Gene Found That May Affect IQ in Males
Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."
It would be very interesting to see the effects of this gene across different populations. If it does not adversely affect Caucasian females, perhaps other populations are also immune to its effects (or are particularly susceptible to it).
Jesus saved me from my past. He can save you as well.
300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.
Women are like electronics: you don't know how damaged they are until you try to turn them on.
"...didn't being marked at 20 approximately 20 points."
;)
Maybe I have that gene, 'cuz I can't figure out what you're trying to say there...
"People will pay big bucks for the luxury of ignorance."
Well, I already know I don't have the dumbness gene, because my IQ isn't 20 points lower than it is. Or something.
The study went on to find that those individuals without this gene tend:
/.
- to be picked as moderators on slashdot...
- to vote straight party tickets
- to claim that "anal leakage" is an acceptable side-effect for food additives
- to buy advanced copies of the Dukes of Hazzard DVD
- to work on the MSIE team
- to post stupid bogus study result lists on
I might know what I'm talkin' about, but then again, this is Slashdot...
The standard deviation of IQ is 15 or 16 in most scales. A difference of 1.25 standard deviations is not small.
However, without knowing the frequency of the gene in the tested population, it's impossible to know if the difference is statistically significant. If the group was 50% male and 50% had the gene, it almost certainly represents a real difference; if only 5% had the gene, that's only 7-8 guys, and the "difference" is pretty likely to be random chance.
It's also worth noting that the difference could be in developmental speed rather than in level---i.e., the guys with the gene could just take longer to develop, but be just as smart by age 25, or could be associated with some other factor that is merely correlated with intelligence (such as, say, alcoholism which can lead to poverty which can lead to a less intellectually-nurturing home life).
Basically, this article gives us a sound bite with almost no useful information---shoddy reporting.
Yes some people definitely have, genetically, an intellectual advantage over others... but as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.
Let's say you're a genius, some child prodigy who's super at calculus or something.
Can you charm women and get laid?
Can you get along with strangers and keep a stable job?
Are you smart enough to stay out of trouble? Avoid fights, etc.
Are you smart enough to choose good friends?
Are you disciplined enough to manage our finances?
Are you street smart enough to protect your wealth from crooks?
Do you get regular exercise and stay in shape?
These are all things that are very important for a good quality of life, and you don't necessarily get 'em just because you are smrt.
"All men are created equal, except for those guys."
Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.
Sure, the tests will never be perfect. That doesn't make them useless or irrelevant.
Unless you're an idiot-savant, splitting hairs about different types of intelligence isn't all that useful. Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.
BTW, 20 points could qualify as "extremely major differences".
It's partially true. God gave man two heads, unfortunately he only gave us enough blood to use one at a time!
If your thinking with the little head, the big one is in standby.
Professional Politicians are not the solution, they ARE the problem.
Why would this be interesting, if it was true? Any trait is determined by some combination of (1) genetics, (2) prenatal environment, and (3) environment after birth. Studies of twins have already shown that genetics accounts for a very large percentage of the variance in IQ scores. On the other hand, there is no consensus about what IQ scores measure, except that they measure...the property possessed by people who do well on IQ scores. So we already knew there are genes that are important in determining it, but we don't know what "it" really is. What does this particular study (if correct) tell us that we didn't already know?
Find free books.
Let's not forget what we are testing for here. We're not saying that this gene makes people dumb. We're saying that boys with this gene score more poorly than boys without this gene. We're using a purely operational definition of intelligence (IQ score), and not making a value judgement.
This is interesting science, despite those who are spending their energy railing against IQ tests. IQ tests are terrible indicators of how "bright" someone is, but they are fairly consistent tests, in which people tend to get the same results over time, so they are measuring something with accuracy. And whatever that is, is hurt by this gene.
Is it attention? Does this gene make your balls itch, thus distracting you from standardized tests (also explaining why it only affects boys)? Perhaps, does it affect mathematico-spatial ability specifically, which boys tend to do better on than girls (very likely for social reasons), and thus the generally poor performance of girls in this part of the test accounts for the gender variation (a floor effect)?
Who knows. But a strong correlation between a gene and a standardized test score (especially a well established one like most IQ tests) in a not insignifigant sample (300 kids) is nothing to sneeze at - 20 points in a sample that large tends to indicate it's a real effect. Don't let the articles journalistic simplifications ("Gene makes boys dumb") throw you from seeing what that is.
Please read all instructions before beginning this test.
For this test you'll need:
If you did not bring the proper pencils or paper, please see the administrator. If you lack the proper genes, please turn this test over and place your head down upon the table. Your test will be administered later; when we have time for you. If you cannot read this sentence, stare blankly out into space until somebody comes by to escort you away.
People are treating this like there's a "smart gene". That's not at all the case. All they've done is identify a genetic defect which tends to lower the IQ of people who have this defect. They don't know the mechanism, and they still have a wide range, so it's probably one of many factors that is meaningless in isolation. Testing a particular living person for it wouldn't tell you anything useful about their intelligence.
P ages/I/Imprinting.html
So, what about potential people who do not yet have an intelligence that can be tested? Well, it turns out that IGF2R is a very, very special gene for other reasons. There are certain genes that are "imprinted" in sexual reproduction. You might wonder why, with all the mutations and screwups that nature seems to allow, we don't see female mammals occasionally giving birth to their own clones, from meiosis that doesn't go as planned. Well, inheriting two of the same chromosome is almost always fatal because of these imprinted genes. With imprinted genes, genes are expressed if and only if they come from one particular parent. IGF2 is expressed exclusively from the father. IGF2R is expressed exclusively from the mother. The upshot of this is that while you could use this to discriminate among egg donors, using it to discriminate among sperm donors would be useless. As the mechanism that causes the correllation is still unknown, and ova are in much shorter supply than sperm, people are unlikely to be terribly selective about it in ova. Given all the other things we can test for, it's unlikely people would make a sperm decision based on how smart the grandsons of their designer daughters would be. If we're assuming babies with pre-selected genetic makeup, the next generation could do the same, rendering the decision moot.
Read more: http://users.rcn.com/jkimball.ma.ultranet/Biology
There's no failure quite as dissatisfying as a complete and total solution to the wrong problem.
One of the local businesses used to hire students on summer vacation for clean-up of the property and shop. Few skills required, good hours, etc. But, once the minimum wage got over $3/hour, it was less expensive for the owners to do that work themselves. No more low-skill jobs there, and no chance to get your foot in the door for the high-skill, high-paying jobs in the rest of the plant.
There are jobs out there that do not require a lot of skill. Several million of them, according to statistics on illegal immigration. The trick is convincing students that they're not worth $30K per year when they first leave high school, because they haven't proven themselves in the work place. And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!
All this talk of efficiency and none about what the goal is? Seems hard to calculate the "efficiency" of society without being able to measure our achieval.
But I can make an educated guess that when you talk about efficiency, you're referring to productivity and GDP etc. Is that our whole aim as a species? To manufacture more and more goods? Because you need someone to sell them to and people buy to improve their lives. The greatest possible satisfaction for the largest possible number is the real goal of society in my book - and working in a frenzy to get by isn't it. Face it - ever since the invention of modern farming techniques, most of mankind has been facing a losing battle to make himself useful. We have the necessities of life (in the developed world), with modern transport, telecommunications, medicine, broadcasting, printing ad infinitem. By this point we should be working four days a week maximum and the rest of the time can be adapted to leisure, study, pursuit of all those things you really want to do.
Improving the efficiency of society by weeding out the unproductive? Don't you know that the level of ability needed to be productive is rising and rising? Your idea leads to either fewer and fewer people under more and more pressure to be brilliant, or else a halt to technological development.
Higher education ought to be the biggest growth industry in the developed world right now. Why isn't it?
Aide-toi, le Ciel t'aidera - Jeanne D'Arc.
rs_number|alleles|position (on chromosome 6)
rs8191692 C/T 160360652
rs2975115 C/G 160360684
rs2975116 C/G 160360687
rs8191704 A/G 160382749
rs11759563 C/T 160416104
rs8191746 C/T 160416109
rs8191753 A/G 160418673
rs8191754 C/G 160418735
rs8191758 A/G 160421034
rs8191763 C/T 160424152
rs1570070 A/G 160424389
rs13198308 C/T 160432052
rs8191776 A/C 160434644
rs6413489 A/G 160434696
rs894817 A/G 160434700
rs8191797 A/G 160437232
rs1050004 A/G 160437257
rs8191798 A/G 160437267
rs998075 C/T -160438689
rs6413491 A/G 160438720
rs8191808 C/G 160439921
rs8191809 A/G 160439953
rs8191810 A/G 160439956
rs8191819 A/G 160441967
rs8191820 C/T 160441987
rs8191840 C/T 160452138
rs8191842 C/T 160453003
rs8191843 A/G 160453053
rs8191844 C/G 160453340
rs2274850 C/G 160450541
rs2230043 A/C 160454948
rs8191859 A/G 160455901
rs8191860 A/G 160455961
rs2230048 A/T 160459759
rs8191869 A/G 160459815
rs8191881 C/T 160463358
rs8191886 A/G 160464245
rs2230044 A/G 160464245
rs629849 A/G 160464820
rs11552587 C/T -160465339
rs1050005 C/G 160465360
rs8191904 A/G 160471039
rs8191905 A/G 160471123
rs8191906 C/T 160471223
rs8191908 A/G 160471609
rs2230049 C/T 160471684
rs614754 C/G -160475610
rs1805075 A/G 160475618
rs8191933 C/T 160487883
rs3190229 C/T 160487892
rs1803989 C/T 160487892
rs8191955 C/T 160496427
rs8191956 C/T 160496750
rs8191957 C/T 160496859
rs8191958 A/G 160496868
rs8191959 A/G 160497049
rs8191960 -/ACAC 160497143
rs8191961 A/G 160497202
rs3832385 -/TTTG -160497316
rs8191962 -/ACAA 160497322
rs8191963 C/T 160497586
rs1050015 A/C 160497591
rs8191964 C/T 160497662
rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
rs8191966 A/G 160497672
rs14531 G/T 160497919
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:
Tissue-Specific Inactivation of Muri
I agree with h4rm0ny with a couple of things to add. At our point in civilization, the greatest societal good seems to be the greatest good for the greatest number, also known as utilitarianism. But I think the true criteria for "advanced" society is the degree to which it provides for all people. A society is only successful when the needs of everyone are met. Consider that 50,000 people are born every day and 40,000 people die from starvation on a global level. Is civilization "succeeding" because more people born then are dying because of a lack of food? I would say that as advanced as we humans claim to be that our claim to greatness is lacking if as many as 40,000 die from famine each day. Consider that native american tribes and the hunter-gatherer tribes before them had no "class" of people who were homeless, and only starved in the case that there was no food for anyone. Capitalism, does not seem to be the best system in place for meeting societies needs. Also consider a civilization of Indians (that is, in India) who existed 1,500 years ago and did not require police, advanced government, or a military to enforce rules. They lived in cities, farmed, and lived in peace until their lack of military means led to their being forced into slavery by their invadors, the Caucasions from the Caucaus mountains. This ancient civilization was just ahead of its time, it was not stupid, for those of you who will contend that it is. If society today resembled theirs, we would not behave because of the rule of law, we would do good unto our neighbors because we would understand it is in our best interests and the societal good to do so. Post-Newtonian logic argues that there seems to be an inter-relatedness or oneness to the world. That is, what we do to another, we do to ourselves. If we behave in a self-interested manner we see the obvious evil that arises because of it. This was the main point that both Buddha and Jesus shared: that selfishness and not loving another as you love yourself (in Jesus' case) was the cause of societal woes. Humanities main problems stem from its short-sighted approach to its needs in that we feel that once we have met the needs of our individual person, we are satisfied. If a new paradigm were established and societal good and its success were determined on the basis of the degree to which every person in said society is provided for, you would see a very different culture and economy than you see today. Instead of a GREATLY disproportionate distribution of goods that is say, 90% of the wealth being in the hands of the top 5%, you would see wealth be at LEAST more EQUALLY shared among all sectors of society, knowing that societal good is measured in its ability for all to be satisfied. Also, Rousseau's social theory in part bases itself on a theory that if we were all waiting to be born, and did not know whether we would be born rich or poor, we would, assuming that the rich would be, by far the minority, would rather have a roughly equal society where all are basically provided for. This would seem more logically than playing the "lottery" and merely hoping to be one of the few fabulously rich people in the world yet to be created. But as for the original point about intelligence, it seems that a society obsessed with production would value innovation and technology which would make intelligence important. However, I know plenty of intelligent people who have somehow missed the point of life and who also think things which are ridiculous becase they fail the wisdom check to make informed observations and form accurate opinions about the facts of life. And again, the featured article in this story says there is a great deal of variance among those who had the genes just as a group. That means that some who have the altered gene and have an IQ which is 20 pts less than it would be may, in some cases, be smarter than people who don't have the altered gene and therefor and 20 pts more than they otherwise would. If you think intelligence is key to living the good life,
brain development won't occur if people aren't _challenged_ to think.
t ic%22+iq
An illegitemate child named Isabelle was locked in a dark attic for years with her deaf and mute mother and no toys.
http://www.google.com/search?q=%22locked+in+an+at
She caught up with her peers within two years of being rescued and was found to have a normal IQ. Apparently her brain continued developing normally in the absence of intellectual stimulation in the dark attic.
Yeah, great idea. "Hey, that guy's smarter than most of us, which means he's a potential threat to society, therefore we should keep very close tabs on him even though he's done nothing wrong , we're just pretty sure he will eventually, because... well, he can."
Hey, better yet, why not just preemtively lock up anyone with a sufficiently above-average IQ? After all, they're capable of far more than the average "sheeple", certainly more so than the average police officer or federal investigator (percieved as his "natural enemies" just because he's capable of outsmarting them, nevermind whether he would actually try), and worst of all these intelligent folks tend to question established norms that should never be questioned (eg. laws, rules of behavior, patterns of thinking, etc.).
A friend of mine once made the observation that having a working brain in a society that values everything except intelligence is almost like having a real superpower. Yes, it means that smart people can do things that the majority of people can't. However, as parent so sadly illustrated, it also makes them a target, for the very same reason. The average person fears what they don't understand, and they don't understand people that possess greater mental faculties than themselves.
And before anyone flames me too harshly, bear in mind that I'm not suggesting any kind of "superiority" of intelligent people -- human nature and failing knows no IQ score. I'm just pointing out the absurdity of fearing someone, of suspecting them to be of greater criminal inclination, than those of average (or lower) intellect. To associate one's predisposition to commit crime or harm others as being directly proportionate to intellectual capacity a "because they're smart enough to get away with it" is beyond asinine.
Moderately Intelligent Man AWAAAAAAY!