
JOURNAL Nucleic Acids Res. 11, 2871-2880 (1983)
FEATURES Location/Qualifiers
rRNA 1..118
BASE COUNT 27 a 34 c 34 g 23 t
ORIGIN 5' end of mature rRNA.
1 atccacggcc ataggactct gaaagcactg catcccgtcc gatctgcaaa gttaaccaga
61 gtaccgccca gttagtacca cggtggggga ccacgcggga atcctgggtg ctgtggtt
(mushrooms are not primates, of course)
P.
For the price they can easily afford to put it on a DVD. :-)
It sounds like you're trying to compress an ASCII file with a bunch of letters representing the genome data. This is going to compress a lot better than an encoded file with two-bit bytes due to the large number of repeated "garbage" data in the ASCII representation. That's not to say that the encoded representation wouldn't compress well, perhaps with a customized compression algorithm. Run-length encoding would probably catch a good number of runs.
Josh Woodward
Imagine combining the DNA of some sexy celebrity with cheap, offshore cloning. You'd get living sex toys.
Just think: every geek could have their very own Britney/Amadala/etc living toy...
Wait a minute. Was I trying to say this is a bad thing? Bring on the clones!
Ed Wedig
Graphic design services
docbrown.net
An interesting question. If they had sequences from a large number of people, they might figure out where the genes are by looking at more stable regions of DNA. They might figure out codons through some sort of sequence analysis.
But I do think that it would be difficult to make a person without knowing the genetic code - otherwise how would you know how to interpret the DNA. Plus, a cell is hardly a stateless machine - you can't just synthesize 10 copies of each protein in the genome and put it in a cell with a genome and expect it to work... You would probably have to start with at least a partially working cell (you might get away with a tweaked yeast cell or something like that if you were really good, but I'd probably want to at least clone the genome into a vertebrate cell).
I guess you have to look at the goal. For Ventner, 99.999% is good enough (though it leaves huge regions unsequenced). Actually, just seqencing the ESTs would be good enough - his main goal was to patent important genes and sell important sequence data to companies. Nobody knows enough to market the non-coding regions - though I personally think they'll be just as important once everything has been figured out. But this is more along the lines of basic research - which is of little interest to companies like Celera - and one of the reasons that the NIH is still important...
I couldn't agree more on the "junk" DNA.
I think part of the problem is that DNA has to accomplish a lot of tasks. It has to mutate at just the right rate, it has to be pretty durable, it has to carry data, it has to be regulatable, it has to fit inside a confined space, and it probably has to do a lot of things nobody has thought of yet. Bacteria and viruses go for the most coding DNA in the smallest space. Eukaryotes go for the most versatility. Having all that non-coding DNA is a bit of a luxury when you think about it, but eukaryotes aren't driven by efficiency. Maybe a megabase of seemingly repetitive DNA convers a very slight advantage - maybe due to the physical structure of the DNA, or maybe due to the ability to implement a fancy regulatory system using it. For a bacteria, a megabase of extra DNA would be unthinkable unless it conferred a tremendous advantage. For eukaryotes, the cost of having that DNA is much lower, and so you are more likely to keep it around in case it comes in handy.
Picture these scenarios:
1. You live in a 2 bedroom apartment with a wife and three kids. Property costs a fortune in the area - you couldn't get more space without paying a FORTUNE for it.
2. You live in Bill Gate's house. Land costs 1 cent per acre, and you can build a 500,000 square foot warehouse for $29.95.
If you live in world #2 - would you ever throw anything out that didn't smell? Just the remote chance that it could come in handy later would make things worth saving. Somebody who purused your warehouse might not be able to figure out what some of that stuff is for - you don't seem to use it at all. You know what it is for, but you don't use it since you replaced it with something better years ago and are only keeping it since it doesn't cost you anything.
If you lived in world #1 there would be nothing in your house which isn't absolutely essential. Anybody who studied your house would figure out pretty quickly what everything is for. After all, they could see how you use it every day.
In the future: Insurance companies asking for a copy of your DNA CD when applying.
...and now he is getting ridiculous. Or longing for big money. 1. The human genome is still not fully sequenced. 2. Getting a single human DNA 100% sequenced in a reasonable amount of time (say a few months) is science-fiction for years to come. Read the news, other scienticts talk about 2050. What would it be worth, anyway: 3. Even the exact number of genes is not known yet. Numbers are ranging from 30.000 to 40.000. Let alone what these genes really do! Some funny comments like that one "a drop of blood on a CD" contain more thruth than Ventner giving interviews.
I've heard that humans share something like 97% of the same genetic code with a mouse and like 99% of the same code with a chimpanzee.
If that's true, then you could save a substantial amount of space by just burning the diffs between yourself and a standard chimp.
Well, in some cases around here you might not need a whole CD.
A floppy would probably suffice for all the diffs between some of us and the chimp.
"Provided by the management for your protection."