Slashdot Mirror
Antibiotic Resistant Staph Infections
LinuxGeek8 writes "There's a news update on a previous article about the first case of antibiotic resistant staph infections. The woman who has the infection is being kept up to 6 months in an isolation room. She is taking an antibiotic that is working, after many others did not.
"In the scheme of public health threats, this has to rank close to the top," David Ropeik, director of risk communication at the Harvard Center for Risk Analysis, said of antibiotic resistance."
the direct effect of industry driven animal farming. With antibiotics in the animal food. It is forbidden in Sweden, but is allowed in many many countries. Will make the jerms immune to antibiotics it has been known for quite some time 10+ years.
- To understand recursion, we must first understand recursion -
West Nile is a virus. There are no antibiotics for viruses, only treatments and immune shots. Immune shots allow our own bodies to make antibodies against viruses, so they shouldn't be susceptible to a similar problem with viruses (although immune shots must be taken at least several weeks before exposure to the virus).
Pretty common under the right conditions for nearly any bacteria.
It is fairly common for many types of bacteria to swap genes. I don't think it is very common that you can observe such a concrete trait being transferred from one species to another.
It's not so much 'theft' as 'mating'. . .gene exchange is just one method by which bacteria maintain genetic diversity.
Antibiotic resistant strains develop all the time, and most likely each and every one of us is a carrier for antibiotic resistant microbes. When you contract a viral infection and are prescribed antibiotcs it is important to take ALL the prescription. Just because you feel better doesn't mean the infection is gone, it just means you've killed enough virii that your body no longer needs to raise it's extra defenses (ie the symptoms). If you do not kill all the microbes, the ones that remain will develop defenses against whatever antibiotic was used against it, just as our bodies develop antibodies to defend against a Virus we've contracted previously..
Everyone is entitled to their own opinion. It's just that yours is stupid.
If you'd read the article as opposed to jumping at the opportunity to blame animal farming, you'd have read the vancomycin resistant staph infection (and it's presence in the Detroit area) is attributed to the mixing of antibiotics, including methicillin, with heroin by Detroit drug users from the 1970's. They were attempting to avoid infections.
Isn't this just another strain of the MRSA (Methicillin Resistant Staphylococcus aureus) superbug. If so, the UK has already had 2 deaths in Edinburgh (after it infected 13 patients). There was a death last year from it after a 14yr boy broke his ankle (see BBC News for more articles).
If you read the article, the resistance is attributed to theft of genetic material from another organism. So those bacteria which were most effective at stealing vancomycin resistance survived to breed, and pass on their criminal legacy.
Many health professionals hope that following this summer's discovery of vancomycin-resistant staph aureus in the metro woman's foot, Americans will be scared enough to accept limited use of antibiotics.
Not bloody likely. Though maybe if more doctors took the approach that was taken at the Olympic Village in Salt Lake City, the over-use of anti-biotics might start to decline. Not many doctors have that kind of captive audience, though.
It's not a matter of scaring people away from antibiotics, it's a matter of giving them something that actually might work, instead of just giving them something to get them out of the office...
I have no problem with bringing it up. But this article is discussing a specific strain with a specifically attributed cause and it isn't animal farming. It's heroin/antibiotic mixing. That's the cause attributed today, here.
In the creationist's mind, this is an example of "microevolution" and not "macroevolution". The latter of these two is the one that Goes Against God's Plan(TM), etc. They'll go along with staph becoming antibiotic-reistant, but not with staph mutating into an entirely different creature.
This ignores that micro and macro are in reality the same thing to educated people, of course.
The Russians have been working for years on alternatives to antibiotics. Phages are viruses that target bacteria and have been shown to be successful in targeting what would otherwise be very resistant strains. http://www.phages.org/PhageHistory.html
I'm pointing out that the scientists involved feel they have found the specific cause of this specific instance of vancomycin-resistant staph. And it isn't animal farming. It was heroin/antibiotic mixing.
If you want to discuss resistance in general, and it's growth in the future, bring up animal farming. But don't attribute this case to it.
There have been rumblings in the news for over a decade that profligate use of anitbiotics in both medical care and factory farming would lead to just this sort of problem. After years of warnings, no one should be surprised by this development. DNA swapping among bacteria species is a well-known phenomenon, and I read years ago that biologists were concerned this very thing would happen.
What's the alternative? Virtually every species of bacteria has one or more virus species that have evolved to prey on it. These bacteriophage (or phage for short) can sometimes be used as treatment for bacterial infection. They were supposedly the Next Big Thing about a century ago, before antibiotics stole the show. Now there is renewed interest in this approach. There was also a recent development of a technique using only a phage-produced enzyme to fight bacterial infections.
Google "phage therapy" or "phage enzyme" for some good reading on the subject.
Viruses such as HIV can swap genes, but only if two strains infect the same cell. This is why new influenza often comes to us from China, where swine, bird and human all live in close proximity and exchange viruses.
The chief engine of genetic change in viruses is caused by antigen drift via mutation. This is due to the error-prone nature of virus replication.
However, drug resistance is found in viruses. AIDS has shown resistance to some of the early retrotranscriptase inhibitors (AZT), not due to gene-swapping, but good old fashioned natural selection.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
I don't know about about the person who posted the article to /. but the article itself states pretty clearly that this is first strain resistant to vancomycin. I think the article mentioned that staph was already resistant to most other antibiotics. Vancomycin was one of our last defenses against staph evidently. That's why this was worth posting...
What differentiates "antibacterial soap" from "soap"?
One word: Triclosan.
This is an antibacterial agent commonly used in all sorts of consumer products including deodorant soaps. If it's for your body and labeled "antibacterial" check the ingredients. It probably has triclosan. While it is certainly not an antibiotic per se, bacteria can grow resistant to it, producing more virulent strains. See here for a good discussion.
A recent article (too lazy to google again) recently suggested antibacterial and regular soaps do an equally good job of cleaning you of bugs anyway.
I have actually worked in S. aureus research and it is a very scary bug. Some of the strains we had collected were resistant to 12 different antibiotics and even Arsenic. The main reason S. aureus becomes so easily resistant to new antibiotics is because it easily picks up circular strands of DNA called plasmids which carry resistance genes on them. The most likely source of the resistance gene is not cattle but other bacteria present in the hospitals. Enterococcus, a cousin of S. aureus which lives in a person's gut is highly resistant to Vancomycin and it was expected that sooner or later this will be passed to S. aureus. There have been cases of this happening in Japan a few years ago. The best place to pick up a nasty germ is in the hospital since most patiets there are on antibiotics so the only bugs around are highly resistant to a wide range of drugs.
VRSA (vanc. resistant s. aureus) is some scary schtuff. S. Aureus is one of the most virulent organisms we as humans get infected with; aside from the whole being sick in general, it can cause septic shock (death if you're not in a hospital at the time) and VERY rapid failure of your heart valves (called acute bacterial endocarditis). Vanc was once the last line of drugs. If it failed, we had no treatment. Since then, two more classes of ABs have been invented, and we deliberately avoid their general use so they'll be useful in just such situations; some doctors, sadly, don't use this guideline near as much as they need to. Sadly, S. Aureus is also a bacteria which is astoundingly well adapted to take up genetic change. These little buggers actually have "bacteria sex" and share their antibiotic resistance.
Here's some suggestions to help you avoid these problems:
1) Most MDR (multidrug resistant) bugs are found in hospitals (med word: nosocomial). You're relatively safe from this stuff when you're out in the community.
2) TAKE ALL OF YOUR ANTIBIOTICS AS PRESCRIBED. Taking just enough to feel better is the worst idea ever - all the bugs left have now been genetically selected for greater resistance.
3) If the doc says you don't need an antibiotic, don't push too hard - ABs can cause serious side effects and drug resistance in YOU. Remeber - a normal health human has 10x more bacteria than they do human cells - most bacteria are there to help!!!
Actually, the majority of antibiotics given to livestock are not administered to prevent infection. They are given to healthy animals in order to promote their growth. There is a good overview of the problem here.
First of all, the strain resistant to vancomycian has been known since 1993, so sensationalism aside, it's hardly news. I myself experienced this in 1996, after getting the same infection from a stream in Missouri; and I *almost* lost a toe because of it. A more powerful antibiotic, that I wish I could remember the name of, took care of it. By the time I realized it was a serious enough infection to go to the hospital, it was almost too late. (I discussed it in a usenet thread way back then, perhaps I can google it back out).
Now, to the "Antibacterial Soap"
What gives "Antibacterial" soap it's antibacterial property is mainly the molecular structure of the soap. It is lipophilic detergent, which impedes the cell membrane (of the bacterium), essentially stopping it from passing water either way (study the Fluid Mosaic Model to understand cell membranes).
I would imagine that olive oil has as much "antibacterial" properties as a grocery store "antibacterial" soap; so would a soap made from animal fat for that matter.
My understanding is that what makes Triclosan so special is, it simplifies (economizes) the manufacturing process, because it is less expensive to formulate triclosan than the alternatives with similar properties. I'm not trying to say that it doesn't kill bacteria -- it DOES kill bacteria, but the WAY it kills them is through a simple physical process.
I wonder if the patent has had any relationship to the sudden adoption of this chem in practically every personal care product on the shelf?
-fb Everything not expressly forbidden is now mandatory.
Not to push you over the edge, but the antibacterial soaps are controversial; many studies show they are little more effective than regular soap. Some contend the antibacterial ingredients can cause problems all their own.
Most bacteriocides that you'd be willing to put on your skin take a while to work, more time than you'd have the soap on. The most effective treatment is a good scrub, which physically scrapes the bacteria away -- not glamorous but effective. Most of us do a lousy job at handwashing -- it needs to be thorough and repeated during the day, as the bacteria multiply on your skin -- myself included, and I have two of those little disease vectors called "children."
Only 40% of people wash their hands exiting public restrooms, one study showed (imagine being the data-taker); the problem there being the encouragement of the fecal-oral route of disease transmission from the non-handwasher to others. I'll let you visualize what fecal-oral involves. So be a good citizen and lather up.
Oh, and the next time the press reports someone getting sick from beef tainted with E. coli, note that "coli" means colon, where these bacteria were discovered. These E. coli come from careless slaughtering practices and, stated frankly, mean that "there's manure in the meat." (quoting the muckraking author of the excellent Fast Food Nation)
It's a microbe's world after all.
And for my own favorite test, just like chiropractric, colloidal silver users make some wide, sweeping, and exagerated claims for what silver "can cure". I mean crap, that's a huge list of things it will cure or alleviate. You just have to wonder when you see that many claims of a miracle medicine/tonic.
"Doubt your doubts and believe your beliefs." -- Switchfoot, Ode to Chin
When you hear reports in terms of infections per 100,000 people, as opposed to isolated case studies, take heed. For now it merely makes for good copy, over and over.
Didn't you read the article - Staph aureus is a common pathogen that infects about 400,000 U.S. hospital patients a year. About one-quarter of them die . That sounds like a pretty big problem !!
Hey, great plugs for "Colloidial Silver". It's natural, right? And anything natural must be a Good Thing, right?
Yeah, kinda like Hemlock is natural.
Check out these links before you hit the natural foods store:
Rosemary Jacob's Argyria Pages -- her skin is a fetching shade of blue-grey, somewhat like the robot on Futurama.
Politician turns blue from drinking 'health' solution -- the Libertarian US Senate candidate from Montana would have had the distinction, if elected, of being the only Blue member of Congress. (I'm a Green, myself).
Stressed? Me? Of course not. Stress is what a rubber band feels before it breaks, silly.
Wrong. Most "antibacterial" products contain triclosan, which is about as useful for fighting infection now (after decades of massive overuse) as green Jello.
If you worked in a hospital, you obviously weren't a doctor or nurse. MRSA is Methicillin Resistant Staph(ylococcus) Aureus--a bacterial strain that is resistant to one of the antibiotic 'big guns' methicillin.
There are few choices of antibiotics left to treat it (for example, vancomycin--though vancomycin resistant staph was observed recently, IIRC). A patient with MRSA is unlikely to survive the trauma of surgery coupled with a serious infection, because the drugs used to treat MRSA are often not friendly in their side effects.
~Idarubicin
Correct me if I'm wrong, but you pee out any excess vitamin C that your body can't store. Vitamin C flies through your system, but other vitamins such as A can get saved, and too much of that is a bad thing.
But then, too much of anything, including vitamin C, is a bad thing. Especially if you like keeping your kidneys and other bloodstream filtering organs.
The latest all natural fad being used as an anti-microbial is "Grapefruit Seed Extract" (commonly called GSE).
I discovered it when it was recommended to me for a nasty GI virus that wouldn't go away by normal starvation. Killed the sucker right off. As a nursing student I will be trying to bring this into any hospital I eventually work for.
Hopefully, and I don't see why not, it will work against antibiotic resistant bacteria and viruses.
A good overview
Here's a good summary from another site:
Grapefruit seed extract is derived from the bioflavonoids found in the seed and pulp. Its anti-germicide action has shown a growth-inhibiting effect on bacteria, fungi, parasites, and viruses in several in vitro studies. The effectiveness of grapefruit seeds was discovered accidentally by a doctor, who noticed that the seeds did not decompose in his compost file. Further examination revealed that the grapefruit seeds killed any microorganism that tried to decompose it. Laboratory studies have shown it to be effective in inhibiting bacteria such as Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, and Mycobacterium tuberculosis. Grapefruit seed extract has been formulated by a number of manufacturers for various uses, including an internal bactericide, water disinfectant, skin cleanser, and first-aid spray. Grapefruit seed extract is also a treatment for house pets and livestock that may be susceptible to bacterial infections from a variety of sources.
Multiple anbitiotic resistance in bacteria is documented. I can refer you to a brief article which shows that the med community is aware of it.
* Tenover FC, Hughes JM. The challenges of emerging infectious diseases: development and spread of multiply-resistant bacterial pathogens. Journal of the American Medical Association 1996;275:300-304.
Also, we can consider this from two points of view and see why it's reasonable:
1.) bacteria can transfer genes from one to another by plasmid - a plasmid is a small circle of DNA that's not part of the bacterial genome. so one plasmid can code for resistance to antibiotic A, and another plasmid can code for resistance to antibiotic B. this modularity just from the molecular biology of bacteria makes bacteria well-equipped to deal with multiple assaults. a bacteria doesn't have to independently develop resistance, it can acquire it easily from another bacteria, mix and match etc.
2.) the nature of darwinian selection of the survivalists means that, while it is *unlikely* for any particular bacteria for develop resistance, *once* it does develop resistance, then it will likely survive and multiply under heavy antibiotic environments.
Triclosan is not an antibiotic. Antibiotics such as vancomycin are a mold. Triclosan is a chemical.
Despite very wide use, so far no one has discovered organisms developing resistance to triclosan. Which is not to say it can't happen, but so far it seems ok. Furthermore, triclosan is not something you can use to fight infection, so medically speaking it is irrelevant anyway.
If there is a problem with triclosan, it is that people could be exposed to abnormally few bacteria, and that perhaps this could weaken the development of the immune system (or something).
Personally, I doubt that bacteria will develop a resistance to triclosan. It would probably be about as difficult as developing a resistance to alcohol, which is apparently pretty much impossible for the poor little bacteria. Too bad for them.
Similar things have been done. Since most staph usually just colonize patients' noses rather than causing infections, you can block transmission by deliberately implanting relatively a-virulent strains in patients' noses. This was done buy a microbiologist called Shinefield in a series of experiments in neonatal units in the 50s and 60s. Another approach is to use viruses that target bacteria but not human cells. This has been used a lot in the former Soviet Union, and there's a good bit of research now going on into such methods in the West. It is certainly possibly that resistance costs will lead to drug-sensitive strains winning out in the long run if the antibiotic selective pressure is withdrawn. However, it really would be pretty crazy to deliberately cause an infection (rather than just colonization) in a patient with a second virulent bug.
So many people take anti-biotics for everything, and don't complete their prescribed courses, that people forget the other tried and true methods of helping your body and immune system fight a cold.
1. Inhalation of steam and an antiseptic agent.
Eucalyptus oil or Tea Tree oil in water, then heated/boiled is a great way to kill off bugs in the air. Very good for throat/nasal infections. Scented burners are good value for this.
2. Acidic foods/liquids.
This includes oranges, lemons, apples, grapefruit and tomato, including juices of those. Vinegar, particularly cider and malt vinegar, can be good if used as a mouth wash/gargle or ingested (if you can). Salt is also a good thing to ingest when ill, but as always, too much is bad for you. Yes, I am advocating salt'n'vinegar potato chips here. *grin*
3. Mouth washes.
Cider and malt vinegar work well, as does salt water. Iodine throat wash (commonly found under the "Betadine" brand) is also very good, but don't swallow it. Listerine and other mouth washes (for teeth care/plaque) are also good value. And brush your teeth too.
4. Suppliments/herbal treatments.
Echinacea, and other herbal suppliments can help, though be warned that some may have bad or deadly side affects for some people. Ginger is used lots in Chinese medicine, and is apparently quite good for helping someone overcome a cold, but some people are allergic to it. Vitamin suppliments are also good if you haven't been eating right, or can't keep a lot of food down.
5. Fluids.
The kidneys are a primary place for a virus to be flushed from the human body. Don't drink too much though, as it is possible to kill yourself from taking too much fluids.
6. Regular wash/shower.
Sweat is another way for fluids to leave the body, and regular washing helps remove some viruses.
This is not a definitive list. But I'm hoping someone out there might find it useful. There are a lot of NATURAL ways to fight a cold. The goal is to help out the body. If that is by helping to remove the virus or most of the things the body fights against on a regular basis (air-born contaminants, throat bourne virii, etc), then you body will have more resources to chuck at other areas. Just think of the whole thing as a resource based game, where you are the resource. Remember though that too much of something can be bad though, so balance things out.
MRSA strains with intermediate resistance to vancomycin have been seen in many parts of the world since 1996, and patients certainly have died as as result of vancomycin treatment failure. However, these perhaps weren't so scary as the resistance mechanism was a very thick cell wall which made these strains very slow growing and not so viable in the absence of vancomycin.
What's new is that MRSA strains have now emerged with high-level vancomycin-resistance and this happened by acquistion of the vancomycin-resistance gene (vanA) from VRE. That this was possible was shown in the lab in 1992, but the first time it's been seen in patients was this year. The two reports of Vancomycin-resistant MRSA in the U.S. can be found in the CDC's newsletter:
MMWR Morb Mortal Wkly Rep 2002 Oct 11;51(40):902
MMWR Morb Mortal Wkly Rep 2002 Jul 5;51(26):565-7
How scary is it? Until recently MRSA has been almost exclusively a hospital pathogen, so it's pretty scary if you're a hospital patient with a lot of tubes sticking into you which alow the bugs to get in and cause infections, but if you're well it's not a big threat (doctors and nurses can carry MRSA, but generally they don't develop infections despite a lot of exposure). There have been reports recently of strains of MRSA that do spread well in the community, and that can cause serious infections amongst essentially healthy people. However, these have not been multiply-resistant strains, and really these are no worse than virulent strains of normal S. aureus which have been round for millions of years. The message is, if you're well, don't rush out and buy cipro (this will only helps MSRA as the bugs are resistant to it), and if you're ill, keep away from hospitals.
Just to rebut a few other comments: over-prescribing of antibiotics probably is very important for encouraging drug-resistantce, but even correct of use of antibiotics will lead to some resistance. Use of antibiotics in animal feed can't really be blamed in this case, as drugs of the same class as vancomycin (glycopeptides) have not been used in animal feed in the US, though they have in Europe. They've probably played a significant role in VRE transmission in humans in some European countries, but in the U.S. hospital prescribing of this and other antibiotics have probably been the driving force.
It actually does - it contains triclosan, the over-used and poorly understood antibiotic. And while you're correct that it doesn't contain vancomycin, what it does do is select for those Staph that are resistant to triclosan. That's particularly a bummer when you DO get VRSA and decide to try to treat your infection with triclosan and find out, hmm, it's resistant to that TOO.
Rats!
It's pretty rare that any human invention outdoes mother nature.
Cheers.
There are definitely examples where an antibiotic-resistant strain is less fit than its wild-type strain in an antibiotic free setting. However, it seems that there are many more examples where the bugs just keep holding onto the resistance genes for decades, even when the antibiotics are no longer prescribed. So while it may be theoretically possible to infect someone with a more fit, less resistant strain, you'd probably kill the person due to the shock induced by the immune system reacting to so amy new bacteria.
There's this beautiful study done by a fellow in Florida where he's created a new strain of Streptococcus mutans (the critter that causes the majority of cavities) that kills its cousins (other S. mutans without the resistance gene) and also doesn't acidify your mouth. The end result is that a bad Strep is pushed out (so to speak) of your mouth by a good, non-cavity forming, Strep. It's going to be marketed in about 5 years like the fluoride rinses that you get at the dentist - only this time, no cavities for life!
And one more thing about preventative bacteria - probiotics as well as the indigenous flora in your body. Many pathogenic bacteria have a tough time competing/establishing a flagella-hold in a normal setting due to the presence of pre-existing, normal (i.e. non-pathogenic) bacteria. However, if you take antibiotics that are broad-spectrum (i.e. CIPRO (damnit!!!)), you can wipe out the good bacteria, allowing the bad bacteria to establish and cause lots of problems. So don't self-medicate!
Whether or not to wash yourself wasn't the point of the above comment, but how you wash yourself. She/He clearly stated to use soap only when needed and otherwise WASH with just hot water. Sounds like %100 washing to me. And yes, just water is actually fantastic at washing away basic dirt.
correct.
antibiotics were one of the most significant advancements of the 20th century. i studied the genetic mechanisms of the tranferral of bacterial antibiotic resistence as part of my postgrad and can add a few comments.
it's true that the overuse of antibiotics as placebos is a part of the problem, but what the article fails to mention is that not taking an entire prescription, or taking tablets irregularly, can be just as bad or worse. in these cases, because the full dosage/regimen is not followed, bugs get to "acclimatise" to a much lower dosage of the drug, which aids the evolution of resistance genes.
bacteria have a pretty damn nifty mechanism ("integrons") by which they can transfer genes encoding antibacterial resistance (amongst other things) to other bacteria. this, combined with the high rate of genetic evolution in bacteria, and the improper use of antibiotics, allows bacteria to develop resistance to new antibiotics very rapidly.
the moral of the story: don't ask for or take antibiotics unless you're really sick! you have an extremely efficient and adaptive immune system which works better the more it's used, so use it! and don't forget than big pharma companies *want* you to take antibiotics, and *want* doctors to prescribe them, even for stupid people with the flu (a virus).
matt
Actually, no. Bacteria have a pretty easy time growing on stainless steel. It's brass and other copper containing alloys that they can't take.
http://www.fastinc.com/foodsafe_copper.htm
Copper shows antibacterial properties against E. Coli
Originally published 9/14/2000
Source: www.foodservicecentral.com
A recent study, conducted by Bill Keevil, Ph.D., of the Porton Down, UK-based Center for Applied Microbiology & Research (CAMR), found E. coli O157:H7 bacteria survive for much shorter periods of time on copper and brass surfaces than on stainless steel. According to Keevil, this finding has wide-ranging implications for controlling the microorganism.
The work carried out by CAMR team member, Andrew Maule, revealed that at room temperatures it takes 34 days for E. coli O157:H7 bacteria to die on stainless steel tiles, 4 days to die on brass tiles, and just 4 hours to die on copper tiles. At chill temperatures typical of food storage, the study found that 10% of the bacteria were still alive on stainless steel tiles after 34 days, whereas bacteria were completely eradicated on brass tiles within 12 days and on copper tiles in just 14 hours.
Okay, after seeing the article, right about the time this came on the news.
For the patience-impaired, a local (err, Houston area) high school has had a rash of staph infections break out and the infections are apparentaly resistant to antibiotics. Now I understand that we over-medicate everyone but what's next when things such as this pop up in more than just an "isolated" area?
"...we dont care about the economics; we just want to be able to hack great stuff."
I believe that you are mistaken about a causal connection between the use of antibiotics in animals and antibiotic resistance as a result in infections in people. Please see New England Journal of Medicine, Vol. 345 (Oct 18, 2001). There are mutliple articles and an editorial on this topic. I would have provided a link to the articles, but I think full-text access is limited to subscribers. Their home page is here.
I never take antibiotics unless clearly, unequivocaly indicated... period. I was sick the entire month of September with Mycoplasma (an "atypical" pneumonia), and took no antibiotics. IAAD, BTW, so I have access to any and all antibiotics... I took nothing. Want to know why?
Whenever you take antibiotics you are messing with your normal bacterial flora; those bugs that live in/on you all day, every day. These communal bugs will almost never make you sick. Taking antibiotics wipes out your normal flora, along with the bug making you sick. No problem, right? Wrong... think of it in terms of population dynamics. You are opening up lots and lots of living space for any organism that wants to set up shop. Since it's now an antibiotic-rich environment, what bugs could survive there? That's right... the resistant ones.
Most antibiotics are broad spectrum (some more than others), within their class... ie. gram positive or gram negative. Since I work in a hospital, I am around a bad group of microorganisms, often multiply-resistant. Hospital-acquired pneumonias/other infections are problematic, precisely because that's where wide antibiotic use has bred resistance. If you have a live-in older disabled relative you take care of, or work in a nursing home, or work with end-stage AIDS patients, etc, you might want to be extra careful taking antibiotics. Those normal flora organisms may be doing you more good than you think.
This phenomenon is evident in conditions like Clostridia difficile colitis, where antibiotics wipe out normal bugs and allow the Clostridia to overgrow.
My personal (not necessarily professional) advice is to suck it up. If you have a cold and/or mild/moderate sinusitis, deal with it... the overwhelming majority are viral. If you have coexistant medical conditions, you may need antibiotics earlier than a young, healthy person. If you are young and healthy, be thankful, and avoid antibiotics unless clearly indicated.
Also, this may sound self-serving, but listen to your doctor when he says antibiotics aren't needed... that's why he went to school. The "I know my body" and the "I always get antibiotics for this" and the "my body has a resistance to drug X, I need drug Y" (usually a much more expensive/worse choice) crowd are the bane of every physician's existance. It sounds patronizing (and somebody is going to take me to task for this, I can feel it) but listen to your doctor, and don't throw a fit.
Even if a man chops off your hand with a sword, you still have two nice, sharp bones to stick in his eyes.
>However, you might look into apple seeds.
They are high in what is being called Vitamin B17, or Laetril. Quite controversial in its application; and depending on who you believe, it either cures cancer or kills you. It is also found in Apricot seeds, and Linseed (flax).
The FDA never seems to like anything that can't be patented and make their business friends lots of money...so it's best to study the heck out of this yourself.
A good site
Here's the short answer:
What Does Vitamin B-17 Do?
Dr. Krebs discovered the Vitamin B-17 compound reacts to the enzyme beta-glucosidase, primarily located in huge quantities at the site of cancerous tumours. In this reaction, two potent poisons are manufactured by beta-glucosidase at the cancer cell site; hydrogen cyanide and benzaldehyde. Therefore, Vitamin B-17's toxic reaction destroys the cancer cell.
What Happens To The Excess Vitamin B-17 Not Consumed In The Killing Of Malignant Cancer Cells?
Dr. Krebs found that healthy cells contain an enzyme called rhodanese, that acts as a control agent. Rhodanese is common throughout the body yet not at cancerous locations. If Vitamin B-17 comes into contact with healthy cells, rhodanese detoxifies the cyanide and oxidizes the benzaldehyde, and accurately targets Vitamin B-17 at cancerous locations and not at healthy tissue. Any excess by-products produced by the reaction are expelled in normal fashion through the urine.
Exactly. The whole point of soap is to make water "wetter", as I learned in 1st year high school honors chemistry. I don't think his claims are too outlandish.
Chris
umm actually soap emulsifies the oils so that the water can rinse them away.
Sorry, teleporters just kill you and then make a copy. A perfect, soul-less copy.
Not kidding...
http://news.bbc.co.uk/2/hi/health/1907065.stm
Deleted