Slashdot Mirror
Gene Found That May Affect IQ in Males
Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."
It would be very interesting to see the effects of this gene across different populations. If it does not adversely affect Caucasian females, perhaps other populations are also immune to its effects (or are particularly susceptible to it).
Jesus saved me from my past. He can save you as well.
300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.
Women are like electronics: you don't know how damaged they are until you try to turn them on.
So, now where can I get a genetic evaluation for my girlfriend and I, so we know if we'd risk passing this gene on to our children? Or, alternatively, when will we be able to genetically engineer them not to have it?
"[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz
"...didn't being marked at 20 approximately 20 points."
;)
Maybe I have that gene, 'cuz I can't figure out what you're trying to say there...
"People will pay big bucks for the luxury of ignorance."
IQ tests are too unreliable for identifying gene that contribute to intelligence. They are far from standardized for all people/genders and until then its really not possible to definitivly say just how any gene affects intelligence short of extremely major differences, such as those found in cases of genetic disorders. Even then, determining the exact gene (if it even is just one) is very difficult. If only we could agree on a perfect definition of intelligence first, then maybe we could come up with a better way to measure it.
Demented But Determined.
I'll wait to see their statistics. Why did they study this gene? It seems likely, for example, that given any group of 300 people, one could find a gene variant correlated with higher (or lower) IQ *in those 300 people*. With 30,000 genes, the statistics could be quite delicate. Another subject not discussed, apparently, is that a gene could presumably affect rate of development or growth, rather than eventual intelligence (this may be much more plausible, for example). This would manifest itself in 10-year olds, but not, for example, in 30 year olds. Why did they study 10-year olds? It seems like this may be an obvious objection.
welcome our new male overloards... Oh wait...
The study went on to find that those individuals without this gene tend:
/.
- to be picked as moderators on slashdot...
- to vote straight party tickets
- to claim that "anal leakage" is an acceptable side-effect for food additives
- to buy advanced copies of the Dukes of Hazzard DVD
- to work on the MSIE team
- to post stupid bogus study result lists on
I might know what I'm talkin' about, but then again, this is Slashdot...
The standard deviation of IQ is 15 or 16 in most scales. A difference of 1.25 standard deviations is not small.
However, without knowing the frequency of the gene in the tested population, it's impossible to know if the difference is statistically significant. If the group was 50% male and 50% had the gene, it almost certainly represents a real difference; if only 5% had the gene, that's only 7-8 guys, and the "difference" is pretty likely to be random chance.
It's also worth noting that the difference could be in developmental speed rather than in level---i.e., the guys with the gene could just take longer to develop, but be just as smart by age 25, or could be associated with some other factor that is merely correlated with intelligence (such as, say, alcoholism which can lead to poverty which can lead to a less intellectually-nurturing home life).
Basically, this article gives us a sound bite with almost no useful information---shoddy reporting.
Do you know what the bad ones who get "weeded out" under such a system do when they can't find a job? They steal your car and sell cocaine in order to get by.
Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do. Sure, they don't have the IQ to design bridges or perhaps even to work a cash register. Nevertheless, society as a whole is better off if there are opportunities available to those who cannot compete in the job market based on their (lack of) intelligence.
You can often employ several such people doing various tasks for the cost of one more police officer. It's better to keep them out of a life of crime than it is to "let nature take its course".
Cyric Zndovzny at your service.
Yes some people definitely have, genetically, an intellectual advantage over others... but as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.
Let's say you're a genius, some child prodigy who's super at calculus or something.
Can you charm women and get laid?
Can you get along with strangers and keep a stable job?
Are you smart enough to stay out of trouble? Avoid fights, etc.
Are you smart enough to choose good friends?
Are you disciplined enough to manage our finances?
Are you street smart enough to protect your wealth from crooks?
Do you get regular exercise and stay in shape?
These are all things that are very important for a good quality of life, and you don't necessarily get 'em just because you are smrt.
"All men are created equal, except for those guys."
Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.
Sure, the tests will never be perfect. That doesn't make them useless or irrelevant.
Unless you're an idiot-savant, splitting hairs about different types of intelligence isn't all that useful. Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.
BTW, 20 points could qualify as "extremely major differences".
It's partially true. God gave man two heads, unfortunately he only gave us enough blood to use one at a time!
If your thinking with the little head, the big one is in standby.
Professional Politicians are not the solution, they ARE the problem.
Why would this be interesting, if it was true? Any trait is determined by some combination of (1) genetics, (2) prenatal environment, and (3) environment after birth. Studies of twins have already shown that genetics accounts for a very large percentage of the variance in IQ scores. On the other hand, there is no consensus about what IQ scores measure, except that they measure...the property possessed by people who do well on IQ scores. So we already knew there are genes that are important in determining it, but we don't know what "it" really is. What does this particular study (if correct) tell us that we didn't already know?
Find free books.
Let's not forget what we are testing for here. We're not saying that this gene makes people dumb. We're saying that boys with this gene score more poorly than boys without this gene. We're using a purely operational definition of intelligence (IQ score), and not making a value judgement.
This is interesting science, despite those who are spending their energy railing against IQ tests. IQ tests are terrible indicators of how "bright" someone is, but they are fairly consistent tests, in which people tend to get the same results over time, so they are measuring something with accuracy. And whatever that is, is hurt by this gene.
Is it attention? Does this gene make your balls itch, thus distracting you from standardized tests (also explaining why it only affects boys)? Perhaps, does it affect mathematico-spatial ability specifically, which boys tend to do better on than girls (very likely for social reasons), and thus the generally poor performance of girls in this part of the test accounts for the gender variation (a floor effect)?
Who knows. But a strong correlation between a gene and a standardized test score (especially a well established one like most IQ tests) in a not insignifigant sample (300 kids) is nothing to sneeze at - 20 points in a sample that large tends to indicate it's a real effect. Don't let the articles journalistic simplifications ("Gene makes boys dumb") throw you from seeing what that is.
Please read all instructions before beginning this test.
For this test you'll need:
If you did not bring the proper pencils or paper, please see the administrator. If you lack the proper genes, please turn this test over and place your head down upon the table. Your test will be administered later; when we have time for you. If you cannot read this sentence, stare blankly out into space until somebody comes by to escort you away.
This explains that Simpsons episode when Lisa was depressed because she thinks she will turn out to be a loser, but then it turned out only the male Simpsons were like Homer and all the females were doctors and scientists.
Liberals call everyone Nazis yet they are the closest thing to it.
People are treating this like there's a "smart gene". That's not at all the case. All they've done is identify a genetic defect which tends to lower the IQ of people who have this defect. They don't know the mechanism, and they still have a wide range, so it's probably one of many factors that is meaningless in isolation. Testing a particular living person for it wouldn't tell you anything useful about their intelligence.
P ages/I/Imprinting.html
So, what about potential people who do not yet have an intelligence that can be tested? Well, it turns out that IGF2R is a very, very special gene for other reasons. There are certain genes that are "imprinted" in sexual reproduction. You might wonder why, with all the mutations and screwups that nature seems to allow, we don't see female mammals occasionally giving birth to their own clones, from meiosis that doesn't go as planned. Well, inheriting two of the same chromosome is almost always fatal because of these imprinted genes. With imprinted genes, genes are expressed if and only if they come from one particular parent. IGF2 is expressed exclusively from the father. IGF2R is expressed exclusively from the mother. The upshot of this is that while you could use this to discriminate among egg donors, using it to discriminate among sperm donors would be useless. As the mechanism that causes the correllation is still unknown, and ova are in much shorter supply than sperm, people are unlikely to be terribly selective about it in ova. Given all the other things we can test for, it's unlikely people would make a sperm decision based on how smart the grandsons of their designer daughters would be. If we're assuming babies with pre-selected genetic makeup, the next generation could do the same, rendering the decision moot.
Read more: http://users.rcn.com/jkimball.ma.ultranet/Biology
There's no failure quite as dissatisfying as a complete and total solution to the wrong problem.
rs_number|alleles|position (on chromosome 6)
rs8191692 C/T 160360652
rs2975115 C/G 160360684
rs2975116 C/G 160360687
rs8191704 A/G 160382749
rs11759563 C/T 160416104
rs8191746 C/T 160416109
rs8191753 A/G 160418673
rs8191754 C/G 160418735
rs8191758 A/G 160421034
rs8191763 C/T 160424152
rs1570070 A/G 160424389
rs13198308 C/T 160432052
rs8191776 A/C 160434644
rs6413489 A/G 160434696
rs894817 A/G 160434700
rs8191797 A/G 160437232
rs1050004 A/G 160437257
rs8191798 A/G 160437267
rs998075 C/T -160438689
rs6413491 A/G 160438720
rs8191808 C/G 160439921
rs8191809 A/G 160439953
rs8191810 A/G 160439956
rs8191819 A/G 160441967
rs8191820 C/T 160441987
rs8191840 C/T 160452138
rs8191842 C/T 160453003
rs8191843 A/G 160453053
rs8191844 C/G 160453340
rs2274850 C/G 160450541
rs2230043 A/C 160454948
rs8191859 A/G 160455901
rs8191860 A/G 160455961
rs2230048 A/T 160459759
rs8191869 A/G 160459815
rs8191881 C/T 160463358
rs8191886 A/G 160464245
rs2230044 A/G 160464245
rs629849 A/G 160464820
rs11552587 C/T -160465339
rs1050005 C/G 160465360
rs8191904 A/G 160471039
rs8191905 A/G 160471123
rs8191906 C/T 160471223
rs8191908 A/G 160471609
rs2230049 C/T 160471684
rs614754 C/G -160475610
rs1805075 A/G 160475618
rs8191933 C/T 160487883
rs3190229 C/T 160487892
rs1803989 C/T 160487892
rs8191955 C/T 160496427
rs8191956 C/T 160496750
rs8191957 C/T 160496859
rs8191958 A/G 160496868
rs8191959 A/G 160497049
rs8191960 -/ACAC 160497143
rs8191961 A/G 160497202
rs3832385 -/TTTG -160497316
rs8191962 -/ACAA 160497322
rs8191963 C/T 160497586
rs1050015 A/C 160497591
rs8191964 C/T 160497662
rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
rs8191966 A/G 160497672
rs14531 G/T 160497919
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:
Tissue-Specific Inactivation of Muri
I agree with h4rm0ny with a couple of things to add. At our point in civilization, the greatest societal good seems to be the greatest good for the greatest number, also known as utilitarianism. But I think the true criteria for "advanced" society is the degree to which it provides for all people. A society is only successful when the needs of everyone are met. Consider that 50,000 people are born every day and 40,000 people die from starvation on a global level. Is civilization "succeeding" because more people born then are dying because of a lack of food? I would say that as advanced as we humans claim to be that our claim to greatness is lacking if as many as 40,000 die from famine each day. Consider that native american tribes and the hunter-gatherer tribes before them had no "class" of people who were homeless, and only starved in the case that there was no food for anyone. Capitalism, does not seem to be the best system in place for meeting societies needs. Also consider a civilization of Indians (that is, in India) who existed 1,500 years ago and did not require police, advanced government, or a military to enforce rules. They lived in cities, farmed, and lived in peace until their lack of military means led to their being forced into slavery by their invadors, the Caucasions from the Caucaus mountains. This ancient civilization was just ahead of its time, it was not stupid, for those of you who will contend that it is. If society today resembled theirs, we would not behave because of the rule of law, we would do good unto our neighbors because we would understand it is in our best interests and the societal good to do so. Post-Newtonian logic argues that there seems to be an inter-relatedness or oneness to the world. That is, what we do to another, we do to ourselves. If we behave in a self-interested manner we see the obvious evil that arises because of it. This was the main point that both Buddha and Jesus shared: that selfishness and not loving another as you love yourself (in Jesus' case) was the cause of societal woes. Humanities main problems stem from its short-sighted approach to its needs in that we feel that once we have met the needs of our individual person, we are satisfied. If a new paradigm were established and societal good and its success were determined on the basis of the degree to which every person in said society is provided for, you would see a very different culture and economy than you see today. Instead of a GREATLY disproportionate distribution of goods that is say, 90% of the wealth being in the hands of the top 5%, you would see wealth be at LEAST more EQUALLY shared among all sectors of society, knowing that societal good is measured in its ability for all to be satisfied. Also, Rousseau's social theory in part bases itself on a theory that if we were all waiting to be born, and did not know whether we would be born rich or poor, we would, assuming that the rich would be, by far the minority, would rather have a roughly equal society where all are basically provided for. This would seem more logically than playing the "lottery" and merely hoping to be one of the few fabulously rich people in the world yet to be created. But as for the original point about intelligence, it seems that a society obsessed with production would value innovation and technology which would make intelligence important. However, I know plenty of intelligent people who have somehow missed the point of life and who also think things which are ridiculous becase they fail the wisdom check to make informed observations and form accurate opinions about the facts of life. And again, the featured article in this story says there is a great deal of variance among those who had the genes just as a group. That means that some who have the altered gene and have an IQ which is 20 pts less than it would be may, in some cases, be smarter than people who don't have the altered gene and therefor and 20 pts more than they otherwise would. If you think intelligence is key to living the good life,
Start with Googling for a definition of allele, to understand the concept.
If some gene-dependent trait is "positive" or not depends upon the environment. (See e.g. malaria resistance and red blood cells.)
In general, there are two things influencing wether a trait is on for males/females.
Karma: Excellent (My Karma? I wish...:-( )
The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested. If they don't relate to ones actual ability to be a productive member of society, it's hard to argue that they're meaningful.
Got a reference handy? I may be reading this incorrectly, but Psychology Today published an article that appears to disagree with you.
"Weapons should be hardy rather than decorative" - Miyamoto Musashi
I think that goes for OS's too
Trouble is the _competence_ part. Do show me where to get competent programmers... So far there don't seem to be that many about.
In fact hardworking incompetent programmers are pretty dangerous. (they're not as dangerous as hardworking incompetent military leaders of course).
Actually for programmers, I won't really care about the 20% vs 85% effort. As long as the genius guy uses his genius when doing his work.
I suggest that a programmer might be required to be fairly smart in order to be competent.
After all when it comes to _programming_, the _computer_ is supposed to do the work that doesn't require much intelligence.
Believe me, I've seen code by stupid programmers, and designs by stupid designers (I'm not a great programmer or designer, but some things are just so obviously stupid). The genius guy can replace some of these stupid but hardworking programmer with a script or two. If you could see some of the code I've seen... It's amazing how bad stuff can get and still "kinda work" (which can be very _dangerous_ if you think about it).
Everything else remaining the same (assume normal to above average trustworthiness and loyalty), I'd take the lazy genius guy anytime even if he only spends 20% of his office time working.
You won't have to throw 80-100% of his work away AND spend more time and resources fixing the resulting mess - corrupted data, pissed off people.