Human Gene Count Slashed

← Back to Stories (view on slashdot.org)

Posted by samzenpus on Wednesday October 20, 2004 @03:39PM from the half-the-human-I-used-to-be dept.

jd writes "The estimate for the number of genes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genes at around 44,000 - or even as high as 100,000. Eric Lander of the Broad Institute in Cambridge, Massachusetts is quoted in the CNN story as saying that the number of genes isn't as crucial as how they are used." Read on for more, below.

jd continues: "This has the potential for making life extremely interesting for genetic engineers, given that both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out. Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code.

There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer, although if you now factor in the increased complexity of interactions, it is possible that such side-effects can be better understood and therefore prevented. The new estimates, therefore, are more than just idle curiosity but have the potential for impacting how the science is approached."

29 of 504 comments (clear)

Ah by Anonymous Coward · 2004-10-20 15:40 · Score: 5, Funny

Finally scientific proof that it's not the size that matters, it's how you use it.
1. Re:Ah by SEWilco · 2004-10-20 16:50 · Score: 2, Funny
  
  Hmmmm, I guess Microsoft has a problem then...
  No, Microsoft has been saying that the problem is how you use it.
2. Re:Ah by cylcyl · 2004-10-21 01:36 · Score: 2, Funny
  
  So this means that we can fit the genetic information of any person on one CD or a 512MB SD? I feel compressed :(
enough... by micronix1 · 2004-10-20 15:45 · Score: 5, Funny

25,000 genes will be enough for everyone. - 2004
great, we've been demoted by nomadic · 2004-10-20 15:46 · Score: 4, Funny

The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family.

Damn elitist mustard, looking down on us.
1. Re:great, we've been demoted by sik0fewl · 2004-10-20 16:02 · Score: 5, Funny
  
  I, for one, welcome our new Arabidopsis overlords.
  
  --
  I remember when legal used to mean lawful, now it means some kind of loophole. - Leo Kessler
2. Re:great, we've been demoted by tchalvak · 2004-10-20 16:48 · Score: 2, Funny
  
  You're working for them, aren't you.
Revised number revised by ignoramus · 2004-10-20 15:47 · Score: 3, Funny

In late breaking news, the final count of genomes in a typical human being has been found to be exactly 1. See http://en.wikipedia.org/wiki/Genome for details.
Great, more downsizing... by DLR · 2004-10-20 15:48 · Score: 5, Funny

Where'd they off-shore the genes to?

--
"Like fire and fusion, government is a dangerous servant and a terrible master."~RAH
Re:Death of Creationist Theory? by Anonymous Coward · 2004-10-20 15:49 · Score: 1, Funny

You really need to stop lending credence to their bullshit by entertaining it.

First they ignore you. Then they laugh at you. Then they fight you. Then you win.

Frankly, we are at step 3. Have been for a while.
Link To Mirror by naden · 2004-10-20 15:51 · Score: 2, Funny

Oh wait .. just read the post.

Damn newbies ... hehe.

--
Funtage Factor: Purple
Grade School Science Films Revisited by grannyknot · 2004-10-20 15:52 · Score: 3, Funny

This items made me recall a science film we watched when I was in grade 8. It was all about chromosomes.

There was an actor playing a typical I-don't-care-about-no-science-so- long-as-my-tractor-runs-right yokel who, as the 'scientist' (read: guy in a lab coat) noted that the fruit fly has five chromosomes and humans have 23, remarked "well, that's because people are the most advanced creatures on the planet."

The look on his face was priceless when he found out that potatoes have over forty.
The Scariest Part of the Article... by KhaZ · 2004-10-20 15:52 · Score: 2, Funny

Was the advertising by google.. :)
Human Genome on eBay Find human genome items at low prices. With over 5 million items for sale every... www.ebay.com
Heh. "Now valued at more $$$/Gene! Buy it now?"

--
- - - -
KickingDragon
Huh? by cmcguffin · 2004-10-20 15:56 · Score: 2, Funny

savagely revised

What, did they revise the number with a chainsaw?
Re:Death of Creationist Theory? by Frennzy · 2004-10-20 16:06 · Score: 1, Funny

Sir, I can't believe I wasted mod points on something else yesterday.

Applause. No Bullshit...Serious, solemn, applause.
Frightening headline by Pan+T.+Hose · 2004-10-20 16:28 · Score: 4, Funny

I've read the headline as "Human Genome Slashdotted" and I shouted: "Dear God, we're doomed!" My God, what an embarrassment... I need sleep.

--
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
Internets? by MillionthMonkey · 2004-10-20 16:38 · Score: 3, Funny

Wow, my hat's off to you sir. That's the easiest 5, Informative I've ever seen someone pull off on this Internet or any of the Internets for that matter.
Genetic Code by marko123 · 2004-10-20 16:43 · Score: 2, Funny

If there are less genes than we thought, the little buggers must be executing their comments.

--
http://pcblues.com - Digits and Wood
Spoiler alert by vandelais · 2004-10-20 17:06 · Score: 4, Funny

gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac

--
Game: Player 'Donald J Trump' now has AI skill level 'experimental'.
1. Re:Spoiler alert by servognome · 2004-10-20 19:02 · Score: 4, Funny
  
  It's a gene sequence?
  I thought it was one of those pictures that if you stare at it right turns 3D... stupid waste of 4 hours!
  
  --
  D6 63 0D 70 89 81 BB 8E 7B 7C 5F 5D 54 EA AB 73
2. Re:Spoiler alert by addaon · 2004-10-20 19:14 · Score: 5, Funny
  
  He only posted a few lines of it, but it reproduced.
  
  --
  
  I've had this sig for three days.
Re:Genomes? by Thenomain · 2004-10-20 17:14 · Score: 3, Funny

>That would be incorrect. The number of genomes in the human genome is 1.

Does that mean instead of being slashed, the number of genomes has been dotted?

--
This now concludes our broadcast day.
So long and thanks for all the fish... by Kippesoep · 2004-10-20 17:42 · Score: 2, Funny

I already knew white mice and dolphins were more advanced than us lowly human beings, but now we've been surpassed by a mustard plant!!??? Douglas Adams would've laughed his head off...
|00% A1lI NATURA| GENOME ENIARGEMENT by SetupWeasel · 2004-10-20 17:53 · Score: 2, Funny

!00% all safe super growth formu1a.

Garanted! MONEY BACK !

To Unsubcrib click her

jimeejzwgogzgqbjtywwenhbkklwnpkeeleyj
Only 25,000 genomes? by Pan+T.+Hose · 2004-10-20 17:57 · Score: 3, Funny

"The estimate for the number of genomes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genomes..."

Only 20,000 to 25,000 genomes? I was sure that the number of genomes in human genetic code was closer to 6,500,000,000.

--
Sincerely,
Pan Tarhei Hosé, PhD.
"Homo sum et cogito ergo odi profanum vulgus et libido."
Re:Death of Creationist Theory? by Anonymous Coward · 2004-10-20 18:23 · Score: 1, Funny

Why the need to spoil Gaia with your imaginary friend?
-----

Gaia, the mythical earth spirit? Or the total BS "planetary organism" concept. And you're talking down to others because "my imaginary friend can beat up your imaginary friend?"

Or did you mean Terra, the proper scientific name for this planet?
Code optimization? by spiff42 · 2004-10-20 19:33 · Score: 2, Funny

the number of genes isn't as crucial as how they are used
Compare to
the number of instructions isn't as crucial as how they are used
I think there are many similarities with machine code, and this in fact shows that it IS possible to spend thousands of years optimizing a piece of code.
I wonder what kind of debugger God uses? And if he ever reverse engineered someone elses code.
/Spiff
Re:Genomes? by Steve+Cox · 2004-10-20 20:24 · Score: 3, Funny

> But you and I have a different set of genes, so
> wouldn't be more correct to say that the number of
> genomes in the human genome is equal to the number
> of men living in the earth?

I guess that as a typical geek you find women to be a completely different species..... :)

Steve.
What's junk DNA? by Schwarzchild · 2004-10-20 20:53 · Score: 3, Funny

Which begs the BIG question, "What are those sections of the genome actually doing there?"

C'mon, it's trivial. Those are the comments in the code.

--
"sweet dreams are made of this..."