Slashdot Mirror


Burn your genes on CD -- for $500,000

An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "

105 of 276 comments (clear)

  1. Consider the Savings by carb · · Score: 5, Funny

    If you bring your own disc, that'll only come to $499,990.00

    1. Re:Consider the Savings by jweatherley · · Score: 5, Funny

      I'll warez mine off eDonkey or Kazaa - $0.00 for me!

      --

      --
      Reverse outsourcing: it's the future
    2. Re:Consider the Savings by NanoGator · · Score: 2

      You can tell from the price that the RIAA produced it. As usual, the DNA artists don't get a significant royalty.

      --
      "Derp de derp."
  2. I wonder... by Innominate+Recreant · · Score: 2, Interesting

    what it would sound like. Take the data on the CD, convert it to MP3 or OGG and then have a listen. While most of our "songs" would sound the same, I suppose some filters could be applied to record only the major differences. It might make for some interesting electronica.

    1. Re:I wonder... by agdv · · Score: 2, Funny
      I know it's not nearly the same, but have you heard of the Who song Baba O'Riley?


      (Score:1, The Who Reference)

    2. Re:I wonder... by stile · · Score: 3, Interesting

      This has been done before. Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major. Then they would just "play" a dna sequence and see what came out... Unfortunately, I have no links to post, I lost wherever I first heard mention of this (discover magazine, maybe?) and haven't found it since. Anyone?

    3. Re:I wonder... by jetlag11235 · · Score: 2, Informative

      Many links can be found at:
      linkage.rockefeller.edu/wli/dna_corr/music.html

      I can't say that I tried them all ... but one link near the bottom was rather interesting. Thymine in particular is worthy of checking out. AIFF format.
      www.healingmusic.org/SusanA/order.html

    4. Re:I wonder... by Chiasmus_ · · Score: 2, Insightful

      Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major

      Dude.. that's an Am7 chord. Your entire song is a "random arpeggio" through a single Am7 chord. Play it really fast and you've got.. an Am7 chord with a lot of vibrato on it.

      I can't say I'm overwhelmingly impressed...

      --
      "Beware he who would deny you access to information, for in his heart he deems himself your master."
    5. Re:I wonder... by the+gnat · · Score: 3, Interesting

      I dunno. . . put a throbbing techno beat behind it, you might have something. Esepcially since so much of our genomes is actually repeated motifs like SINEs or Alu sequences. Music to clone by. Even better, take some real genes or even just the DNA encoding protein fragments, and see if you get anything interesting. (I think "Leucine Zipper" would be a badass song name.)

      I'm a bioinformaticist- maybe I'll try this if I get bored some evening.

    6. Re:I wonder... by greenhide · · Score: 2

      Try google...DNA Music pulls up some good links...

      --
      Karma: Chevy Kavalierma.
  3. repost by Jucius+Maximus · · Score: 2

    This article has been done before!

  4. I carry my genes about with me everywhere anyway. by Moderation+abuser · · Score: 4, Funny

    And it doesn't cost me a penny!

    --
    Government of the people, by corporate executives, for corporate profits.
  5. Oh, the price has gone down. by titurel · · Score: 3, Informative

    From this first post: "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500."

  6. Put one in space by B1ackDragon · · Score: 2, Insightful

    This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.

    --
    The snow doesn't give a soft white damn whom it touches. -- ee cummings
    1. Re:Put one in space by Tablizer · · Score: 4, Insightful

      This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.

      I think one would need reference info to put the code to use. It is kind of like having the machine code of an app without knowing the machine language.

    2. Re:Put one in space by jafuser · · Score: 2
      But even besides that, the alien race would very likely not be DNA based
      What an assumption. Why is a soap bubble round?

      Now if you'll excuse me, I have a beam of light to catch...

      --
      Please consider making an automatic monthly recurring donation to the EFF
    3. Re:Put one in space by martyn+s · · Score: 2

      You're absolutely right. Maybe out of all the chemicals in the universe DNA is the only one which can encode genetic information in a biological process, and therefore any alien life would have to have DNA. I was going to mention that, but I just didn't want to write a rambling post, by mentioning every side possibility, and qualifying my every statement. The point of my post still stands tho. My point was, we can't even guarantee they'd have any idea what DNA means. No matter how smart you are, without actually seeing DNA based life forms, and knowing what base pairs correspond to which amino acids (as far as I know, it's arbitrary), they couldn't possibly figure it out.

  7. The Fly by dnoyeb · · Score: 2

    Gives a whole new meaning to a "bug" in your software...

  8. Wow, this so much easier by typical+geek · · Score: 5, Funny

    than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!

    1. Re:Wow, this so much easier by jdkincad · · Score: 4, Funny

      It certainly be cheaper, too.

      --
      The great advantage of having a reputation for being stupid: People are less suspicious of you.
  9. RIAA by rc27 · · Score: 3, Funny

    Just more proof that, one day, the RIAA will indeed own all of us.

    1. Re:RIAA by user32.ExitWindowsEx · · Score: 3, Funny

      Hilary Rosen, circa 2025: "All your DNA are belong to us."

      --
      "Evil will always triumph because good is dumb." -- Dark Helmet
  10. the ultimate insult by PaganRitual · · Score: 5, Funny

    cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.

    "gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"

  11. Alright, start the clock... by GeekLife.com · · Score: 2

    How long till the RIAA finds out how this violates the DMCA?

  12. some questions by john82 · · Score: 3, Interesting

    I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.

    1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?

    2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)

    3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.

    1. Re:some questions by micromoog · · Score: 3, Interesting
      1. It's a non-profit project.
      2. It's a non-profit project.
      3. Back it up just like any other worthwhile data.
    2. Re:some questions by Jhan · · Score: 2

      1> cd /mnt
      1> ls -l
      -rw------- 1 johf wheel 660000000 Sep 20 09:15 dna.txt
      1> more dna.txt
      CGAAGACTCTTTCAGATCGGCTAGATTGATTACATCTCGGG ATCTCTATTGCGCTTAGCCTTAGCGTCTCTCGAGATCGAGATCTCGGCCT ATATTATGACAT
      dna.txt (0%)

      Seriously, the research crowd tend to use simple and open file formats. No need to worry.

      --

      I choose to remain celibate, like my father and his father before him.

    3. Re:some questions by rew · · Score: 3, Interesting

      CGAAGACTCTTTCAGATCGGCTAGATTGATTACATCTCGG

      Nope. Won't fit.

      The Human gene set holds about 3 billion acid pairs. Thus you'd need a file of about 3 gigabytes to hold it in plain ascii. The file holds only 2 bits per byte, so can trivially be compressed to 600M, but gzip is very likely able to do much better.

      #include

      int main (int argc, char **argv)
      {
      int ch;
      char ACGT[] = "ACGT";

      while ((ch = getchar ()) != EOF) {
      putchar (ACGT[ (ch >> 0) & 0x03] );
      putchar (ACGT[ (ch >> 2) & 0x03] );
      putchar (ACGT[ (ch >> 4) & 0x03] );
      putchar (ACGT[ (ch >> 6) & 0x03] );
      }
      exit (0);
      }

      Regards,

      Roger.

  13. Ventner is suspect already... by oliphaunt · · Score: 4, Interesting

    Remember, this is the guy who swapped HIS OWN DNA with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?

    --




    Humpty Dumpty was pushed.
  14. Re:how big is the entire genome? by Captain+Nitpick · · Score: 2, Informative
    like, is it 1 cd(i find it hard to believe, but not that hard) or 30? 1000?

    Sources say there's about 3 billion base pairs in the human genome. If we assume a reasonably efficient encoding scheme, we can get 4 base pairs into a normal 8-bit byte without compression. This gives us a total data size of a little over 700 megabytes, uncompressed. Run it through gzip, and you could probably fit it onto one cd, definitely 2.

    --
    But then again, I could be wrong.
  15. CD? by Cyno01 · · Score: 2

    Why does it cost half a million dollars to get your genes on a cd when you can get 'em put on a t-shirt for 50 bucks?

    --
    "Sic Semper Tyrannosaurus Rex."
    1. Re:CD? by freeweed · · Score: 2

      Your DNA sample will be purified, amplified, expressed and analyzed according to funDNA protocols. A high-quality, clean stretch of quality base pairs will be extracted, combined with one of our designs, and then digitally transferred on to your new t-shirt, lunch box, or coffee mug!

      Because the t-shirt folks aren't doing anywhere close to your entire genome, they state this right on the page you linked to, and a listing of 3 billion base pairs would have to be so small as to be unreadable, no matter HOW large your t-shirt size.

      Wouldn't surprise me at all if 'funDNA protocols' just ignores anything input, and outputs random letters - how is the buyer going to confirm or deny it?

      --
      Endless arguments over trivial contradictions in books written by ignorant savages to explain thunder in the dark.
  16. Say what? by roystgnr · · Score: 2, Informative

    "Each chemical that forms your DNA" is adenine, guanine, cytosine, or thymine, and we've known the chemical structure of all those for decades.

    1. Re:Say what? by Chiasmus_ · · Score: 2

      Each chemical that forms your DNA" is adenine, guanine, cytosine, or thymine, and we've known the chemical structure of all those for decades.

      That's a bit incomplete. The helix itself isn't made of those chemicals; it's some kind of protein structure.

      The original poster actually makes a valid argument, but only if the subject receiving the CD is not familiar with genetics. In other words, if we put the CD in a time capsule, and then wiped ourselves out with biological warfare, and then the Earth was resettled by aliens 150 million years later, then even if they knew the CD was full of some kind of genetic information, they wouldn't be able to recreate a human without some additional knowledge. Consider receiving the world's first MP3, being told it was "a song", and being asked to write a player. Now, think of something several orders of magnitude more difficult. Yeah, that's about right.

      But even if he makes a valid point, it's not necessarily a very relevant one, since I see no compelling reason to care what happens to the universe after our species is extinct...

      --
      "Beware he who would deny you access to information, for in his heart he deems himself your master."
    2. Re:Say what? by Schnapple · · Score: 2
      adenine, guanine, cytosine, or thymine
      Remember when they made a song of these chemicals over and over on The Daily Show? Yeah, try getting that out of your head for the rest of the day.
  17. Post Your Genes on Slashdot - $0 by miracle69 · · Score: 3, Funny

    Chromosome 1:
    atgcgcctagtttatagcgagcgtatgctgatcagtctggtatggt tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc

    --
    Linux - Because Mommy taught me to Share.
    1. Re:Post Your Genes on Slashdot - $0 by freeweed · · Score: 5, Funny

      I suggest you contact a doctor immediately.

      According to this, you are going to die from insanely shortened chromosome #1 any second now.

      --
      Endless arguments over trivial contradictions in books written by ignorant savages to explain thunder in the dark.
    2. Re:Post Your Genes on Slashdot - $0 by silvaran · · Score: 2

      Oh yeah? Well you are a dumbass too...

  18. What I wanna know is... by DarkHelmet · · Score: 4, Funny

    Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.

    --
    /^[A-Z0-9._%+-]+@[A-Z0-9.-]+\.[A-Z]{2,4}$/i
    1. Re:What I wanna know is... by garcia · · Score: 2

      if you consider the "express line" that table they bring you to when you have a long beard or a turban.

  19. Re:how big is the entire genome? by treat · · Score: 5, Informative
    ike, is it 1 cd(i find it hard to believe, but not that hard) or 30? 1000?

    This website says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.

  20. Why a CD? by Cyno01 · · Score: 4, Funny

    Could i get my genome sequenced onto vinyl?

    --
    "Sic Semper Tyrannosaurus Rex."
  21. Re:Will it fit? by NewbieV · · Score: 2, Insightful

    From the Human Genome Project FAQ:

    Q. How big is the human genome?

    The human genome is made up of DNA, which has four different chemical building blocks. These are called bases and abbreviated A, T, C, and G. In the human genome, about 3 billion bases are arranged along the chromosomes in a particular order for each unique individual. To get an idea of the size of the human genome present in each of our cells, consider the following analogy: If the DNA sequence of the human genome were compiled in books, the equivalent of 200 volumes the size of a Manhattan telephone book (at 1000 pages each) would be needed to hold it all.

    It would take about 9.5 years to read out loud (without stopping) the 3 billion bases in a person's genome sequence. This is calculated on a reading rate of 10 bases per second, equaling 600 bases/minute, 36,000 bases/hour, 864,000 bases/day, 315,360,000 bases/year.

    Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data.

    As time goes on, more annotations will be entered as a result of laboratory findings, literature searches, data analyses, personal communications, automated data-analysis programs, and auto annotators. These annotations associated with the sequence data will likely dwarf the amount of storage space actually taken up by the initial 3 billion nucleotide sequence. Of course, that's not much of a surprise because the sequence is merely one starting point for much deeper biological understanding!

    Contributions to this answer were made by Morey Parang and Richard Mural formerly of Oak Ridge National Laboratory; and Mark Adams formerly of The Institute of Genome Research. [01/01]

    --


    "For every right, an equal responsibility..."
  22. Cooking Recipe. by T-Kir · · Score: 5, Funny

    burning individual human's entire DNA sequences onto shiny compact discs

    I can do that for less than $500k:

    Ingredients:

    One CD (make use of an AOL one for a change).

    A skin or blood sample.

    Preperation:

    Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.

    A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!

    --
    Are you local? There's nothing for you here!
  23. Value by Anonamused+Cow-herd · · Score: 3, Funny

    Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.

    Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
    Cheers,

    --
    -----[0_o]-----
    We are not amused.
    1. Re:Value by glwtta · · Score: 2
      I mean, that's just pennies per gene!

      Actually, it's around $16 per gene... still not too bad.

      --
      sic transit gloria mundi
  24. Re:One flaw, not everything is on the CD. by freeweed · · Score: 2

    Or you could just take high school biology and not worry about these mysterious 'chemicals' not being actually present on the CD. You also can't use the CD to impregnate women with, but I don't think anyone's gonna complain about that.

    --
    Endless arguments over trivial contradictions in books written by ignorant savages to explain thunder in the dark.
  25. Re:Me for sale! by MoneyT · · Score: 2

    I wonder if this would violate ebay's rules against biological items or not.

    --
    T Money
    World Domination with a plastic spoon since 1984
  26. Re:I carry my genes about with me everywhere anywa by Xpilot · · Score: 2

    And it's more usable in a biological format too :)

    --
    "Backups are for wimps. Real men upload their data to an FTP site and have everyone else mirror it." -- Linus Torvalds
  27. Watch out. by hateddamntruth · · Score: 3, Insightful

    ""Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome."

    Even though it's you, you know they will copyright it.
    And even though it's you, you know they will prevent you from copying and sharing it.

    Bad what people do for money.

    1. Re:Watch out. by wizzy403 · · Score: 2

      D'oh! I guess that means I'll just have to keep sharing my DNA the old fashioned way...

  28. Great business plan by Frank+of+Earth · · Score: 2

    @fbiTopTen = wget("http://www.fbi.gov/mostwant/topten/fugitives /fugitives.htm");

    foreach $criminal (@fbiTopTen) {
    1. Download $criminal iso image from Kaaza
    2. Clone
    3. Put $criminal in enhanced growth chamber.
    4. Get Lunch
    5. Take $criminal to FBI and collect ransom
    }

    Profit!

    1. Re:Great business plan by *xpenguin* · · Score: 2

      Syntax error on line 4.

  29. What are you talking about?!?!? by acidfast7 · · Score: 2, Informative
    As a biochemist/microbial physiologist this post TOTALLY BAFFLES me.

    As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.

    If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".

    Look here at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.

    Also one can FREELY browse the human genome and look for differences between your genome and those used to construct this draft of the genome.

  30. By the time this could conceivably useful... by carlcmc · · Score: 2

    What is the chance that you'll have an archaic CD-ROM drive in your computer to read it????

  31. Broken Time Machine by Ektanoor · · Score: 2

    This looks like one of those old stories about "overcoming his death by sending a message to the future".

    Presently the only good potential customer I could see would be the one that dreams on making a copy of himself when medicine gets to advanced to achieve what can't do today. This thing goes on the same wave as the frozen cadavers, frozen human cells and the frozen human DNA. However we know that all this risk to degrade in time. So the idea of writing up one's DNA would be an intersting solution to these drawbacks. Is it?

    No. Because CD are also not eternal. And besides there is a huge difference between genes and what comes up after. We humans are the less genetic species on Earth, and every detail on character, behaviour and knowledge is mainly a product of our everyday experience. We are formed under the circumstances we grow up, the conditions of our family, society and the world in the whole. Besides every single piece of experience can be very fundamental to our character.

    Let's remeber an old tale that many people used on several SF tales - Adolf Hitler's clones. Would Adolf Hitler revive from his genes? Absolutely not. His copies wouldn't ever seen his strict mother and his father with that very character of an austriac small burocrat. He wouldn't have suffered that poisoning in Ypres battlefield and wouldn't have seen the turmoil of the Russian October Revolution beating on the doors of Germany. He would not be the same racist bastard because his antecessor managed to wipe out a good piece of Jewish population in Germany and this populistic view that "jews are to be blamed for everything" is hardly to be overused today. Who would really be the new Adolf Hitler is hard to predict. However I would believe that his fate would not be shinny. Because he would not have parents, his artificiality would probably hunt him for the rest of his life and society, with its stupidities, faiths and superstitions would always mark him as the "Butcher of the World".

    Well, probably soon we will have "an holographic image of your brain on DVD" together with instructions to reproduce it... But even then I would hardly believe that anyone may get ready for eternity. What would happen if I suddenly travel 1000 ahead from now? Well, let's take someone 1000 before us, and think the SHOCK he would get:

    Boxes showing people or talking.
    Mettalic tubes that spit fire and make huge thunders.
    Big metallic things that move without horses, some EVEN FLY like birds.
    People talking to each other on distance.
    Fire that burns without wood.
    Some strange boxes, made of metal and something like glass, where people write some strange symbols that look like letters and pass huge amounts of time on them. Some of these boxes even play songs or seem to talk. Others show demons, dragons and even trolls.

    In other terms - The Hell...

    1. Re:Broken Time Machine by Jhan · · Score: 2

      Being frozen for 1000 years and waking up in the year 3000?

      I think I've watched enough Star Trek to get along. I'd probably find some decendant to leach from...

      Then again, I'm just some pizza parlor dude, what do I know?

      --

      I choose to remain celibate, like my father and his father before him.

    2. Re:Broken Time Machine by SoupIsGoodFood_42 · · Score: 2
      No. Because CD are also not eternal.

      Does anyone know how to do freaken back-ups any more? Has everyone forgotten how to copy CDs?

      Does the word CD suddenly put most people's brain into a mode where they forget the fundamental concepts of digital media?

      Seriously....Whenever "CD" and "back-up" are mentioned in the same aritcal, there's always about 20 posts along the lines of "CDs only last XX years", "But who would still have a CD-ROM in XX years time?", "By that time...".

  32. That's not the point? by capt.Hij · · Score: 2

    Interesting. I had assumed the whole purpose was to make a back up. Compared to a contract with IBM it seemed like the price was justified.

  33. Re:how big is the entire genome? by idiot900 · · Score: 2

    Not quite. The estimate is 30000 *genes*, at an average size of 3 kbp apiece. That means ~90 Mbp of coding sequence.

    You couldn't even make a bacterium with 30 kbp of coding sequence.

  34. Re:how big is the entire genome? by the+bluebrain · · Score: 2
    • This website [ornl.gov] says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.
    Thanks for doing the calculation. Kind of magical in several ways:
    - Even including the junk - not very much by today's information-processing standards. Given some outrageous tech, it would be possible to re-create "a" human race with ten or twenty CDs.
    - Talking about outrageous tech: a CD full of information squashed together in a space it takes an electron microscope even to see. We have some catching up to do :) (I dunno ... something like "I keep my MP3 collection in suspension in this [squints] drop of water")
    --
    yes, we have no bananas
  35. But... by sjbe · · Score: 2

    I can burn my genes on the stove for free. Heck I can burn my jeans too while I'm at it.

  36. Re:how big is the entire genome? by Hal-9001 · · Score: 2

    The sequence probably compresses very well, too. My understanding is that human DNA sequences are relatively low entropy--significant portions of human DNA are repetitive sequences that don't encode a protein (i.e. they don't belong to a gene), and the fact that they're repetitive lends themselves well to lossless compression schemes like Huffman coding.

    --
    "It take 9 months to bear a child, no matter how many women you assign to the job."
  37. encoding vs. compression by alienmole · · Score: 2
    I think it's probably really easy to compress something consisting of 4 letters (it's 4, right?) in various sequences. I'm sure you could get it down to almost a quarter of its size...

    You're confusing encoding with compression. Something composed from an alphabet of 4 letters is already essentially encoded in base 4, and can be encoded in binary using 2 bits per letter.

    How much you can compress the resulting bit stream completely depends on the nature of the data, and without knowing something about the actual data patterns in the genome, it's not really possible to know in advance how much it'll compress.

  38. Guarantees of accuracy? by 0x0d0a · · Score: 2

    IIRC, the accuracy on the current sequencing, while not awful, isn't perfect. Is the company liable for errors in the half-million dollar CD you're buying?

  39. It's too bad by professortomoe · · Score: 2, Funny

    Anyone who buys it won't find out they have the Sucker Gene until they get their disc.

    --
    If I wasn't so lazy, I'd have a sig.
  40. Midochondrial DNA not on CD; DNA not whole story by goombah99 · · Score: 2, Informative
    Although the parent to this post is a Troll. He is unfortunately correct, but not for reasons he cites. A cell has many components that are inherited from your mother that are not contained in the DNA. THe simplest and most profound of these is your Midochondial DNA. Midochodria are organelles that live symboitically inside every cell in your body. They are your main source of energy (ATP), and the cell is the Midochodia's only source of food. Both die without each other. Midochondia have their own private DNA which is not contained in the Cell's nucleous. You get your midochondia from your mother's egg (thus you and she have gentically identical midochondrial DNA.

    More speculatively, there may be other things we dont know about yet that get a free ride from mother to child. To be very speculative, certain protein sets might very well influence the exprression of your genome. That is to say different developement.

    This is not an unreasonable hypothesis, despite its high degree of speculation. Your and my Genonomes are so similar it is reasonable to suppose our differences arrise in part from HOW the genese are expressed. Expression is regulated by proteins in the cell that contains the DNA. Thus implanting your genome in another cell might not produce the same phenotype individual despite the common DNA.

    --
    Some drink at the fountain of knowledge. Others just gargle.
  41. Midochondrial diversity by BlueboyX · · Score: 2

    Midochondrial DNA has an extremely low mutation rate. I believe that as a result their geneic diversity is pretty small. The differences between your midochondria and mine would be slight.

    --
    "Never, never suspect the dreams within the dreams of dreaming children." ~The Amazon Quartet
  42. Re:Digital Life? by glwtta · · Score: 2, Redundant
    sigh, here we go again:

    first of all, we are talking about genotypes and not phenotypes (phenotypes are impossible to put on CD for obvious reasons). secondly, the human genome is roughly 3 Giga Basepairs, which, if you consider that you need 2 bits to store one basepair, gives you just over 715MB, with some compression that happily lives on a CD.

    Of course the vast (vast) majority of that is identical for all people, so you only need to store the differences.

    --
    sic transit gloria mundi
  43. I can do better by Jesus+IS+the+Devil · · Score: 2, Funny

    Yeah? Well I can burn my DNA into a live human being with just a few pelvic thrusts.

    --

    eTrade SUCKS
    1. Re:I can do better by Jesus+IS+the+Devil · · Score: 2, Funny

      Come to think of it... nevermind... I'll still end up paying $500,000 for the little bastard that comes out.

      --

      eTrade SUCKS
  44. Reality Check by Snork+Asaurus · · Score: 2, Insightful

    I'm certain that genetics will have a great deal more to do with the field of medicine in the future. I'm not sure why you bring up drugs, except as an inference (there is no reference to drugs in the item). Anyway the "article" is not about drugs nor is it about Genetics, the science. It is a thinly veiled advertisement for Venter's business; a press release and sales pitch disguised as news. It is designed to appeal to the egos of the rich, while suggesting to everyone that it is for the good of all humankind. Bah.

    --
    Sigs are bad for your health.
  45. Why? by Junior+J.+Junior+III · · Score: 4, Funny

    Why pay $500,000 for my genetic code on CD when I can just get it off of kazaa or gnutella for the cost of bandwidth? I mean really.

    --
    You see? You see? Your stupid minds! Stupid! Stupid!
  46. Re:how big is the entire genome? by Schnapple · · Score: 2
    which after compression should fit comfortably on a standard CD
    I've got an even better idea - put it on a DVD, so this "under 700MB" bit isn't even an issue.

    This of course brings up a different possibility - watching your gene map on TV. Dark room, techno music, maybe a little beer - quite the show.

  47. Re:how big is the entire genome? by the+gnat · · Score: 5, Informative

    Yes and no. I just tried gzipping chromosome 22 (one of the smallest) - it goes from 35MB to 10MB. The entire genome is about 3.5GB. However, keep in mind that the repetition isn't perfect, because from what I understand repeat motifs are more like regex's than simply the same sequence over and over again. A custom compression scheme could probably do much better than gzip.

  48. Re:Consider This... by Jhan · · Score: 2

    Interesting, interesting....

    AFAIK, chimpanzee DNA has never been fully sequenced(?). Comparisons have probably been made using simpler DNA typing procedures.

    However, by now we have at least two complete human DNA's. Has anyone run a diff on them to determine exactly how much difference there is between two not exactly random but anyway humans? Assuming the DNA is 99.9% identical, your chromosomal uniqueness (stored as a diff from some Standard Human DNA) should fit on a single floppy!

    Heck, using this scheme, you should be able to store the DNA code of every single human being alive in < 10 PB, soon within reach of SAN storage clusters. The mind boggles... Of course, that would cost < $5e15 with current pricing. Maybe I can get a volume discount.

    BTW, is anyone working on mapping mitochondric DNA? How large is that, anyway?

    --

    I choose to remain celibate, like my father and his father before him.

  49. Backup by Trickster+Coyote · · Score: 5, Funny

    It's alway good to have a backup copy of your genes in case you have to reformat / reinstall yourself.

    --
    Ideology is for ideots.
    1. Re:Backup by sharkey · · Score: 2

      ...in case you have to reformat / reinstall yourself

      You know you're screwed when booting your DNA CD installs Windows.

      --

      --
      "Outlook not so good." That magic 8-ball knows everything! I'll ask about Exchange Server next.
  50. Re:how big is the entire genome? by martyn+s · · Score: 2, Insightful

    And even better is if there were a standard template for the "average" human genome. Then you can just show where your genes differ, and that will uniquely identify you. And you'll cut the size into almost 1/1000th of storing the full data. Of course, you would have to have the standard human template to compare it to, to get your full genome. I just imagine people going to pharmacies or doctors and they swipe their DNA card to get their full genome. If the pharmacy/doctor kept a standard human template, you can cut down the data each person needs to carry by a huge amount.

  51. Re:Backup, bad pun by kingofnopants · · Score: 2, Funny

    yeah, i had a friend who partitioned himself wrong and went to unichs (unix)

    --
    Disco Stu was talkin' to you.
  52. Re:You have it backwards... by Rich0 · · Score: 2

    The backbone is made up of deoxyribose (a sugar) and phosphate. It is quite different from a protein, as you indicated..

  53. Re:how big is the entire genome? by Rich0 · · Score: 2

    Also - don't be scared off by the 3.5GB figure - that is probably encoded as a text file which gives 8 bits per base (so that is 4X space waste right there). Plus it probably has carriage returns and position indexes intersperced, which is some more overhead.

  54. End of the chain by PhotoGuy · · Score: 2

    Man, when Jr. destroys that CD (as he has many others), the propagation of my DNA will be halted...

    --
    Love many, trust a few, do harm to none.
  55. Re:how big is the entire genome? by Rich0 · · Score: 2

    While the data-density of DNA is pretty high keep in mind that the fidelity of replication is VERY LOW by computer-standards (though quite impressive by just about any other standard). Mutations happen all the time - usually in non-critical regions. Computers are not very fault-tolerant - you would need a lot of error-correction overhead if you wanted to use DNA for data storage. And it doesn't store very well. You can't just take some DNA and stick it on a shelf for 5 years and expect it to make it unharmed. When scientists extract DNA from dead animals it is quite fragmented, but certainly good enough for identification/ classification purposes. Individual strands of DNA are quite fragile. Just moving it around without shearing it is difficult. (Picture a piece of spaghetti a million miles long and try to move it without breaking it - you're talking a length-thickness ratio along those lines.)

  56. Re:Albert Einstein's Genome exists! by Angry+Toad · · Score: 4, Insightful

    Actually it's pretty unlikely, I would guess. It depends strongly upon how the brain has been preserved - if it's in a strong formalin solution then the DNA is largely unrecoverable. There are methods for getting some DNA out of formalin-fixed tissue, but it wouldn't be an easy job.

    I don't think the information would be a lot of use anyway until a LOT more is understood about brain development, and that's still assuming that whatever made Einstein's brain so brilliant was completely genetic in anyway. In utero environmental factors and probably lots of other factors we don't even know about yet might play a role. Make a complete DNA copy of Albert and you might just end up with an unusually bright kid, but not a world-class genius.

  57. Try before you buy. by mackman · · Score: 2

    Before I plop down 500k, does anybody actually know if this sounds good? I mean, I could pay a lot less for bad music.

  58. Flaming by affenmann · · Score: 2

    Yeah, "burn your genes"! Now!

  59. Hehe by RedWolves2 · · Score: 2, Funny

    After you have burned your genes on CD put the CD into the microwave.

    Oh what fun.

  60. Re:how big is the entire genome? by YrWrstNtmr · · Score: 2

    which after compression should fit comfortably on a standard CD.

    We're assuming lossless compression, right?

    Don't want to lose any important bits....:)

  61. anyone serious about preservation... by jonbrewer · · Score: 2

    Anyone serious about preservation of his/her DNA would best save $498,000 and bank their blood or other bodily fluids for 10 or so years. Some companies even offer payment plans on that $2000 charge.

    In ten years time the technology to sequence quickly will allow for this operation to be done at 1% of today's cost. (Yes, I will put money on that prediction.)

    Of course when the time comes, if you really want to keep the sequence a long time, I wouldn't suggest CD-ROM. With a shelf-life of 50-200 years under optimal conditions, you'd be better with a book printed on acid-free paper. There you're looking at a shelf life of half a millenium or more under the same conditions.

    1. Re:anyone serious about preservation... by geekoid · · Score: 2

      actually, I was going to construct a space laser, and just burn the sequence into the earth...

      --
      The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
  62. Movie synopsis from the year 8,372,002 by Alien+Being · · Score: 2

    Mad scientists create an amusement park with the theme of cloning a post-neanderthal whose DNA was discovered during the government recall of all "Boy Band" music.

    When the experiment goes awry, a young female tourist saves the day with her knowledge of Unix workstations*.

    *UNIX is a registered trademark of William H. Gates DCXVII

  63. Huh? I AM a CD. by gelfling · · Score: 2

    WTF sense does this make. You want mt DNA? OK scratch some skin, take some blood.

  64. Re:how big is the entire genome? by the+gnat · · Score: 2

    Right, I'm not taking the small character set into account, and in this case there are newlines (but not position indices)- which might reduce the apparent repetition as far as gzip is concerned, but doesn't do much to the file size. However, there are not _really_ just four characters in any of the files, because the genome still has so many gaps. Centromere regions are a bitch to sequence, and right now the small arms of even the well-covered chromosomes are virtually blank (as far as I know), mainly because they're mostly rDNA and not as interesting. So you need to add the 'N' character, because for the time being you'll never get a completely sequenced chromosome. Even considering that sequencing technology is getting better and better, some stuff is just a pain in the ass and not really worth the extra effort in most cases.

    I guess the obvious snide in joke to make here would be that since Venter's talking about this, we can assume that everyone who goes for this will end up with quite a few N's in their sequences. (sorry, I've heard a few too many Cato Institute types use Celera as an example of why we should eliminate the NIH. morons.)

  65. Re:how big is the entire genome? by drDugan · · Score: 2

    this is pretty close

    http://www.ncbi.nlm.nih.gov/UniGene/

    and as for the poster 2 up -- over 98% ov genetic material between humans is the same. current estimates are that only 30-50megabases differentiate any one huamn from another.

  66. Re:Copyright? by drDugan · · Score: 2


    I would be REALLY surprised, as his name is J Craig, not Greg.

    sorry, I couldn't resist.

  67. Re:What kind of special features will I get on DVD by drDugan · · Score: 2

    what I'd love to see is the "create a kid" feature:

    Pop in your CD and one from a potential mate -- then push the button and have the software generate the array of potential vital stats on offspring. propensities, diseases, height and weight, correlations. as long as I'm dreaming, a good face shot too would be nice too.

    it's a long way off. probably not in my lifetime, but it'll be here within 100 years.

  68. Re:how big is the entire genome? by Scoria · · Score: 2

    (the rest is the mysterious "junk dna")

    Until we become collectively aware of its purpose, anyway. :)

    --
    Do you like German cars?
  69. Re:how big is the entire genome? by cheesyfru · · Score: 2

    It sounds like you're trying to compress an ASCII file with a bunch of letters representing the genome data. This is going to compress a lot better than an encoded file with two-bit bytes due to the large number of repeated "garbage" data in the ASCII representation. That's not to say that the encoded representation wouldn't compress well, perhaps with a customized compression algorithm. Run-length encoding would probably catch a good number of runs.

  70. Re:how big is the entire genome? by Rich0 · · Score: 2

    I guess you have to look at the goal. For Ventner, 99.999% is good enough (though it leaves huge regions unsequenced). Actually, just seqencing the ESTs would be good enough - his main goal was to patent important genes and sell important sequence data to companies. Nobody knows enough to market the non-coding regions - though I personally think they'll be just as important once everything has been figured out. But this is more along the lines of basic research - which is of little interest to companies like Celera - and one of the reasons that the NIH is still important...

  71. Re:how big is the entire genome? by Rich0 · · Score: 2

    I couldn't agree more on the "junk" DNA.

    I think part of the problem is that DNA has to accomplish a lot of tasks. It has to mutate at just the right rate, it has to be pretty durable, it has to carry data, it has to be regulatable, it has to fit inside a confined space, and it probably has to do a lot of things nobody has thought of yet. Bacteria and viruses go for the most coding DNA in the smallest space. Eukaryotes go for the most versatility. Having all that non-coding DNA is a bit of a luxury when you think about it, but eukaryotes aren't driven by efficiency. Maybe a megabase of seemingly repetitive DNA convers a very slight advantage - maybe due to the physical structure of the DNA, or maybe due to the ability to implement a fancy regulatory system using it. For a bacteria, a megabase of extra DNA would be unthinkable unless it conferred a tremendous advantage. For eukaryotes, the cost of having that DNA is much lower, and so you are more likely to keep it around in case it comes in handy.

    Picture these scenarios:

    1. You live in a 2 bedroom apartment with a wife and three kids. Property costs a fortune in the area - you couldn't get more space without paying a FORTUNE for it.

    2. You live in Bill Gate's house. Land costs 1 cent per acre, and you can build a 500,000 square foot warehouse for $29.95.

    If you live in world #2 - would you ever throw anything out that didn't smell? Just the remote chance that it could come in handy later would make things worth saving. Somebody who purused your warehouse might not be able to figure out what some of that stuff is for - you don't seem to use it at all. You know what it is for, but you don't use it since you replaced it with something better years ago and are only keeping it since it doesn't cost you anything.

    If you lived in world #1 there would be nothing in your house which isn't absolutely essential. Anybody who studied your house would figure out pretty quickly what everything is for. After all, they could see how you use it every day.

  72. Re:Consider This... by King+Babar · · Score: 2
    AFAIK, chimpanzee DNA has never been fully sequenced(?). Comparisons have probably been made using simpler DNA typing procedures.

    Chimp DNA is being worked on right now; not sure of the ETA, but you can be certain that this will make a big splash when even a draft sequence is released. Most comparison made between chimp and human DNA so far have either been simple hybridization experiments, or comparisons of tens (now hundreds) of genes sequenced in both species. The short story is: wow, these genomes are close, but on the other hand we are *rather* different from chimps in many ways that matter quite a lot.

    --

    Babar

  73. Re:Consider This... by geekoid · · Score: 2

    human DNA is about 99% the same as any other human, chimps DNA is about 94% similiar then any other chimp.
    Chimp are more diverse because they have been around longer.

    --
    The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
  74. Re:Albert Einstein's Genome exists! by geekoid · · Score: 2

    "Albert and you might just end up with an unusually bright kid, but not a world-class genius."
    good enough.

    A cd of Alberts DNA might sell. If it was 5 bucks, I might buy it for the novelty sake.

    --
    The Kruger Dunning explains most post on /. http://en.wikipedia.org/wiki/Dunning%E2%80%93Kruger_effect
  75. wc `diff chimp.dna me.dna ` by 4of12 · · Score: 2

    I've heard that humans share something like 97% of the same genetic code with a mouse and like 99% of the same code with a chimpanzee.

    If that's true, then you could save a substantial amount of space by just burning the diffs between yourself and a standard chimp.

    Well, in some cases around here you might not need a whole CD.

    A floppy would probably suffice for all the diffs between some of us and the chimp.

    --
    "Provided by the management for your protection."