Gene Found That May Affect IQ in Males

← Back to Stories (view on slashdot.org)

Gene Found That May Affect IQ in Males

Posted by ScuttleMonkey on Tuesday December 6, 2005 @04:26PM from the best-joke-setup-in-the-world dept.

Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."

14 of 660 comments (clear)

Only Caucasians tested by ReformedExCon · 2005-12-06 16:29 · Score: 5, Insightful

It would be very interesting to see the effects of this gene across different populations. If it does not adversely affect Caucasian females, perhaps other populations are also immune to its effects (or are particularly susceptible to it).

--
Jesus saved me from my past. He can save you as well.
1. Re:Only Caucasians tested by paulsgre · 2005-12-06 18:25 · Score: 5, Informative
  
  I agree that looking at other populations is crucial, but from what I can tell, they haven't even determined whether this is the gene actually responsible for the observed correlation.
  
  1. When looking at haplotypes, we see that genes travel together in chunks, and because someone has an alternate version of this gene, it could just mean that the haplotype is different. For example say the top 1/3 of chromosome #3 has 7 haplotypes. This means that when you look at populations from all over the world, you will see one of these 7 haplotypes, with 2-3 occuring in the vast majority of cases. On this haplotype there are multiple genes that travel together and recombine together so taht they stay "linked". The gene ACTUALLY affecting IQ could merely be closely linked in physical proximity to the gene they have identified. The genotypes observed in this study may just be markers for another as yet unidentified gene.
  
  2. The fact that it affects caucasian males vs females suggest it is sex-linked and other populations with the gene would be similarly affected. HOWEVER, it is entirely possible that the observed gene is an uncommon phenotype that has not drifted throughout the species and doesn't even exist in other races/populations.
  
  3. The gene in question codes for a growth factor receptor. Growth factor temporal expression dynamics are an interesting but complex subject, and the fact that they are looking only at 10 year olds presents another major problem. In brain development (or any development), decreased affinity for a ligand can alter the protein-binding curve such that more of the ligand (in this case the insulin-like growth factor) is needed to elicit the desired response, OR the ligand may fail to elicit the response because it "missed the train". There are different types of latencies across individuals, and increased developmental latency is a hallmark of the evolutionary nascent human brain, so it would not surprise me that there are many genetic variants of brain growth factors and receptors expressed during adolescence. Let's put it this way- there are two types of "malfunction"- A)you're supposed to meet up with your friends at 9 but you arrive at 10pm- your friends are pissed at you, but they waited for you, and the drunken revelry can continue as planned OR B) your flight was at 9pm, you missed it, too bad, do not pass go and do not collect 200 dollars.
  In the case of this growth factor receptor, we have no idea whether the gene variant causes malfunction, slower reaction, or complete inactivation, or even increased activation. I would not be surprised if the observed IQ differences leveled out over the next 5 years, especially considering the sex-hormone charged brain differentation that occurs during puberty.
  
  This article is pop fluff, and I would be wary of drawing any sort of conclusion from it.
Sample size? by Majik+Sheff · 2005-12-06 16:31 · Score: 5, Informative

300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.

--
Women are like electronics: you don't know how damaged they are until you try to turn them on.
Re:Gattaca by dogwelder99 · 2005-12-06 16:56 · Score: 5, Funny

Well, I already know I don't have the dumbness gene, because my IQ isn't 20 points lower than it is. Or something.
Related Traits... by catdevnull · 2005-12-06 16:59 · Score: 5, Funny

The study went on to find that those individuals without this gene tend:

- to be picked as moderators on slashdot...
- to vote straight party tickets
- to claim that "anal leakage" is an acceptable side-effect for food additives
- to buy advanced copies of the Dukes of Hazzard DVD
- to work on the MSIE team
- to post stupid bogus study result lists on /.

--

I might know what I'm talkin' about, but then again, this is Slashdot...
StdDev = 15, but it doesn't matter by Dire+Bonobo · 2005-12-06 17:00 · Score: 5, Interesting

> anyone know offhand what the population variance for IQ is?
The standard deviation of IQ is 15 or 16 in most scales. A difference of 1.25 standard deviations is not small.
However, without knowing the frequency of the gene in the tested population, it's impossible to know if the difference is statistically significant. If the group was 50% male and 50% had the gene, it almost certainly represents a real difference; if only 5% had the gene, that's only 7-8 guys, and the "difference" is pretty likely to be random chance.
It's also worth noting that the difference could be in developmental speed rather than in level---i.e., the guys with the gene could just take longer to develop, but be just as smart by age 25, or could be associated with some other factor that is merely correlated with intelligence (such as, say, alcoholism which can lead to poverty which can lead to a less intellectually-nurturing home life).

Basically, this article gives us a sound bite with almost no useful information---shoddy reporting.
Article Summary by strider44 · 2005-12-06 17:06 · Score: 5, Funny

"All men are created equal, except for those guys."
ah, the predictable denial by r00t · 2005-12-06 17:10 · Score: 5, Insightful

Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.

Sure, the tests will never be perfect. That doesn't make them useless or irrelevant.

Unless you're an idiot-savant, splitting hairs about different types of intelligence isn't all that useful. Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.

BTW, 20 points could qualify as "extremely major differences".
Correlation? by erikharrison · 2005-12-06 17:37 · Score: 5, Insightful

Let's not forget what we are testing for here. We're not saying that this gene makes people dumb. We're saying that boys with this gene score more poorly than boys without this gene. We're using a purely operational definition of intelligence (IQ score), and not making a value judgement.

This is interesting science, despite those who are spending their energy railing against IQ tests. IQ tests are terrible indicators of how "bright" someone is, but they are fairly consistent tests, in which people tend to get the same results over time, so they are measuring something with accuracy. And whatever that is, is hurt by this gene.

Is it attention? Does this gene make your balls itch, thus distracting you from standardized tests (also explaining why it only affects boys)? Perhaps, does it affect mathematico-spatial ability specifically, which boys tend to do better on than girls (very likely for social reasons), and thus the generally poor performance of girls in this part of the test accounts for the gender variation (a floor effect)?

Who knows. But a strong correlation between a gene and a standardized test score (especially a well established one like most IQ tests) in a not insignifigant sample (300 kids) is nothing to sneeze at - 20 points in a sample that large tends to indicate it's a real effect. Don't let the articles journalistic simplifications ("Gene makes boys dumb") throw you from seeing what that is.
New IQ test instructions by Think+Loudly · 2005-12-06 17:38 · Score: 5, Funny
Instructions:
Please read all instructions before beginning this test.
For this test you'll need:
- Two #2 sharpened pencils
- A non recessive IQ gene
- Four sheets of blank paper
- etc...
If you did not bring the proper pencils or paper, please see the administrator. If you lack the proper genes, please turn this test over and place your head down upon the table. Your test will be administered later; when we have time for you. If you cannot read this sentence, stare blankly out into space until somebody comes by to escort you away.
Re:Give those with low IQ jobs. by WoodstockJeff · 2005-12-06 18:31 · Score: 5, Insightful

But, who could afford it, given today's laws and taxes? Under current law, it costs an employer a minimum of about $500/week (depending upon the state) to employ a person for 40 hours at minimum wage. That's not what the employee gets - that's what it costs the employer to have them around. Anyone that doesn't produce at least $500/week in value to the business isn't going to be around for very long, no matter how "compassionate" it is to keep them.
One of the local businesses used to hire students on summer vacation for clean-up of the property and shop. Few skills required, good hours, etc. But, once the minimum wage got over $3/hour, it was less expensive for the owners to do that work themselves. No more low-skill jobs there, and no chance to get your foot in the door for the high-skill, high-paying jobs in the rest of the plant.
There are jobs out there that do not require a lot of skill. Several million of them, according to statistics on illegal immigration. The trick is convincing students that they're not worth $30K per year when they first leave high school, because they haven't proven themselves in the work place. And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!
Re:Give those with low IQ jobs. by h4rm0ny · 2005-12-06 20:06 · Score: 5, Insightful

All this talk of efficiency and none about what the goal is? Seems hard to calculate the "efficiency" of society without being able to measure our achieval.

But I can make an educated guess that when you talk about efficiency, you're referring to productivity and GDP etc. Is that our whole aim as a species? To manufacture more and more goods? Because you need someone to sell them to and people buy to improve their lives. The greatest possible satisfaction for the largest possible number is the real goal of society in my book - and working in a frenzy to get by isn't it. Face it - ever since the invention of modern farming techniques, most of mankind has been facing a losing battle to make himself useful. We have the necessities of life (in the developed world), with modern transport, telecommunications, medicine, broadcasting, printing ad infinitem. By this point we should be working four days a week maximum and the rest of the time can be adapted to leisure, study, pursuit of all those things you really want to do.

Improving the efficiency of society by weeding out the unproductive? Don't you know that the level of ability needed to be productive is rising and rising? Your idea leads to either fewer and fewer people under more and more pressure to be brilliant, or else a halt to technological development.

Higher education ought to be the biggest growth industry in the developed world right now. Why isn't it?

--

Aide-toi, le Ciel t'aidera - Jeanne D'Arc.
IGF2R by MillionthMonkey · 2005-12-06 20:42 · Score: 5, Informative

According to build 35.1 of GenBank and version 124 of dbSNP, the following 66 genetic polymorphisms have been found to occur within the 48 exons of IGF2R in humans:

rs_number|alleles|position (on chromosome 6) rs8191692 C/T 160360652 rs2975115 C/G 160360684 rs2975116 C/G 160360687 rs8191704 A/G 160382749 rs11759563 C/T 160416104 rs8191746 C/T 160416109 rs8191753 A/G 160418673 rs8191754 C/G 160418735 rs8191758 A/G 160421034 rs8191763 C/T 160424152 rs1570070 A/G 160424389 rs13198308 C/T 160432052 rs8191776 A/C 160434644 rs6413489 A/G 160434696 rs894817 A/G 160434700 rs8191797 A/G 160437232 rs1050004 A/G 160437257 rs8191798 A/G 160437267 rs998075 C/T -160438689 rs6413491 A/G 160438720 rs8191808 C/G 160439921 rs8191809 A/G 160439953 rs8191810 A/G 160439956 rs8191819 A/G 160441967 rs8191820 C/T 160441987 rs8191840 C/T 160452138 rs8191842 C/T 160453003 rs8191843 A/G 160453053 rs8191844 C/G 160453340 rs2274850 C/G 160450541 rs2230043 A/C 160454948 rs8191859 A/G 160455901 rs8191860 A/G 160455961 rs2230048 A/T 160459759 rs8191869 A/G 160459815 rs8191881 C/T 160463358 rs8191886 A/G 160464245 rs2230044 A/G 160464245 rs629849 A/G 160464820 rs11552587 C/T -160465339 rs1050005 C/G 160465360 rs8191904 A/G 160471039 rs8191905 A/G 160471123 rs8191906 C/T 160471223 rs8191908 A/G 160471609 rs2230049 C/T 160471684 rs614754 C/G -160475610 rs1805075 A/G 160475618 rs8191933 C/T 160487883 rs3190229 C/T 160487892 rs1803989 C/T 160487892 rs8191955 C/T 160496427 rs8191956 C/T 160496750 rs8191957 C/T 160496859 rs8191958 A/G 160496868 rs8191959 A/G 160497049 rs8191960 -/ACAC 160497143 rs8191961 A/G 160497202 rs3832385 -/TTTG -160497316 rs8191962 -/ACAA 160497322 rs8191963 C/T 160497586 rs1050015 A/C 160497591 rs8191964 C/T 160497662 rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665 rs8191966 A/G 160497672 rs14531 G/T 160497919

(Sorry about the formatting; the lameness filter forced me to make it look like that.)

Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.

The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:

Interestingly, M6P/IGF2R in mice is imprinted in all tissues except for the brain where both alleles are expressed. It is highly expressed in neurons of the forebrain, with the highest expression in the pyramidal cells, the polymorphic layers of the hippocampus, and the granule cell layer of the dentate gyrus; regions involved in emotional behavior, information processing, and memory formation. These findings indicate that M6P/IGF2R may assist in the development of these brain functions. This postulate is reinforced by the identification of M6P/IGF2R as the first putative "IQ gene." By comparing children with an IQ of 160 or higher to those with an average IQ, M6P/IGF2R was shown to be linked with general cognitive ability ("g"). The role of this receptor in the development of cognitive function can now be systematically assessed with M6P/IGF2R conditional knockout mice.
Tissue-Specific Inactivation of Muri
Re:Give those with low IQ jobs. by Zoyd · 2005-12-06 22:04 · Score: 5, Informative

brain development won't occur if people aren't _challenged_ to think.

An illegitemate child named Isabelle was locked in a dark attic for years with her deaf and mute mother and no toys.
http://www.google.com/search?q=%22locked+in+an+att ic%22+iq

She caught up with her peers within two years of being rescued and was found to have a normal IQ. Apparently her brain continued developing normally in the absence of intellectual stimulation in the dark attic.