Slashdot Mirror


Gene Found That May Affect IQ in Males

Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."

660 comments

  1. hellooooooooo by orbit86 · · Score: -1, Offtopic

    I need a new brain..warranty on mine expired.

    1. Re:hellooooooooo by Anonymous Coward · · Score: 1, Insightful

      How is this flaimbait? I can see offtopic maybe...

  2. This just in... by nxtr · · Score: -1, Troll

    Wigger gene identified...

    1. Re:This just in... by kabz · · Score: 1

      Hey, you insensitive clod, my school nickname was Wigger.

      "My momma always said that 'Stupid is, as stupid does.'"

      --
      -- "It's not stalking if you're married!" My Wife.
  3. In other news... by rd4tech · · Score: 2, Funny

    Company looking for a web designer with the proper IQ gene to design a website compatible with firefox, some javascript knowledge also required.

    1. Re:In other news... by adolfojp · · Score: 1

      I think that it would be cheaper and easier to administer an IQ test than a genetic one, plus, if the IQ test already exists, why isn't it required for job interviews.

      Cheers,
      Adolfo

    2. Re:In other news... by CyricZ · · Score: 1

      Or perhaps it's time to use a better browser. Konqueror and Opera both render that site just fine.

      --
      Cyric Zndovzny at your service.
    3. Re:In other news... by TheGavster · · Score: 2, Funny

      Because actually being physically and mentally capable to perform tasks associated with a job can't be a job requirement anymore. Now, if we get rid of OSHA, we can keep the non-discriminatory policies and let natural selection weed out the bad ones like we did in the 20s ...

      --
      "Because Science" is one step from "Because old book". Try "Because of my experiment testing my falsifiable assertion".
    4. Re:In other news... by TelJanin · · Score: 1

      So does Firefox, actually. Not sure what the GP is trying to say.

    5. Re:In other news... by Anonymous Coward · · Score: 0

      As does IE. GP is a poor baby who lives in a Firefox glass house.

    6. Re:In other news... by rolfwind · · Score: 1

      Even if IQ can determine Intelligence (which I find ridiculous if they ask culture or history related questions), it doesn't determine the quality of the interviewee. There are other things at play.

      In a programmer, I'd rather have a competent person giving me their honest 75-85% effort than a certified genius giving me their half-assed 15-20% effort and spending the rest of their energy on the job in a haze, playing games, distracted by shit on the internet constantly, and blaming their misfortunes or failure to deliver on ADD, ADHD, and their parents.

      There are more than enough of either type around.

    7. Re:In other news... by Anonymous Coward · · Score: 0

      It was, I'm moderately sure, a comment on the uses of the discovery. Not on the site. Firefox works fine with it...

    8. Re:In other news... by S3D · · Score: 1

      In a programmer, I'd rather have a competent person giving me their honest 75-85% effort than a certified genius giving me their half-assed 15-20% effort
      The thing is, you need both. Sometimes you need breakthrough solution which requie insight and couldn't be achived by any amount of pure technical work. Also dull, unisnpired persons often produce bloated, overcomplicated code/design and usually not keeping up with latest technology.

    9. Re:In other news... by Anonymous Coward · · Score: 0
      if the IQ test already exists, why isn't it required for job interviews.

      Well, for one thing, an IQ test is horribly flawed. No, seriously. The way in which an IQ is calculated is extremely flawed, and any IQ value should be taken with the proper amounts of NaCl.

      The main reasons having to do with the tests being laregly based on small tricks you learn that you just may not have come across yet, as well as the IQ value being determined by age relative scores, despite the fact the difference in intellegence between, for example, an average 43 year old and an average 48 year old should be negligable.

      If you really care, google around for a while and you can find all the info I don't care to waste my time typing ;)

    10. Re:In other news... by cmossell · · Score: 1

      if the IQ test already exists, why isn't it required for job interviews.

      It is illegal to administer an IQ test for hiring. Any tests administered have to be related to some specific job qualification. When interviewing candidates for a programming job, a general inteligence (typically IQ) test can't be used.

      See Bell Curve : Intelligence and Class Structure in American Life by Murray and Hernstein for more info.

    11. Re:In other news... by TheLink · · Score: 3, Insightful

      Trouble is the _competence_ part. Do show me where to get competent programmers... So far there don't seem to be that many about.

      In fact hardworking incompetent programmers are pretty dangerous. (they're not as dangerous as hardworking incompetent military leaders of course).

      Actually for programmers, I won't really care about the 20% vs 85% effort. As long as the genius guy uses his genius when doing his work.

      I suggest that a programmer might be required to be fairly smart in order to be competent.

      After all when it comes to _programming_, the _computer_ is supposed to do the work that doesn't require much intelligence.

      Believe me, I've seen code by stupid programmers, and designs by stupid designers (I'm not a great programmer or designer, but some things are just so obviously stupid). The genius guy can replace some of these stupid but hardworking programmer with a script or two. If you could see some of the code I've seen... It's amazing how bad stuff can get and still "kinda work" (which can be very _dangerous_ if you think about it).

      Everything else remaining the same (assume normal to above average trustworthiness and loyalty), I'd take the lazy genius guy anytime even if he only spends 20% of his office time working.

      You won't have to throw 80-100% of his work away AND spend more time and resources fixing the resulting mess - corrupted data, pissed off people.

      --
    12. Re:In other news... by Savantissimo · · Score: 1

      You don't know what you're talking about. By all means take the scores with a grain of salt - in fact it requires a pretty decent IQ and a good deal of study to interpret IQ scores - but IQ is not based on mental age and hasn't been for over 75 years. IQ is the best established quantitative measure in human psychology. Some poor questions may depend on "tricks" but that is just a reflection of a limited degree of inaccuracy in a particular test. The tests are limited in precision and not infrequently give incorrectly low scores to an individual on a given administration.

      The way we know IQ, or more properly, "g" is a measurable entity is that just about all kinds of tests involving a component of mental skill correlate with one another (usually quite well). IQ tests, which are tests specially made to have the highest correlations with the common factor among all mental tests, also predict job performance across all sorts of different-level jobs better than any other single factor a decicion maker can consult - better than interviews, resumes, or education.

      --
      "Is life so dear, or peace so sweet, as to be purchased at the price of chains and slavery?" - Patrick Henry
  4. Only Caucasians tested by ReformedExCon · · Score: 5, Insightful

    It would be very interesting to see the effects of this gene across different populations. If it does not adversely affect Caucasian females, perhaps other populations are also immune to its effects (or are particularly susceptible to it).

    --
    Jesus saved me from my past. He can save you as well.
    1. Re:Only Caucasians tested by sharkb8 · · Score: 1

      It said whiLe females... not whiTe females...

    2. Re:Only Caucasians tested by mattjb0010 · · Score: 2, Interesting

      Firstly, the article (and /. blurb) says females in general, not specificaly Caucasian ones. It's fairly well known that a lot of genes relating to nervous system development are X-linked, in some work by my colleagues looking at sleep and IQ, this is something that is controlled for by considering the mother's IQ. I would be interested if there were any variations with race, however. At a conference I'm just about to fly back from, one of the talks detailed how one metabolic mutation was carried by 10% of Caucasians, this fell to 4% in Chinese populations, and only 1% in Japanese.

    3. Re:Only Caucasians tested by penguinoid · · Score: 4, Interesting

      Various genetic disorders can be carried by females, but only manifest in males. I guess we have this to compensate. I wonder how many other positive genes manifest only in males?

      --
      Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
    4. Re:Only Caucasians tested by flamelord · · Score: 0
      This is by no means a positive factor. Like baldness, this is a mutation off the norm; you might call it the 'tard' gene:




        "All people carry the gene, but some have a version with a slightly different code, Jirtle said. This variation, he and his colleagues found, correlates with a lower IQ."


      It does seem to be a sex linked one, that like baldness, manifests only in males. Actually, baldness is even worse, supposedly, largely (main contributing genes) seem to be inherited from the mother's x to the son and doesn't have much to do with whether the dad is bald or not.


      Regarding whether these results would hold up outside of the caucasian ethnicity, I don't see any reason why it wouldn't.

    5. Re:Only Caucasians tested by TastyCakes · · Score: 2

      uhh the gene is a negative one. it makes you dumber.

    6. Re:Only Caucasians tested by accessdeniednsp · · Score: 1

      Damnit! I'm *WHITE*, not "caucasian". I never have been to, nor am from, the land/province of "Caucasia".

      What the hell is wrong with this planet. My skin is pale, white, whatever. Call me a cracker, whatever. But damnit, don't call me "caucasian".

    7. Re:Only Caucasians tested by Anonymous Coward · · Score: 0

      You, madam, are an anti-negro

    8. Re:Only Caucasians tested by paulsgre · · Score: 5, Informative

      I agree that looking at other populations is crucial, but from what I can tell, they haven't even determined whether this is the gene actually responsible for the observed correlation.

      1. When looking at haplotypes, we see that genes travel together in chunks, and because someone has an alternate version of this gene, it could just mean that the haplotype is different. For example say the top 1/3 of chromosome #3 has 7 haplotypes. This means that when you look at populations from all over the world, you will see one of these 7 haplotypes, with 2-3 occuring in the vast majority of cases. On this haplotype there are multiple genes that travel together and recombine together so taht they stay "linked". The gene ACTUALLY affecting IQ could merely be closely linked in physical proximity to the gene they have identified. The genotypes observed in this study may just be markers for another as yet unidentified gene.

      2. The fact that it affects caucasian males vs females suggest it is sex-linked and other populations with the gene would be similarly affected. HOWEVER, it is entirely possible that the observed gene is an uncommon phenotype that has not drifted throughout the species and doesn't even exist in other races/populations.

      3. The gene in question codes for a growth factor receptor. Growth factor temporal expression dynamics are an interesting but complex subject, and the fact that they are looking only at 10 year olds presents another major problem. In brain development (or any development), decreased affinity for a ligand can alter the protein-binding curve such that more of the ligand (in this case the insulin-like growth factor) is needed to elicit the desired response, OR the ligand may fail to elicit the response because it "missed the train". There are different types of latencies across individuals, and increased developmental latency is a hallmark of the evolutionary nascent human brain, so it would not surprise me that there are many genetic variants of brain growth factors and receptors expressed during adolescence. Let's put it this way- there are two types of "malfunction"- A)you're supposed to meet up with your friends at 9 but you arrive at 10pm- your friends are pissed at you, but they waited for you, and the drunken revelry can continue as planned OR B) your flight was at 9pm, you missed it, too bad, do not pass go and do not collect 200 dollars.
      In the case of this growth factor receptor, we have no idea whether the gene variant causes malfunction, slower reaction, or complete inactivation, or even increased activation. I would not be surprised if the observed IQ differences leveled out over the next 5 years, especially considering the sex-hormone charged brain differentation that occurs during puberty.

      This article is pop fluff, and I would be wary of drawing any sort of conclusion from it.

    9. Re:Only Caucasians tested by linuxfanatic1024 · · Score: 1

      Now you might understand why deaf people hate being called "hearing impaired",

      why blind people hate being called "visually impaired",

      why some black people hate being called "African-American" (Not all dark-skinned people in this world came from Africa, nor are they always American.)

      "Political correctness" needs to stop. It offends people of all varieties by using big euphemisms where a simple word (deaf, blind, black, white) would be simpler (and more often preferred). It avoids directly mentioning an integral part of a person's being.

      --
      Microsoft-free since March 28, 2004
    10. Re:Only Caucasians tested by ozmanjusri · · Score: 1

      it makes you dumber.

      So you don't get to be a geek, but you can succeed in sport, politics and country music. You also get to enjoy sitcoms, reality tv and Fox news.

      Negative, huh?

      --
      "I've got more toys than Teruhisa Kitahara."
    11. Re:Only Caucasians tested by Darby · · Score: 1

      It said whiLe females... not whiTe females...

      Damn. Maybe prison can smarten this one up as well ;-)

      No offense brother (OP). Glad you're doing better.

    12. Re:Only Caucasians tested by ceoyoyo · · Score: 1

      Agreed, descriptions like "visually impaired" are pretty silly. Caucasian is sort of a middle term -- it's sort of scientific, but not really. A better word might be Caucasoid, a physical anthropology term. "White" is not scientific. Since this is a scientific article, describing a scientific procedure, use of scientific terms with actual definitions seems like a fairly good idea.

      The grandparent can call himself white if he wants to, and somebody else can be black, or asian, but physical anthropology (the best non-genetic description of populations likely to be related genetically) classifies you, the other guy and the other guy as being caucasoid, negroid and mongoloid, depending on various measures of your skull:

      These terms were not made up to be politically correct (although they may have been adopted by society for that use), but to describe populations that are believed to be related, prior to the availability of genetic classification.

    13. Re:Only Caucasians tested by Darby · · Score: 2, Funny

      I wonder how many other positive genes manifest only in males?

      The main one is technically called "The Power of the Pole"

      Use it wisely, my son.

    14. Re:Only Caucasians tested by syousef · · Score: 2, Funny

      No you don't understand. They put the population with the gene in with the women. All male IQs go down by the amount they observed when they're placed next to females. Females do this too but only for the males they find attractive. Trouble is most males find any female attractive.

      --
      These posts express my own personal views, not those of my employer
    15. Re:Only Caucasians tested by synaptic · · Score: 1

      This has to be one of the best replies I've ever read. Nice post.

    16. Re:Only Caucasians tested by Anonymous Coward · · Score: 0

      Of course, if you use the word caucasoid, you'll also have to use negroid and mongoloid which you may not be well received.

    17. Re:Only Caucasians tested by RoLi · · Score: 1

      When you do that, you have immedieately have protestors all around you that say how racist/biased/whatever your testing methods are, because we all know that we are all equal and any difference must be the fault of the testing methods.

    18. Re:Only Caucasians tested by larkost · · Score: 1

      The main one is technically called "The Power of the Pole"

      I believe that the power of the (strippers) pole rests mostly with the female of our species.

    19. Re:Only Caucasians tested by Viper+Daimao · · Score: 1

      Reminds me of a news broadcast about the riots in Paris trying to describe the rioters without calling them black. The broadcaster ended up calling them French African-Americans. It was pretty ridiculous.

      --
      "In the game of life, someone always has to lose. To me, if life were fair, that someone would always be Oklahoma." -DKR
    20. Re:Only Caucasians tested by Highrollr · · Score: 1

      paulsgre wins the thread! There is no need for any further posts. Which I guess would include thi

    21. Re:Only Caucasians tested by Anonymous Coward · · Score: 1, Informative
      "trying to describe the rioters without calling them black."

      The French call them bougnoules. It sounds like a kind of cake, to me.

    22. Re:Only Caucasians tested by ceoyoyo · · Score: 1

      For silly reasons, and only in the US. Just because some idiot (or some group of idiots) used a word in a disparaging manner at some point in history doesn't mean that it's insulting.

    23. Re:Only Caucasians tested by CFTM · · Score: 1

      If you look at the dispersion of human intelligence across a bell curve it becomes apparent that there exists six men to every one woman in the outer regions of the spectrum. In other words, there are more men geniuses but there are also more men who have intelligences that fall in to the retarded range. Strange how evolution works...

    24. Re:Only Caucasians tested by Darby · · Score: 1

      I believe that the power of the (strippers) pole rests mostly with the female of our species.

      Then you, my friend, need to learn to use it properly :-)

    25. Re:Only Caucasians tested by saforrest · · Score: 1

      It does seem to be a sex linked one, that like baldness, manifests only in males.

      "Sex-linked" refers to a gene on the X or Y chromosomes. In this case, since women can be carriers, it would have to be a gene on the X chromosome.

      I would think if it were sex-linked they would have just said so, since then it wouldn't be any great mystery why it mostly affects men.

      It's also worth noting that X-linked traits do *not* "only manifest" in males. They just manifest more often in males. If an X-linked gene occurs in the population with, say, 40% probability, then the chance of a baby boy expressing it is 0.40. On the other hand, the chance of a baby girl expressing it is 0.40 * 0.40 = 0.16, while the chance she gets it (and either expresses it or is a carrier) is 1-(1-0.40)*(1-0.40)=0.64.

      For a gene occurring with small probability, the square of that probability is really small, so there are quite few colour-blind females. But they do exist, and any sons they have are guaranteed to be colour blind.

    26. Re:Only Caucasians tested by drinkypoo · · Score: 1

      Don't be so proud of this sexual terror you've erected. The power to make a woman as big as a house is insignificant compared to the power of the pink side.

      --
      "You're right," Fisheye says. "I should have set it on 'whip' or 'chop.'"
    27. Re:Only Caucasians tested by Darby · · Score: 1

      ROFLMAO.

      Well played, Sir!

  5. Sample size? by Majik+Sheff · · Score: 5, Informative

    300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.

    --
    Women are like electronics: you don't know how damaged they are until you try to turn them on.
    1. Re:Sample size? by tomzyk · · Score: 2, Insightful
      Any variation in a sample that size is just signal noise.
      Normally, I'd agree... but in this situation (when talking about IQs), I think 20 points is a VERY significant amount.

      I would, however, be more interested in which counties these children were from. This could just be a difference in upbringing and education rather than genetic.
      --
      Karma: NaN
    2. Re:Sample size? by Daniel+Dvorkin · · Score: 1

      The necessary sample size is determined by the population parameters. 300 may or may not be a large enough sample; anyone know offhand what the population variance for IQ is?

      --
      The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
    3. Re:Sample size? by Monkey-Man2000 · · Score: 1

      It _would_ be interesting if this gene was correlated with the upbringing as you suggested. If your father had this gene you may be more likely to be in a poorer environment for reversing the effects this gene would have on your IQ. So, it could have a negative feedback response on you progreny which would accumulate over time. This might account for the significant difference between the two groups (the difference grew over generations). This might also account for why there was a wide variation in IQ of people that express the gene. Maybe a lot of the parents overcame whatever defiencies this gene would have on the lifestyle they could give their kids.

      --
      This post was generated by a Cadre of Uber Monkeys for Monkey-Man2000 (603495).
    4. Re:Sample size? by bcrowell · · Score: 4, Informative
      It's impossible to tell the signal-to-noise ratio from the info given in the article, because they don't say how frequent the gene is. If the gene has a 50% frequency, then the number of people with the gene in their study is 150, and the number without is 150. IQ is defined to have a mean of 100 and a standard deviation of 16. Averaging over a group of 150 people reduces the s.d. by a factor of 1/sqrt(150), to 1.3, in which case a 20-point difference between the two groups is extremely statistically significant. However, if the gene has a very high or very low frequency, then one of the two groups could be very small, in which case it might not be significant.

      They also don't say how they controlled for other variables. For instance, IQ is highly correlated with socioeconomic status, and if they didn't control for that, then that could explain the whole effect. E.g., black hair is negatively correlated with socioeconomic status in the U.S. (all those impoverished African-American and Latino people have black hair), so it's negatively correlated with IQ, but that doesn't mean that the gene for black hair also causes you to be stupid -- it just means that, for various reasons, IQ tests are biased against African-American and Latino people.

    5. Re:Sample size? by Majik+Sheff · · Score: 1

      Yes, 20 is significant as it stands; my concern for the integrity lies in the fact that the sample came from a very narrow demographic/geographic selection. I would be interested to see the same study done with say 8-15 year-olds. Perhaps a sample across ethnic backgrounds? Or maybe even a study that spans more than a few school districts and/or municipal water systems. What about adults with the gene variants? How many mensans have this variant? None? 20%? 1 Standard deviation?

      The problem with correlating desirable/undesireable traits to genetic roots is that historically the researchers had some form of agenda. Did the scientists avoid crossing ethnic backgrounds so that they would not have to deal with that slippery slope? No one likes being accused of being a racist/sexist/homophobe/etc..

      --
      Women are like electronics: you don't know how damaged they are until you try to turn them on.
    6. Re:Sample size? by draxbear · · Score: 1

      My class in 3rd form (age 13) were given an IQ test, but were allowed to leave once it was completed. Given the option of slogging through the test, or a head start on the rest of the school for the limited number of computers available during lunch, it's not hard to see which option the geeks in the class chose. It was a closed results test and it was anonymous so I've always wondered how skewed the results were...

      --
      --- I've completed diagnosis of your problem and can classify it as a YOYO...You're On Your Own
    7. Re:Sample size? by Puf_Almighty · · Score: 1, Informative

      It's a variation of 20 IQ points. Iq tests are normed to have a mean of 100 and a standard deviation of 15. That means that this difference signifies greater than one standard deviation of difference: even in a "small" sample (and precisely how much do you want for them to compare IQs over 160, and do gene arrays on them all?) that's freaking enormously significant.

    8. Re:Sample size? by Anonymous Coward · · Score: 0

      It's considered a basic part of the scientific method that you try to minimize possibilities of variables other than the ones being studied. Unwanted external variables affecting data is called confounding, and it could be a cause to reject any analysis of the obtained data.

      It seems the study in the article was just fine. The hypothesis is that a certain gene causes a statistically significant increase in IQ from those who lack it. Then, you minimize as many other factors as possible and gather as much data as possible within such a sample set. Then, you can clearly state that yes, there is a difference in IQ correlated with this gene for otherwise "identical" sample groups. Introducing a wide range of socioeconomic and ethnic variables will do nothing but make the data more difficult to interpret, as there are so many other factors that could be introduced, including differences in upbringing and possible differences in gene expression in certain ethnicities.

      While I personally strongly dislike "political correctness", that is one of the least likely reasons for the way the study was performed.

    9. Re:Sample size? by litclicker · · Score: 1

      IQ can be a hard thing to measure. Who's to say they aren't smart in other ways/applying themselves?

      --
      what if there were no hypothetical questions?
    10. Re:Sample size? by Lars83 · · Score: 1

      N=300? That's pretty large, actually. I'm sure the people who ran this study know a little bit about statistics and could accurately tell how large the difference needs to be in order to be significant.

      I know a little bit about statistics and IQ myself (I'm a psychologist)....and 20 IQ points is a difference of 1.33 standard deviations, which is a _huge_ difference.

    11. Re:Sample size? by Anonymous Coward · · Score: 0

      IQ is easy to measure.

      What's hard is intelligence.

    12. Re:Sample size? by Anonymous Coward · · Score: 0

      "300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise."

      You can't just say that. It depends on the standard deviation of the IQ distribution (IIRC, it is 10 points) and the fraction of the sample which has this gene.

      If 50% have the gene, and if IQ has a Gaussian distribution, then I guarantee that a sample of 300 is more than enough -- statistically speaking -- to test the described hypothesis at better than 0.95 CL.

      "The genetic->IQ link has always been a contentious subject... This is only fuel for the fire."

      You are completely wrong about this. PKU is a genetic condition. Until the 1960s, PKU almost always led to mild-to-severe mental retardation. This was a real and well-established link.

      After much research, the heel-prick test for PKU was developed. Because of this good and reliable test, it is possible for people with PKU to maintain a special diet and lead a normal life.

      That is just one example of why this kind of study is so important. There may be dozens more as-yet unknown genetic conditions which have subtler bad effects, but which are completely treatable. If people who are prejudiced against genetic research succeed in shutting these kind of studies down, who knows what the ultimate cost to humanity will be?

    13. Re:Sample size? by TastyCakes · · Score: 1

      "The genetic->IQ link has always been a contentious subject... This is only fuel for the fire."

      That IQ is controlled by genetics doesn't seem very contentious to me.. Why else would there be siblings with vastly different IQs? They have the same environment etc. I believe studies of identical twins seperated at birth support this as well. ie even ones raised in vastly different backgrounds have similar iqs. Can you give examples of how a genetic base for iq is contentious?

    14. Re:Sample size? by caenorhabditas · · Score: 1

      It's not contentious in that "Everyone thinks it's impossible to be correct", it's contentious in the sense of "There's not been much evidence (until now, if that study proves accurate) of it in the past, and foolish people tend to use information like this in exactly the wrong ways." Frankly, the idea that intelligence is genetic is evident if you believe that we are smarter than chimps and know anything about evolution. If genes that make (almost) all humans smarter than chimps exist, why couldn't there be genes that make some humans smarter than others?

    15. Re:Sample size? by AnotherDaveB · · Score: 1

      The Economist recently reported a University of Utah study that suggested Ashkenazi Jews as an ethinic/genetic group have a similar gene.

    16. Re:Sample size? by ceoyoyo · · Score: 1

      I expect they used very stringent criteria to try to eliminate possible confounding effects. For example, if they had included people from a rural area and an urban area, and randomization ended up putting more urban people in one group than the other, the difference between going to school in Kansas and New York might reasonably be expected to affect the results. That's why mouse studies use mice that are identical except for the gene in question. It's considered unethical to breed pure strains of people, so you have to settle for picking white ten year olds from a particular school/couny/city/region.

    17. Re:Sample size? by Darby · · Score: 1

      my concern for the integrity lies in the fact that the sample came from a very narrow demographic/geographic selection.
      Totally reasonable concern.

      I would be interested to see the same study done with...8-15 year-olds...across ethnic backgrounds...spans more than a few school districts and/or municipal water systems...

      Well, do you really think that that won't happen once *a* target gene has been identified?

      Did the scientists avoid crossing ethnic backgrounds so that they would not have to deal with that slippery slope?

      I'd imagine based on your earlier questions that it was more a question of isolation. Once you have something to look at with an isolated number of variables, doesn't it make more sense to get those findings before moving on to ....say....the whole diversity of humanity?

      Seriously, they aren't hawking a pill yet. IANAGenetecist, but if there's anything to this particular study that will happen.

    18. Re:Sample size? by Anonymous Coward · · Score: 0

      The genetic->IQ link has always been a contentious subject...

      Only by people with a retard gene. If you accept that humans are more intelligent than moss then you accept that intelligence is affected by genetics. Once you've accepted that, variation by mutation is inevitable.

    19. Re:Sample size? by Jackmn · · Score: 1
      That IQ is controlled by genetics doesn't seem very contentious to me.
      Consider that the only thing responsible for the difference between brains formed in humans and brains formed in cows is genetics.

      Upbringing certainly has a large effect too, of course.
    20. Re:Sample size? by Thomas+Miconi · · Score: 1

      300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.

      The study does not seem to mention whether social factors were taken into account.

      I live in a quarter which is inhabited both by locals (who are rather poor and have a low level of education) and students (who are usually well-off and often come from various parts of the world). If you uperformed the same kind of study here, you would definitely see a dichotomy between a "high IQ" and a "low IQ" class. You would also certainly find that the "lower IQ" class seems to be correlated with genes that identify the local population. Which is exactly the kind of results that this study found.

      Anyway the journalist's spin on this is ridiculous (" a significant step toward understanding the genetic basis for intelligence.") This is not a "clever gene", this is a "dunce gene", a genetic variation which seems to make people dumber (if causal links are ever demonstrated). Everybody knows that certain genetic defects can have a severe impact on intelligence. The question of a comprehensive genetic basis for intelligence is orthogonal to this.

      Thomas-

    21. Re:Sample size? by DarkSarin · · Score: 0

      um, no?

      300 is a respectable sample size. Before you can even make a statement about variation being "just signal noise" you need to know a lot more, first of which is the amount of variation. If we were talking about a correlation of .01 or even .09, I would agree with you, but if this is a correlation of .3 or .5, then I am disinclined to agree.

      I will agree with you on one thing: the genetic->IQ link is extremely contentious, and is probably best left alone.

      As someone said, the standard deviation is either 15 or 16 (depending on the scale), but this is (IIRC) normed on a regular basis, so scores from 20 years ago are not necessarily comparable to scores today (if you use the current version of any particular scale).

      Additionally there are definable group differences on these scales, and more than a little contention about the nature of intelligence. Is intelligence best measured by knowledge, if so, which knowledge? Is it best measured by a scale, an acitivity or something else? Can it be measured? Is there more than one type of intelligence? Is factor analysis appropriate in determining the number of intelligences? Is it appropriate to combine all subfactors into a single score (g or IQ)? These are the questions that plague researchers and psychometricians. What makes it worse is that intelligence tests show group differences (blacks scoring lower than whites, females lower than males, and finally, Asians higher than whites), but the within group variance is typically greater than the between group variance, eg. men have (example only) an average IQ of 110, women an average IQ of 105 (.33 std deviation), but the standard deviation for both groups is 15. In a sample large enough, this means that the difference between men and women will be statistically 'significant'*, but practically meaningless (although my numbers are made up, the truth is very similar to this!). This is the same for blacks v. whites etc.

      In this case of have and have-not for this gene, the difference is greater than 1 standard deviation, but that doesn't make it practically useful. The question of environment is still present (eg, are there environmental factors that make development or manifestation of this gene more likely?), and frankly, genetic links to intelligence are going to be worthless until we can settle on a definition of intelligence that works. Frankly, I am opposed to the concept of generalized intelligence. It doesn't seem to work--I know far to many folks that are extremely gifted mechanically, but can't do anything creative. Or the guy who can work wonders with a computer and is a wonderful programmer but can't make beans of a social situation (none of those around here are there?). These are all different areas of intelligence that are available, and seem to operate independently, but when you try to combine them, then you get into trouble (take a factor-analysis or psychometrics course if you want a long explanation).

      The short of it all is this: yes they found something, but what? If this gene would make you overall smarter, then you would think that it would be present in everyone, since for humans being smarter typically makes you more likely to live longer.

      FWIW, I am in psychology, and working on my PhD. I have some minor qualifications to talk about this subject. I don't feel like quoting every relevant peice of research. If you want some reading, see Stephen Jay Gould's 'The Mismeasure of Man', it will delineate the debate quite well.

      *statistical significance is a hotbed of trouble in itself. See Cohen & Cohen's work on the matter or just Cohen's "The earth is round, p.05'--these folks make cogent arguments about why statistical significance is not the end all, be all of scientific research. It shouldn't be ignored, but using meaningful alpha levels is very important.

      --
      "We don't know what we are doing, but we are doing it very carefully,..." Wherry, R.J. Personnel Psychology (1995)
    22. Re:Sample size? by Anonymous Coward · · Score: 0

      Everything else you said sounds reasonable, and to be honest I lack the training to judge it. But I find this statement particularly disturbing coming from a self-professed PhD student in psychology.

      "I will agree with you on one thing: the genetic->IQ link is extremely contentious, and is probably best left alone."

      Are you actually claiming that it isn't worth studying the genetic biological of intelligence? Or maybe we should study that but pretend that genetics doesn't exist? That somehow we can really advance our knowledge about the human mind while ignoring enormous topics of research because we are afraid of what we might find?

    23. Re:Sample size? by Hognoxious · · Score: 2, Insightful
      it just means that, for various reasons, IQ tests are biased against African-American and Latino people.
      Total non sequitur. It may in fact be the case that they are less intelligent (or just less "test-smart") than whites. Heck, they just might not be interested or motivated.

      Asians usually have black hair, too. Remind me, how do they generally score on standardised tests?

      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
    24. Re:Sample size? by alnjmshntr · · Score: 1

      This could just be a difference in upbringing and education rather than genetic.

      I'm not sure that would tell you anything... Maybe smarter children are educated and bought up better because their parents are smarter. So is their intelligence due to genes or upbringing?

      --
      If I had created the world I wouldn't have messed about with butterflies and daffodils. I would have started with lasers
    25. Re:Sample size? by DarkSarin · · Score: 0

      I wasn't going to reply, but I thought about it a bit and decided to despite my best judgment.

      I was not saying that we shouldn't study it, or that the field wasn't worth studying.

      If you read on, you'll note that I say that intelligence itself is not well understood or even well defined as a psychological construct. This is what makes it dangerous to study genetic links to IQ--we don't really know what we are doing with this.

      Let me be clear: until we have agreed on the full structure of intelligence it is best to leave alone genetic links to some arbitrarilly (sp?) selected measure of a construct under debate. It's somewhat like trying to find a scientific proof that God exists--you have to first define God before you can begin the search, and we are far from a unified definition of God (I say this as a Christian who has a fairly different view of deity than is accepted by the mainstream).

      There is a fundamental problem with the concept of correlating a construct that is undefined with anything else--you can't definitively state what you've provided evidence for!

      So I stand by this: until IQ (ick, what a nasty term) is better defined or outright rejected, genetic links with IQ are best left alone. I will say that if you want to find a genetic link with mathematical ability, then you have a metric that I am comfortable with.

      The real problem is that generalized intelligence (g or IQ) is taking things like mathematical ability, verbal ability, and spatial reasoning and combining them into a single score. This is a lossy compression technique (to use IT terminology) that may actually be more like combining a jpeg with a mp3 and calling the result a Movie or Film. Even that is being generous, but you get the idea: IQ is so general and so big that there is doubt that it even exists!

      That said, I know what laymen terms are; we all agree that some people are smarter than others--but does this mean in every area? Think about it like this: if a person is a musical genius (Beethoven level), would that make them any good at math? programming? engineering? art? tactics? literature? or anything else?

      If so, then you have an argument for g (or IQ), but otherwise you have to wonder about the concept. What is the correlation between mathematical ability and musical ability? Both can be trained (which by the way, introduces huge problems into the concept that intelligence is innate), but there is probably some degree of innate ability (and a related question is: how do you measure which is trianed and which is innate? This is important, since access to better education might account for many of the gender and racial breaks in intelligence scores.)

      There is a reason this link is contentious--it has been (rightly or not) linked to racism and other political hotbeds. Beyond that link is the very simple value judgment that smarter people are more valuable and desirable than less smart folks. I don't think it is true, but how many of us would like to see people we think are dumb removed from the gene pool (do you laugh about the Darwin Awards)? I don't have answers, but until there is a unified framework that is widely accepted for dealing with intelligence that is able to get around these problems, it is wise to tread cautiously.

      As a scientific community, we've gotten around the nature/nurture debate (the media may not have caught up, but most scientists know the answer) concerning personality, intelligence, etc. (hint the answer is BOTH), although there is still a matter of degree.

      Hope that helps clarify things a bit.

      --
      "We don't know what we are doing, but we are doing it very carefully,..." Wherry, R.J. Personnel Psychology (1995)
  6. Gattaca by mrchaotica · · Score: 3, Funny

    So, now where can I get a genetic evaluation for my girlfriend and I, so we know if we'd risk passing this gene on to our children? Or, alternatively, when will we be able to genetically engineer them not to have it?

    --

    "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    1. Re:Gattaca by Anonymous Coward · · Score: 1, Funny

      It's doubtful that she'd have it. You may want to check the side of the box she came in, though. Just to be sure.

    2. Re:Gattaca by PromptZero · · Score: 1
      So, now where can I get a genetic evaluation for my girlfriend and I, so we know if we'd risk passing this gene on to our children? Or, alternatively, when will we be able to genetically engineer them not to have it?

      If genetic group A on average were shown to be generally more intelligent than genetic group B, I don't think this would have huge negative side effects. The problem is that people go from populations to specific instances without a decent grasp of probability.

      For example, light eyed people generally have worse reflexes than darker-eyed people. No baseball recruiter bases their picks on eye-color, they base it on the player's statistics, since it's already factored in. In the same way, if a person from the group with the average lower intelligence got a higher SAT score, higher grades, etc. than someone from the group with "better" genetic intelligence background, the person with the higher scores/grades should to be admitted to college/given the job/etc, just as in the baseball example (note that this decision only depends, like the baseball example, on the desire of the institution to be better, not because of a gov't program or equality concerns).

      Just because a group on average happens to be better than another group, it says nothing determinate about any one member of either group. The group with the lower average intelligence may even have the smartest person as a member and the group with the higher average may the twenty dimmest.

      The only reason a study like this would make a difference this would make is that from a population standpoint, people from one genetic group may have different jobs/salaries/etc than people from another genetic group. While this is trivially true right now, I don't think genetics is necessarily the explaination (or even part thereof). Probably heavily cultural. But how can we know if we don't study it?

      If I say black people are generally taller than Chinese people, that's pretty non-controversial, but any other tests, people are likely to blame the ruler I'm using.

    3. Re:Gattaca by Anonymous Coward · · Score: 0

      for my girlfriend and I

      You mean for my girlfriend and myself.

      You're welcome.

    4. Re:Gattaca by Anonymous Coward · · Score: 0

      Actually, no. It's "... for me and my girlfriend." Since you asked.

    5. Re:Gattaca by dogwelder99 · · Score: 5, Funny

      Well, I already know I don't have the dumbness gene, because my IQ isn't 20 points lower than it is. Or something.

    6. Re:Gattaca by mrchaotica · · Score: 1

      The article only says that females don't seem to be affected by the gene. It doesn't say anything about them not having it and being able to pass it on to male children.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    7. Re:Gattaca by mrchaotica · · Score: 1

      Yeah, but I'm not trying to measure performance after the fact, I'm trying to optimize the conditions beforehand. A better analogy would be, say, somebody taking a test. Sure, someone who didn't study might get a higher score than someone who did, but that doesn't mean the studying was useless! Similarly, just having the gene doesn't necessarily mean my kid would be stupid, but since it does (if the study is true) indicate that it's more likely, I'd be an idiot to choose to let my children inherit it.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    8. Re:Gattaca by mildgift · · Score: 1

      There was some unnatural selection that made Black people in America taller on average.

    9. Re:Gattaca by penguinoid · · Score: 1

      It's a gene for intelligence. You don't risk passing it on. (With emphasis on either "you" or "risk":-) Hey don't blame me this is Slashdot.

      --
      Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
    10. Re:Gattaca by 19thNervousBreakdown · · Score: 2, Funny

      Don't worry. Whether you blow her up or not, one of the two of you definitely has the gene.

      --
      <xml><I><am><so><damn>Web 2.0</damn></so></am></I></xml>
    11. Re:Gattaca by cheesygrapes · · Score: 1

      Obviously, you've never seen the movie.

    12. Re:Gattaca by koreaman · · Score: 1

      No offense, but are you autistic or something?

      It was a joke.

    13. Re:Gattaca by Excen · · Score: 1

      So, now where can I get a genetic evaluation for my girlfriend and I
       
        YOU HAVE A GIRLFRIEND?!?!?!?!?

      --
      "No beer until you finish your tequila!" -Leela's Dad
    14. Re:Gattaca by Anonymous Coward · · Score: -1, Flamebait

      You obviously haven't been to Sudan lately...

      Stop being a victim of blacks crying victimisation about something that took place 3-400 years ago.

    15. Re:Gattaca by lordofthechia · · Score: 1

      "risk passing this gene on to our children?"

      Just make sure you have a bomb surgically implanted in the child at an early age. That way if they turn out to be freakishly smart you can destroy them with a push of a button before they do any real harm.

      --
      Georgia Tech, the leader in Chia(tm) technology.
    16. Re:Gattaca by Anonymous Coward · · Score: 0

      And it is "my girlfriend and me" if you follow the general rule of listing yourself last in a group. I don't know if there's really any point to that, but it is linguistic tradition.

    17. Re:Gattaca by mrchaotica · · Score: 1

      No, but my girlfriend is (slightly) -- which is part of why I'm concerned about this soft of thing. My particular malfunction is ADD, so either our kids will be incredibly smart (from me) and talented (from her), or completely unable to function -- I just wish I knew which. : /

      And yes, I got the joke -- about 3 seconds after I hit "submit." I just figured admitting that it flew straight over my head would only make it worse. I usually notice those things; I blame my tiredness.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    18. Re:Gattaca by mrchaotica · · Score: 1

      Hey, it surprised me too, and in fact our first meeting was by random chance: there were only two free seats on the school bus, one next to each of two girls. I picked the prettier one. And to compound the improbability of it, she's actually turned on by nerds -- she had a crush on me for the year before that, just because she saw me playing with my calculator on the bus!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    19. Re:Gattaca by Hognoxious · · Score: 1

      Since when has being a fidgetting scatterbrain who can't concentrate been equal to smart?

      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
    20. Re:Gattaca by Anonymous Coward · · Score: 0

      I think her mother might resist that type of examination...

    21. Re:Gattaca by mrchaotica · · Score: 1

      It isn't, but I am smart as well as a fidgeting scatterbrain who can't concentrate (also, being autistic doesn't necessarily imply talent, but my girlfriend is indeed talented).

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    22. Re:Gattaca by msouth · · Score: 1
      ...where can I get a genetic evaluation for my girlfriend and I...


      you're posting on slashdot, so you might want to write "girlfriend" as "putative girlfriend" or "future girlfriend". Otherwise you could get modded down for overactive imagination, etc.

      --
      Liberty uber alles.
    23. Re:Gattaca by Hognoxious · · Score: 1
      Let me remind you what you wrote (you've probably forgotten, or can't be arsed to reread it):
      My particular malfunction is ADD, so either our kids will be incredibly smart (from me)
      Just for the record, so is used to imply a causal relationship.
      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
  7. Genes (sp?) Jeans. by WeeLad · · Score: 0, Offtopic

    Women have always told me that my brain is in my Jeans.

    --
    Seriously, Don't take anything I say seriously.
  8. dur dur dur by UprlghtCitizen · · Score: -1, Flamebait

    Ey WuNDer EEF MB eY HavE tEH GENE Whart du U gUyS tiNK?

  9. maybe... by rd4tech · · Score: 2, Funny

    Maybe they have actually found the male-dumbness gene?

    1. Re:maybe... by dogwelder99 · · Score: 2, Funny

      It was found long ago... males drop 20 IQ points on average in the presence of an XX-chromosome genotype.

    2. Re:maybe... by xenoandroid · · Score: 1

      That is only true for dickheads like yourself who feel the need to make lame jokes based upon a generalization of the male gender.

    3. Re:maybe... by jamesh · · Score: 1

      The thing is, it's funny because it is based on a generalisation. It's also funny because it cleverly ties in some of the themes of the article and the current thread in a way that probably hadn't occured to most people (or at least, it hadn't for me)

      I would score the joke a 7 out of 10, well above the lameness threshold.

    4. Re:maybe... by 19thNervousBreakdown · · Score: 1

      He's saying that men act dumb around women, just replace dumb with -20IQ and women with XX.

      Maybe you just haven't been around... humans... much, but both that joke has been around since they painted "For Better or for Worse" on cave walls.

      --
      <xml><I><am><so><damn>Web 2.0</damn></so></am></I></xml>
    5. Re:maybe... by Mo6eB · · Score: 0

      It was found long ago, only it isn't a gene, but an enzyme and it is called "testosterone".

      All studies agree that this particular enzyme leads to baldness, long facial hair and a tendency to behave like a 5-year old at the age of 40 - a clear sign of mental regression, induced by the aforementioned enzyme.

      For comparison, females, which do not have "testosterone", do not go bald, have facial hair or behave like 5-year-olds at the age of 40. They do, however, show signs of other mental illnesses, like excessive shopping, affinity for strange fluffy objects and the practically unexplained desire to have kids. Also, members of the species between the ages of 13 to 45 go postal once a month, after which they go into deep depression before returning back to normal. All of those seem to follow directly from the "estrogene" enzyme.

      So far nobody has been able to find a human, who has neither "testosterone" nor "estrogene" and researchers believe that this will most probably be the next stage in our evolution.

    6. Re:maybe... by xenoandroid · · Score: 1

      I score any "Male = penor brain" joke 0/10 because it's down right lame, overused, immature, and only helps to perpetuate a damaging stereotype for those many people who aren't able to tell if it's a joke or not. False generalizations are stupid, not funny. And I seriously can't believe you'd call this clever, what are you 12?

    7. Re:maybe... by tau-lepton · · Score: 1

      No, he's ten and lives in Ohio .... Dumb Ass (Red Foreman)

    8. Re:maybe... by Anonymous Coward · · Score: 0

      Hmmm... The way I understood it: When men have the XX genotype (when they are women), they are dumb. Or more to the point: women are dumber than men.

    9. Re:maybe... by Hognoxious · · Score: 1
      So far nobody has been able to find a human, who has neither "testosterone" nor "estrogene"
      Really? I suppose this guy is a fictional character.
      and researchers believe that this will most probably be the next stage in our evolution
      Such an "improvement" would tend to take itself out of the gene pool pretty fast, actually. Oh, and most researchers believe that it's spelled "(o)estrogen".
      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
    10. Re:maybe... by Busy · · Score: 1

      Me too, but after reading it again I don't think that's what was meant. Personally, I like our version better.

      --
      Think of someone with average intelligence. Now think 1/2 the world is dumber than that guy.
  10. hmm.... by Anonymous Coward · · Score: 0

    Bullshit

  11. Suggestive, but not yet science. by Anonymous Coward · · Score: 0

    According to TFA, this research has yet to be peer reviewed or reproduced. We may want to wait a bit before getting too excited.

  12. Housekeeping... by Chemical+Serenity · · Score: 4, Insightful

    "...didn't being marked at 20 approximately 20 points."

    Maybe I have that gene, 'cuz I can't figure out what you're trying to say there... ;)

    --
    "People will pay big bucks for the luxury of ignorance."
    1. Re:Housekeeping... by Ruff_ilb · · Score: 1

      Me neither. Hey, look, we've got two people. That's statistically significant, right?

      --
      http://www.TheGamerNation.com/Forums
    2. Re:Housekeeping... by strider44 · · Score: 1, Informative

      The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20 approximately 20 points.

      I think that is actually gramatically correct, but missing a couple of commas or brackets to make things more readable:

      The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being, marked at 20, approximately 20 points.

    3. Re:Housekeeping... by Anonymous Coward · · Score: 0

      The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being, marked at 20, approximately 20 points.

      You're wrong, its acutally a mathmatical formula:

      The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20^(approximately 20) points.

    4. Re:Housekeeping... by headkase · · Score: 1

      It's a sad state of affairs when the editors don't either fix it or ask the author to fix it.
      Where's a <sic> when it needs one?

      --
      Shh.
    5. Re:Housekeeping... by Anonymous Coward · · Score: 0

      hmm... for all intent and purpose, the punctuation marks are essential part of grammar. So you cannot have "gramatically correct" sentence when you have missing commas or brackets that render the whole thing unintelligible.

    6. Re:Housekeeping... by kureido · · Score: 2, Funny

      "...didn't being marked at 20 approximately 20 points."

      He's obviously speaking Foghorn Leghorn-ese. Think of it instead as "being marked at 20 I say 20 points" and it makes a lot more sense.

    7. Re:Housekeeping... by Chemical+Serenity · · Score: 1

      lol

      "Now look I say lookee here, son... there be 20 I say 20 points a markin', y'hear?

      Nice kid, but about as sharp as a sack I say a sack of bowling balls..."

      --
      "People will pay big bucks for the luxury of ignorance."
    8. Re:Housekeeping... by pete-classic · · Score: 1

      Any text embedded in a quotation, but not part of the quotation, should be set off by square brackets as: [sic].

      -Peter

    9. Re:Housekeeping... by headkase · · Score: 1

      :)
      My bad.

      --
      Shh.
  13. It's obvious by imcclell · · Score: 0

    These gentlemen do not have this gene. The results of this prove nothing. It's impossible to do a study like this without a scientific baseline, and due to the fact that IQ is not a standard, you have no such evidence.

    Guys it's back to the drawing board.

  14. Amazingly enough.... by Anonymous Coward · · Score: -1, Troll

    The researchers apparently didn't find any instance of the gene among Slashdot editors.

    The Bush administration claims to have found the gene among members of the cabinet, but when investigated, no traces were found.

    The gene was first observed by in 1894.

  15. IQ tests are severly flawed by Dr.+Eggman · · Score: 3, Insightful

    IQ tests are too unreliable for identifying gene that contribute to intelligence. They are far from standardized for all people/genders and until then its really not possible to definitivly say just how any gene affects intelligence short of extremely major differences, such as those found in cases of genetic disorders. Even then, determining the exact gene (if it even is just one) is very difficult. If only we could agree on a perfect definition of intelligence first, then maybe we could come up with a better way to measure it.

    --
    Demented But Determined.
    1. Re:IQ tests are severly flawed by Anonymous Coward · · Score: 0

      Well, presume that IQ tests have biases for certain sorts of intelligences and learning styles. Even if they're not complete tests of "intelligence", they can still be considered tests of aptitude or intelligence of a specific logical type or whatnot... they measure something in their present state, we just sorta need to define what that is and how it relates to the universe around it.

    2. Re:IQ tests are severly flawed by andy+jenkins · · Score: 1

      Are you playing the "But IQ tests are flawed card!" or do you actually know what you are talking about?

      I don't know what I'm talking about, and I also know that comparing my IQ to my academically similar girlfriend is not particularly useful (unless she wins, of course.)

      But this is a significant difference of 20 points, over a decent population, run be people who do know what they are talking about.

    3. Re:IQ tests are severly flawed by i_should_be_working · · Score: 1

      The main problem is that that 20 points is an average. As TF summary said people with or without the gene show a wide range of IQs with significant overlap. So even though the average of the two groups may be significantly different, the distribution is probably so wide that trying to predict whether an individual with the gene is smarter than average is just a guess.
       
      I don't think this is just a problem with this study. Every study I've ever seen comparing the IQs of two different groups and claiming a difference only showed a difference of a small fraction of the standard deviation. Making predictions of an individual's intelligence based on their group impossible. I think some of that broadness of the distributions has it's root in some of the parent post's complaints about IQ tests. Too unreliable, and not standardized.

    4. Re:IQ tests are severly flawed by Anonymous Coward · · Score: 0

      If an IQ test isn't "standardized" for all people, that's another way of saying it's a poor measure of 'g', or simply a bad IQ test. But there are several completely nonverbal intelligence tests (Raven's Progressive Matrices for example) which are quite abstract and do not rely on any preprogrammed cultural knowledge. They are administered in different countries across the world and have been shown to have a good correlation with g. I think your argument is based more on a kneejerk rejection of a genetic basis for intelligence rather than a real evaluation of the current state of the art.

    5. Re:IQ tests are severly flawed by marko123 · · Score: 1

      That's just what dumb people with low IQ scores and lots of stupid genes say ;)

      --
      http://pcblues.com - Digits and Wood
    6. Re:IQ tests are severly flawed by SoupIsGoodFood_42 · · Score: 2, Insightful

      Everyone knows that IQ tests don't tests all types of intelligence, but I don't see how that makes these test results meaningless. Perhaps this gene is of benifit to males with other types of intelligence?

    7. Re:IQ tests are severly flawed by blofeld42 · · Score: 2, Informative

      The IQ tests aren't being used to identify the gene. The process is to administer the test, and then run a medical test to determine what genes are present. And the genetic tests run on the subjects are quite relaible. Once both tasks are done they simply correlate the IQ scores to the genes.

      IQ tests are fine predictors of performance in many areas--people who score well on IQ tests tend to have much better performance at many real world tasks.

      20 points is a huge difference. That's approximately the IQ gap between college graduates and non-college graduates in the US. It's more than one standard deviation in the IQ distribution.

    8. Re:IQ tests are severly flawed by Lars83 · · Score: 2, Informative

      IQ tests are _extremely_ reliable. The article doesn't mention which IQ test was administered, but if it was the Wechsler Intelligence Scale for Children (WISC) or the Stanford-Binet, those tests have fantastic psychometrics. Their reliability coefficients are in the .8 to .9 range, which is really, really good. These tests are in constant revision in order to maintain this superb reliability. I've read the technical manuals for both of these tests...you'd be hard-pressed to design a more reliable one.

    9. Re:IQ tests are severly flawed by duffahtolla · · Score: 2, Informative
      IQ tests are too unreliable for identifying gene that contribute to intelligence.

      Yes, yes.. That's very PC and all, but it looks like THAT gene does play a significant role.

      From here

      Jirtle said his assertion that the IGF2R gene affects IQ is bolstered by experiments in mice. When he and his colleagues disabled a copy of the gene in lab mice - an experiment intended to mimic humans who inherit the variant copy of the gene - they noticed that the male mice were slow learners on a maze test. Electrical recordings of the mice's brain tissue were also altered in a way that is consistent with slow learning.

    10. Re:IQ tests are severly flawed by deli_llama · · Score: 2, Interesting
      If only we could agree on a perfect definition of intelligence first, then maybe we could come up with a better way to measure it.

      Ah, there's the rub.

      The problem with testing for intelligence is that we're really not quite certain what we're looking for. Spatial reasoning? Problem solving? Mathematical calculations? Reading comprehension?

      It's nearly impossible to test "smarts" in any consistent way because of the varied background and education of each individual. Worst-case scenario, you actually end up testing a person's memory.

      Take my family for instance. I'm a 145... which seems high enough, you'd think. My oldest sister scored a 175 and wasn't really taking the test that seriously (which is just as well, since scores in that range are wildly inaccurate anyway). Everyone else in the family is somewhere in between; I, with my "genius" IQ, am actually the slowest of the bunch. The net result is that none of us really put much stock in IQ tests.

      My sister is definately a genius by any definition. She's a master of all disciplines: an artist, physicist, linguist, mathematician, writer, everything. Not only can she compete in every field, she excels. She, with less to work with than the average McGuyver setup, could conquer the world in an hour.

      She was followed by a brother with similar capacity and opportunity. The two of them made being smart not only cool, but reachable for the rest of us. The opportunity for learning for the rest of us was immense. Every curiousity could be satisfied, and even the most complicated concepts can be taught if you have a highly-capable teacher.

      So now, while I don't personally think I measure up to the mental level of all the great minds of our day, all the "intelligence" tests I take tell me that I do. Compared to a history exam, IQ tests seem easy--like I'd studied for it. In a sense, I guess, I have. I have an uncommonly strong educational background that gives me a noticable edge.

      So what does that mean? Are IQ tests really worthless? If you could create an IQ test for which the results weren't affected by prior education, would it be useful? Would the results be different?

    11. Re:IQ tests are severly flawed by trout0mask · · Score: 2, Insightful

      This post seems totally off base.
      1. The relevant part of the study was done on caucasian males. Even if IQ tests aren't standardized across race and gender, then, that issue is irrelevant.
      2. Determining the exact gene may be very difficult. So what? That doesn't mean researchers can't do it. In this case, they did. Or more precisely, they found a rough but significant estimate for the effects of a specific gene on IQ.
      3. The meaning of IQ in this sense, as even the inventor of IQ tests said, is really just "what IQ tests measure". So they are accurate by definition. It is definitely valid, though, to argue whether that sense of IQ is a useful one. Or the best one, which it almost definitely isn't.

    12. Re:IQ tests are severly flawed by timeOday · · Score: 1
      Criticism of IQ testing is almost irrelevant. Any genetic marker that can predict significant variation in a paper and pencil test is pretty amazing!

      The practical value, I'm not quite sure. It's easier and cheaper to administer a paper and pencil test than a genetic test anyways. Unless of course you don't want somebody to know they're being tested...

    13. Re:IQ tests are severly flawed by ceoyoyo · · Score: 1

      You are correct -- to evaluate the study we need to know the p-value for their results. I've never actually seen one quoted in the popular press though, so its absence doesn't mean that the study is flawed. However, if they hope to get this study published in a peer reviewed journal they're going to need that p-value, and it's going to have to be less than 0.05, meaning that the distributions are sufficiently narrow and sufficiently separated that you can be confident (95% of the time) that your results are showing an actual difference.

    14. Re:IQ tests are severly flawed by Zoyd · · Score: 1

      trout0mask wrote: 3. The meaning of IQ in this sense, as even the inventor of IQ tests said, is really just "what IQ tests measure".

      Edwin G. Boring did not invent the IQ test.

      http://groups.google.com/group/rec.org.mensa/brows e_frm/thread/f601ef89c1b46761/3ce8b211af42a62d?lnk =st&q=%22what+the+tests+test%22+boring&rnum=1&hl=e n#3ce8b211af42a62d

    15. Re:IQ tests are severly flawed by Woldry · · Score: 1

      Okay, here's an example (me).

      On the nonverbal tests you mention, I test significantly lower (~125) than on the ones geared specifically to test verbal IQ (~165). The ones not designed to filter in or out verbal skills I test in the 140 range (depending on the specific test). On the SAT (which, when I took it in the late 1970's, lined up fairly well with IQ test results) I got 1330, which translates roughly to a 133 IQ. On tests of structural visualization, I test at just marginally higher than average; one friend pointed out that I use other mental gymnastics to come up with the answers for structural visualization questions without actually visualizing structures, so I suspect that my score on such tests should be even lower than average.

      So which one do I say is "my" IQ?

      All of my results are significantly above average, but none of them agree with each other, and the differences are huge. I can believe that I'm atypical in showing a 40 point variation among differently designed tests, but I can't imagine that I'm atypical in showing a significant variation at all.

      While I agree that IQ tests measure something, and that they roughly correlate with subjective impressions of intelligence and with academic success, the design of the test can make a huge difference.

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    16. Re:IQ tests are severly flawed by Zoyd · · Score: 1

      Woldry wrote: On the SAT (which, when I took it in the late 1970's, lined up fairly well with IQ test results) I got 1330, which translates roughly to a 133 IQ.

      137.78 Wechsler IQ. 140.29 Stanford-Binet IQ.

      http://members.shaw.ca/delajara/oldSATIQ.html

    17. Re:IQ tests are severly flawed by Woldry · · Score: 1

      Nifty! Thanks. I had only a vague memory of "it's slightly higher than 1/10 of SAT" to go on. Evidently the "slightly higher" was slightly higher than I remembered. Now if only I can be bothered to remember these figures for future reference ...

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    18. Re:IQ tests are severly flawed by Zoyd · · Score: 1

      You're welcome, but you should be made aware that that conversion table is simply the result of a simplistic formula that Rodrigo de la Jara came up with by comparing the SAT scores accepted as minimal requirements for various high-IQ societies with the actual IQ scores those societies accept as minimum.

    19. Re:IQ tests are severly flawed by Anonymous Coward · · Score: 0

      IQ testing in general has some really major flaws. For example, your IQ is supposed to be fixed, but practicing IQ tests will lead to an increase in your ability to score well on the tests. It's all about practice.

      Lots of people have pointed out the cultural problems with IQ testing so I'll leave that out.

      It's also worth noting that IQ tests are basically a bad spin off of Binet's tests. These tests were not meant for finding intelligence, mearly finding children who needed extra attention in their education.

      IQ tests also leave out a huge range of factors that can contribute to a persons intelligence.

    20. Re:IQ tests are severly flawed by Zoyd · · Score: 1

      Woldry wrote: On [...] nonverbal tests [...] I test significantly lower (~125) than on the ones geared specifically to test verbal IQ

      I have never heard of a standardized "verbal IQ" test. What specific test or tests are you referring to?

    21. Re:IQ tests are severly flawed by Woldry · · Score: 1

      Sorry, I wasn't clear. I was referring to the subset of certain standardized tests that measures Verbal IQ. The Wechsler Adult Intelligence Scale, for instance: A person taking the test receives a full-scale IQ score, a verbal IQ score, a performance IQ score, as well as scaled scores on each of the subtests.

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    22. Re:IQ tests are severly flawed by Zoyd · · Score: 1

      You asked which one you should say is your IQ. Your full-scale IQ score is your IQ score for that particular instance of taking the WAIS-III.

      On which tests did you receive the scores that you reported above?

    23. Re:IQ tests are severly flawed by Woldry · · Score: 1
      Being a horrible pack rat, I am unable to lay hands on the specific results to verify these figures. Some I don't still have any documentation for, or my parents have it along with my old school papers, etc. Furthermore, I grow old (I grow old, I shall wear my trousers rolled), so my memory of the exact figures and which ones match which exact test is beginning to grow hazy (aside from the SAT, which was burned into my skull by far too many conversations comparing SAT scores in college). But here's what I seem to recall:

      • Leiter International Performance Scale (taken ca. 1978? 1979?): ~125
      • SAT (1979): 1330 (66 verbal, 67 math -- atypically [for me] lower verbal score) -- which apparently (see a different response to my original comment) translates to ~137/~140
      • WAIS (?1984?): ~140 (? 137 ?) (full-scale), ~165 Verbal IQ (the discrepancy really struck me, so this figure has stuck in my head)
      • Stanford-Binet (? 1976 ?): ~143 (but the "Visual/Spatial" subset was something like 110, IIRC -- again, the discrepancy stuck with me)
      • Test of Nonverbal Intelligence (? 1986? 1987?): ~124

      There were others taken when I was a child in the late 1960's/early 1970's. I don't recall now which tests. I do recall that the scores were generally high 130's, and at least one that was in that range but included a verbal score in the 160's.

      For whatever it's worth (and I don't think it's worth much myself), occasional online IQ tests at various sites over the past 10 years or so pretty consistently assess me at about 140-145, unless they include a lot of spatial/visual questions, and then I get more like 125-130.

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    24. Re:IQ tests are severly flawed by drjzzz · · Score: 1

      Maybe I'm missing something... isn't this less "interesting" than wandering? Seems the mini family history supports the notion that IQ is genetic, at least. But as to what is measured, which seems to be the point of the post, there are no data, even anecdotal. Does your sister excel at spatial as well as verbal skills, etc? Do you share a subset of these skills? These would be observations that might at least lead somewhere. Like I admitted, maybe I'm missing something.

      My $0.02: From an evolutionary point of view, most skills measured on an IQ exam are probably poorly related to what has been selected over the generations. A beautifully logical argument is rarely as persuasive as a moving rhetorical appeal. Human interactions are very complicated and resistant to genetic cheating (like male display characteristics). Maybe IQ measures the intellectual "horsepower" but what counts (in life, instead of the test) is how much of this power can be delivered to the wheels. 'Course a metaphor doesn't really explain anything...

      --
      to err is human, to forgive is divine, to forget is... umm...
  16. IQ testing not science, has a history of bigotry by Anonymous Coward · · Score: 0

    The great academian Steven Jay Gould wrote an awesome book that has put decades of modern IQ "research" to shame and highlights the hidden agendas and racism/sexism that is often involved.

    From Amazon.com:

    The Mismeasure of Man, Stephen Jay Gould's masterful demolition of the IQ industry, should be required reading. Gould's brilliant, funny, engaging prose dissects the motivations behind those who would judge intelligence, and hence worth, by cranial size, convolutions, or score on extremely narrow tests.

    How did scientists decide that intelligence was unipolar and quantifiable, and why did the standard keep changing over time? Gould's answer is clear and simple: power maintains itself. European men of the 19th century, even before Darwin, saw themselves as the pinnacle of creation and sought to prove this assertion through hard measurement.

    When one measure was found to place members of some "inferior" group such as women or Southeast Asians over the supposedly rightful champions, it would be discarded and replaced with a new, more comfortable measure. The 20th-century obsession with numbers led to the institutionalization of IQ testing and subsequent assignment to work (and rewards) commensurate with the score, shown by Gould to be not simply misguided--for surely intelligence is multifactorial--but also regressive, creating a feedback loop rewarding the rich and powerful.

    The revised edition includes a scathing critique of Herrnstein and Murray's The Bell Curve, taking them to task for rehashing old arguments to exploit a new political wave of uncaring and belt tightening. It might not make you any smarter, but The Mismeasure of Man will certainly make you think.

  17. uhhhh.... by Tumbleweed · · Score: 2, Insightful

    ...what?

  18. p=? by wpegden · · Score: 3, Insightful

    I'll wait to see their statistics. Why did they study this gene? It seems likely, for example, that given any group of 300 people, one could find a gene variant correlated with higher (or lower) IQ *in those 300 people*. With 30,000 genes, the statistics could be quite delicate. Another subject not discussed, apparently, is that a gene could presumably affect rate of development or growth, rather than eventual intelligence (this may be much more plausible, for example). This would manifest itself in 10-year olds, but not, for example, in 30 year olds. Why did they study 10-year olds? It seems like this may be an obvious objection.

    1. Re:p=? by mookie+da+wookie · · Score: -1

      nah, these statistics are not delicate at all. There are smart people and not so smart people. Why couldn't this be dictated by genetic makeup? You ask why did they study ten year olds. I ask why you use 300 as a number? You have to pick something.

      The whole notion of eventual intelligence has been debunked by a recent study at MIT, where I am an undergrad in molecular engineering. It is pretty clear, according to the most modern research, that intelligence is solely determined by genetic makeup. It's pretty cutting edge research, so I am not surprised you weren't aware. It's ok.

      I feel like this does explain most celebrities, though. Most celebrities were born either near toxic waste disposal facilities OR large concentrations of cosmic background radiation (statistically, it's true). While the world in general may laud them, actually there is a real lack of intellectual horsepower, if you will.

      Anyhow, I think I made my point. Feel free to rebut.

      --
      I particularly enjoy rubbing your noses in my towering intellect. On a personal note, I am an avid mustard enthusiast.
    2. Re:p=? by nwbvt · · Score: 1
      "There are smart people and not so smart people. Why couldn't this be dictated by genetic makeup?"

      It can. But this study doesn't prove it is caused by this particular gene.

      "I ask why you use 300 as a number?"

      Uh, he knows how to read? That number was mentioned in the FA.

      "It is pretty clear, according to the most modern research, that intelligence is solely determined by genetic makeup. "

      No, actually, many studies have shown that envirommental factors in early development are important as well (which only makes sense, that is when the brain grows).

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
    3. Re:p=? by nwbvt · · Score: 1
      "It seems likely, for example, that given any group of 300 people, one could find a gene variant correlated with higher (or lower) IQ *in those 300 people*."

      Actually, that didn't happen here. They had to introduce a new factor (gender) to get that correlation. Now if there was some justification to consider gender (for instance if this gene appears on a sex chromosome or if empirical evidence suggests daughters are less likely to inherit their parent's IQs), that would be fine. But I see no evidence that either is the case.

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
    4. Re:p=? by caenorhabditas · · Score: 1

      IGF2R is active from very early in development. While the slower-development hypothesis is possible, it's far from the simplest explanation. However, tests should be done (if they're not already planned) incorporating older subjects. I agree on the p value comment, though. I'd really prefer to see a larger sample size (perhaps restricted to only males, this time). Samples from across various cities would be useful, as well.

    5. Re:p=? by glwtta · · Score: 1
      Another subject not discussed, apparently, is that a gene could presumably affect rate of development or growth, rather than eventual intelligence (this may be much more plausible, for example).

      Yeah, no frikin' kidding - a growth factor receptor just might be related to development.

      Here's a paper linking a mutation in IGF2R to differences in rate of growth and height from birth to 7 years. There's also a bunch of studies in mice regarding its imprinting and role in development (incidentally, one mentions that it's regulated so that the paternal allele is repressed, so the gene is maternally expressed).

      Also seems it's been implicated as a tumor suppressor; though that's kinda irrelevant.

      --
      sic transit gloria mundi
    6. Re:p=? by glwtta · · Score: 1
      The whole notion of eventual intelligence has been debunked by a recent study at MIT, where I am an undergrad in molecular engineering.

      Could you provide a reference for this study that settled things with such finality?

      It is pretty clear, according to the most modern research, that intelligence is solely determined by genetic makeup.

      We are still talking about the same study, right?

      It's pretty cutting edge research, so I am not surprised you weren't aware. It's ok.

      No I do feel bad - I should've been aware that a study has been published that debunks virtually all previous studies on the subject and completely reverses our understanding of development and intelligence.

      --
      sic transit gloria mundi
    7. Re:p=? by timeOday · · Score: 1
      This would manifest itself in 10-year olds, but not, for example, in 30 year olds.
      Or maybe in 10 and 30 year olds, but not 60 year olds... right? Which means I could still get smart sooner or later?
    8. Re:p=? by mookie+da+wookie · · Score: -1

      You haven't heard because the news hasn't made it to the trailer park circuit yet. Maybe I should have talked about diggin bait or cookin meth or huntin possum. Those third grade reading skills of yours get a workout here, eh?

      Thanks for feeding my troll, sluggo! Once he is full grown I will name him after you. glwtta is a good troll name. Pat, I'd like to buy a vowel!!!

      --
      I particularly enjoy rubbing your noses in my towering intellect. On a personal note, I am an avid mustard enthusiast.
    9. Re:p=? by mookie+da+wookie · · Score: -1

      Wocka wocka wocka, you smell like a dirty socka

      Well, thanks for feeding this troll! Won't you clean my toilet bowl?

      --
      I fart in your general direction

      --
      I particularly enjoy rubbing your noses in my towering intellect. On a personal note, I am an avid mustard enthusiast.
  19. Budwiser gene by Belseth · · Score: 1

    It's called the beer gene, I thought everyone knew about that one?

    1. Re:Budwiser gene by ebrandsberg · · Score: 1

      No worse than the "whisky" gene.

  20. Flowers for Algernon by yobbo · · Score: 1

    Better still, let's develop ways to artificially increase everyone's IQ!

    1. Re:Flowers for Algernon by RPI+Geek · · Score: 1

      Wow. Someone else read that story? I thought I was reading obscure stuff (at least for 2005)!

      --

      - "Nobody came out that night, not one was ever seen. But Old Man Stauf is waiting there, crazy sick and mean!"
    2. Re:Flowers for Algernon by bsartist · · Score: 1

      Obscure? It's on my short list of some of the best sci-fi ever written. The short story won the Hugo, the novel won the Nebula, and the movie Charly won an Oscar, a Golden Globe, and received a fistful of other nominations. What surprises me is that it took so long for someone to mention it.

      --
      Lost: Sig, white with black letters. No collar. Reward if found!
  21. I have no problems if I find out my genes dumb me by backslashdot · · Score: 1

    So I don't have to run around trying to do complicated crap. Seriously, if I knew what my limits or capabilities are, I could work with 'em instead of doing things the wrong way. For example, maybe I wouldn't have bothered taking calculus and done something else instead.

  22. I for one... by joey_knisch · · Score: 3, Funny

    welcome our new male overloards... Oh wait...

    1. Re:I for one... by joey_knisch · · Score: 1

      lol... all the females of slashdot have come in force to mod this down. it's recieved like 3 overrateds now. lol.

      oh well. i guess you can't please everybody.

  23. Obligatory question by zappepcs · · Score: 1

    uhmmmm were the men that inherited this gene blond haired?

    1. Re:Obligatory question by Anonymous Coward · · Score: 0

      No they all had black kinky hair. Seriously.. what do you think?

    2. Re:Obligatory question by damsa · · Score: 1

      No, one of the IQ tests involved screwing in a light bulb.

  24. Well call me a monkey's uncle... by terradyn · · Score: 1

    If it's that simple, sign me up for a six-pack. Thanks!

  25. Rat brains by Anonymous Coward · · Score: 0

    Maybe they could put the gene into rat brains and teach them to fly planes.

  26. Am I fucking retarded? by Anonymous Coward · · Score: 2, Interesting

    Am I the retarded person here? Here is a direct quote from the article:

    The researchers studied about 300 children with an average age of 10. The children, all Caucasian, came from six counties in the Cleveland area.

    Now, if you can tell me how the hell you figure that the females were anything but Caucasian, I'd really appreciate it. Perhaps I'm just a dumbfuck with this specific gene and my 20 point IQ gap is causing me to misunderstand "The children, all Caucasian".

    1. Re:Am I fucking retarded? by buck_wild · · Score: 1

      No sir. A bit caustic, perhaps, but dead-on accurate reading comprehension skills.

      --
      If all you have is a hammer, everything looks like a nail.
  27. Not enough information by seminumerical · · Score: 1
    Hmm, a gene that lowers IQ by 20 points. Easy enough, there are lots of defective genes that do that. Does this variant of the gene have a purpose? Is there a reason why this allele perpetuates? Does it confer advantage?

    We've talked in the past about numerous genes that raise IQ (in the ashekenazim discussion, though these genes affect others), this allele lowers IQ.

    --
    In wartime... truth is so precious that she should always be attended by a bodyguard of lies. (Churchill)
    1. Re:Not enough information by caenorhabditas · · Score: 1

      This is a perfect example of selection (or in this case, lack of selection) at work. In this case, there really doesn't appear to be much selection (in America, at least) against low IQs. People with lower IQs are still able to survive, hold a job, find a mate and (most importantly) reproduce. Without doing or seeing any studies, it seems quite obvious that IQ scores aren't the most important trait in determining survival and reproduction. The gene perpetuates because the people that it exists in perpetuate. Maybe it perpetuates because it gives an unknown selective advantage, but more likely, it perpetuates because it's not a significant enough detriment to cause selection to act against it. Other genes in the organism can make up for a fitness deficiency in one gene.

    2. Re:Not enough information by aXis100 · · Score: 1

      I'm betting that gene's responsible for higher IQ's will die out.

      Reasons (with a liberal shaking of salt)
      1) Smarter people tend to become more educated and land better jobs
      2) People with "better", higher paying jobs will tend to be more career oriented and not so interested in having a family (especially modern women).
      3) Poeple who dont have families dont progress their gene's

      By comparison, uneducated, poor trailier trash families tend to breed like rabbits.

      PS - all of this is just wild conjecture.

    3. Re:Not enough information by Zoyd · · Score: 1

      the phenomenon of a genetics-mediated drop in IQ is called dysgenics.
      http://www.childrenofmillennium.org/eugenics.htm

    4. Re:Not enough information by Keichann · · Score: 1

      It's a shame there isn't a (-1, Convoluted Nietzcheism) score. I mean, really?

      Assuming that's even true, it only really applies to North America and Western Europe. And even then only to the urbanised areas. As another post said - what other effects does this gene have? Are they desirable?

  28. Less News for Nerds. More Stuff that don't matter. by Anonymous Coward · · Score: 0
    WTF? This is more important than Xen 3.0? And so are rat brains? And whining dental blogdrivel?

    Meh.

  29. Aw Crap... by joey_knisch · · Score: 1

    Who would have though the letters between "" would be filtered out when selecting html formatted?

    Geeze. Obviously I need an IQ gene booster shot.

  30. Re:IQ testing not science, has a history of bigotr by drDugan · · Score: 2, Insightful

    the whole concept of "IQ" is absurd.

    even a cursory undertanding of human nature and modern psychology and personality models show that using one test to characterize everyone is highly reductive and not very useful.

  31. Perfectly Cromulent.. by StikyPad · · Score: 1

    The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20 approximately 20 points.

    Well now we know who doesn't have the IQ gene...

    1. Re:Perfectly Cromulent.. by PresidentEnder · · Score: 1

      Considering that the article states that this gene lowers the average IQ of the remarkably small sample group, I think we now know two people who don't have the gene. (Please don't hit me)

      --
      I used to carry a bottle of whiskey for snake bite. And two snakes. -Nefarious Wheel
    2. Re:Perfectly Cromulent.. by StikyPad · · Score: 1

      I'll chalk up my mistake to the well written summary. :)

  32. Re:IQ testing not science, has a history of bigotr by skingers6894 · · Score: 1

    "even a cursory undertanding of human nature and modern psychology and personality models show that using one test to characterize everyone is highly reductive and not very useful."

    Obviously YOU don't have the gene.

  33. MOTHER @#%&^&$#!!!!!!!! by joey_knisch · · Score: 1

    Ok. Here goes nothing...

    Who would have thought the letters between a "less than" and "greater than" sign would be filtered out when posting in both html formatting and txt formatting.

    (Sees Preview Button)

    Aw crap. I really need those genes enhanced. When's this stuff going to be ready anyways?

    1. Re:MOTHER @#%&^&$#!!!!!!!! by cagle_.25 · · Score: 1
      Select this text and "view selection source" to get your < > codes. :-)

      More info here.

      --
      Human being (n.): A genetically human, genetically distinct, functioning organism.
  34. Fantastic!!!! by Freaky+Spook · · Score: 1

    We all new that the the Penis effects IQ & now they have discovered a new gene????

    More ammunition for my girlfriend to insult my intelligence.

    1. Re:Fantastic!!!! by glwtta · · Score: 1
      We all new that the the Penis effects IQ & now they have discovered a new gene????

      I'm guessing your girlfriend doesn't want for ammunition.

      Oh, and why would you capitalize 'penis'?

      --
      sic transit gloria mundi
    2. Re:Fantastic!!!! by Sathias · · Score: 1

      Well just point out to her that they haven't discovered an intelligence gene in females yet ;)

      --
      Blessed are the 1337, for they shall pwn the earth.
    3. Re:Fantastic!!!! by Woldry · · Score: 1

      One always capitalizes the name of one's Deity.

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
  35. a smart gene? by bjason82 · · Score: 1

    Wel. I mus oviously ahve thes jean.

  36. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    Nothing like an article about IQ to bring out the most non-sensicle and idiotic replies from suposedly smart/nerdy people.

  37. i think by Anonymous Coward · · Score: -1, Troll

    CMDRTACO A STUPID ASSHOLE

  38. "May" the ultimate disclamer by EmbeddedJanitor · · Score: 1, Insightful
    Every biological discovery "may lead to new breakthroughs in aging/cancer/AIDs/impotency treatment", yet so few do.
    Every space probe/Hubble/whatever "may tell us about the origins of life/the universe", but we've really got no closer to the answers. Even mars (now looking like a rover junkyard) "may have sub surface water".

    C'mon scientists, stop hyping. Call us when you've got something real to show. Unfortunately I think the hyping is an inevitable part of trying to rake up funding. Headlines-->good PR-->funding.

    --
    Engineering is the art of compromise.
    1. Re:"May" the ultimate disclamer by inputsprocket · · Score: 2, Insightful

      Every biological discovery "may lead to new breakthroughs in aging/cancer/AIDs/impotency treatment", yet so few do.

      Maybe why they say may?
      At any rate, treatments today are the children of research and as a result we

      • Live longer
      • can treat cancer (some being near 100% successful)
      • treat AIDS
      • treat impotency

      There is no magic bullet, which people like you believe, that treats and cures all. Even your own words say there are yet so few. Isn't the fact that are are some make it all worthwhile?

      Or would you rather take away funding for medical research and pump it into Homeland Defense instead?

    2. Re:"May" the ultimate disclamer by ceoyoyo · · Score: 1

      Cancer/AIDS/impotency treatments are incredibly advanced over what they were just ten years ago, never mind twenty. Space probes/Hubble/rovers have told us a lot about the origins of the solar system and the universe. We know much more about it than we did a few years ago. Much of this new knowledge is causing us to ask new questions, but that's how you know you're onto something.

      For example -- cancers that were a death sentence ten years ago are now treatable, and in some cases curable. Virus load in AIDS patients can often be reduced to undetectable levels by modern anti-viral cocktails. Taking these medications during pregnancy is very effective in preventing the baby from being infected.

      Hubble, Chandra and the series of microwave probes have revealed things like the accelerating expansion of the universe (not long ago we thought expansion was slowing, as you'd expect under the influence of gravity and were trying to figure out whether it would expand forever or eventually collapse). We have good evidence that liquid surface water was once plentiful on Mars and good indications that there may still be large amounts underground.

      Maybe you're mistaking hype (not that it doesn't happen sometimes) for scientists who are enthusiastic about their work sharing it with the public, but being careful to note that their results may indicate something -- nothing is abosolute in science after all.

    3. Re:"May" the ultimate disclamer by killjoe · · Score: 1

      To paraphrase chris rock.

      Where is the medicine?

      "hey doc I can't see"
      "here take this dog"
      "there are people who can see that can't take care of a dog! give me a midget or something!"

      I am with you on this one. Less hype till we actually know what is going on.

      --
      evil is as evil does
    4. Re:"May" the ultimate disclamer by Anonymous Coward · · Score: 0

      nothing is abosolute in science after all.

      Not even spelling...

    5. Re:"May" the ultimate disclamer by agurkan · · Score: 1

      Headlines can be obtained by a simple press release. You do not need to hype, you certainly do not need to lie about your results or discoveries to make headlines. Also, the scientists are not to blame for this situation, it is a consequence of capitalism, which, being short-sighted, needs immediate return on every investment; or at least you have a higher chance of survival if you claim immediate returns. The more a state sponsors science, the less there is media buzz about scientific discoveries in that country.
      If you wait until results come out before supporting science, you will never get any results.
      Finally, we are closer to answers in many problems. Actually we solved many problems in the past decade. Of course nobody is expecting to learn the origin of the universe by using a single instrument, but it is easier to make a 5-inch telescope followed by a 10-inch telescope then to make a 10-inch telescope from scratch. Also the science that comes out of 5-inch telescope will be valuable in itself (I am using an analogy here, I do not mean HST is literally a 5-inch telescope).

      --
      ato
    6. Re:"May" the ultimate disclamer by dsanfte · · Score: 1

      After 200 years of scientific progress, to quote Freud, life is still an improved means to an unimproved end. Namely, we have not conquered death, or even begun to understand the reason we age. So what have we accomplished? We've neatly rearranged the deckchairs on the Titanic of our lives, and postponed the sinking by a few hours.

      --
      occultae nullus est respectus musicae - originally a Greek proverb
    7. Re:"May" the ultimate disclamer by Bloke+down+the+pub · · Score: 1

      Are you a creationist, by any chance?

      --
      It's true I tell you, feller at work's next door neighbour read it in the paper.
    8. Re:"May" the ultimate disclamer by ErikZ · · Score: 1

      I'm sorry, are we trying to conquer death? Did someone declare war? I must have missed it.

      --
      Democrats or Republicans. They are both taking us to the same place and they are not afraid of us anymore.
    9. Re:"May" the ultimate disclamer by Savantissimo · · Score: 1

      Ok, great, but still virtually all the increase in lifespan in the world in the past century has been from sanitation, vaccination, antibiotics, and nutrition. Virtually all the increase in the next 15-30 years is going to come from those four plus smoking reduction. Research is worth doing for the knowledge and the long term, but I don't expct technology's effects will make further big increases in longevity until nano is practical.

      --
      "Is life so dear, or peace so sweet, as to be purchased at the price of chains and slavery?" - Patrick Henry
    10. Re:"May" the ultimate disclamer by inputsprocket · · Score: 1

      Where did vaccination and antibiotics come from?

      It's called research and discovery, since it's is looking at things we know nothing or little about and discovery. Who's to know what we will discover tomorrow? Clearly you know we will not find anything useful, but then what do you or I or the next boffin know?

      Nobody knows, that's why it's worth investing in. To find out.

      Please, think a little outside of your own confines.

    11. Re:"May" the ultimate disclamer by Savantissimo · · Score: 1

      Did you miss the part where I said: "Research is worth doing for the knowledge and the long term..."?

      My point is that not that research fails to contribute to clinical practice, but that virtually all efforts and techniques of clinical medicine put together are not effective enough to show up in the vital statistics in increased lifespan, so the liklihood that any given supposed breakthrough will do much for overall human longevity is slim.

      --
      "Is life so dear, or peace so sweet, as to be purchased at the price of chains and slavery?" - Patrick Henry
  39. I wonder if prestigious Universities in the future by Wisgary · · Score: 1

    ...would ever pull something like "We accept people who have the Intelligence gene only. All other entries are rejected."

    That would suck.

  40. Related Traits... by catdevnull · · Score: 5, Funny

    The study went on to find that those individuals without this gene tend:

    - to be picked as moderators on slashdot...
    - to vote straight party tickets
    - to claim that "anal leakage" is an acceptable side-effect for food additives
    - to buy advanced copies of the Dukes of Hazzard DVD
    - to work on the MSIE team
    - to post stupid bogus study result lists on /.

    --

    I might know what I'm talkin' about, but then again, this is Slashdot...
    1. Re:Related Traits... by mrscorpio · · Score: 1

      Slashdot moderator says: "-1, Truth Hurts"

    2. Re:Related Traits... by eklitzke · · Score: 1

      You know what the funny thing is? The gene makes you score lower on IQ tests, not higher. Ironic, isn't it? Maybe you should RTFA next time.

      --
      #include ".signature"
    3. Re:Related Traits... by glwtta · · Score: 1
      You know what the funny thing is?

      I do! It's that everyone has the gene, but those with a specific mutation (presumably causing loss of function) score lower on IQ test. So not having the gene expressed at all, would likely correlate with a much lower IQ still (well, among other things).

      --
      sic transit gloria mundi
    4. Re:Related Traits... by oncebitten · · Score: 1

      Then I guess I must have this gene in spades (yes, I RTFA) because I've been given moderator access 4 times in the last month.

    5. Re:Related Traits... by Anonymous Coward · · Score: 0

      So not having the gene expressed at all, would likely correlate with a much lower IQ still (well, among other things).

      Not having the gene at all results in death. http://www.geneimprint.com/databases/c6/m6p/intro. html

    6. Re:Related Traits... by meringuoid · · Score: 4, Interesting
      - to be picked as moderators on slashdot...

      I usually get moderator points quite frequently - normally, it's when I've just done some metamoderating, a duty I confess I often ignore. However, I don't really use them for anything.

      The problem with having modpoints is that, if a discussion is on a topic I know something about, or at least that I care about, then I'd far rather post replies than moderate. So I end up making use of my modpoints by going into discussions I neither know nor care about and shooting down First Posts, GNAAs, goatses and copy-paste trolls...

      This may be why we've developed this stereotype of moderators as clueless. If they knew about the stuff being discussed, they'd be discussing, not moderating - so just like I always do, they've gone into a discussion they care little for and are doing the best they can there.

      --
      Real Daleks don't climb stairs - they level the building.
    7. Re:Related Traits... by caudron · · Score: 1

      The study went on to find that those individuals without this gene tend:

      - to respond to articles without reading them.

      Note that those /without/ the gene are smarter. The gene has a negative corrolary to intelligence scoring.

      But other than totally screwing up the gist of the article and making a snap comment that, in light of reality, makes no sense, the post was funny. ;-)

      --
      -Tom
    8. Re:Related Traits... by Anonymous Coward · · Score: 0

      I'll make a suggestion - go to your freaks list, browse through some of their comments, liberally apply troll and flamebait moderations. Problem solved.

    9. Re:Related Traits... by torokun · · Score: 1

      Good points. This suggests a solution.

      Just block anyone from commenting until they've used up their mod points. They can then comment as usual, on any thread they want.

    10. Re:Related Traits... by catdevnull · · Score: 1

      Leave it to slashdot ubergeeks to split hairs on the "with/without" technicalities when the post was meant to be nothing more than silly flamebait that STILL got modded up for 100% funny. Get over yourselves.

      BTW: I'm a FREQUENT moderator. I know who you humorless type-A overclocked tight-asses are now!

      Taste my rogue moderation pain, beeotch. :-)

      --

      I might know what I'm talkin' about, but then again, this is Slashdot...
    11. Re:Related Traits... by Anonymous Coward · · Score: 0

      You know what the FUNNIER thing is? You got a bug up your ass about a complete troll post and you wasted your time both responding to it and reading this!

  41. this is a decent sample size by r00t · · Score: 1

    You seem to lack a feel for statistics. With surprisingly small samples, you can get pretty solid numbers.

    The standard deviation for IQ is usually defined to be 15 or 16. (rarely, it may be 20)

  42. StdDev = 15, but it doesn't matter by Dire+Bonobo · · Score: 5, Interesting
    > anyone know offhand what the population variance for IQ is?

    The standard deviation of IQ is 15 or 16 in most scales. A difference of 1.25 standard deviations is not small.

    However, without knowing the frequency of the gene in the tested population, it's impossible to know if the difference is statistically significant. If the group was 50% male and 50% had the gene, it almost certainly represents a real difference; if only 5% had the gene, that's only 7-8 guys, and the "difference" is pretty likely to be random chance.

    It's also worth noting that the difference could be in developmental speed rather than in level---i.e., the guys with the gene could just take longer to develop, but be just as smart by age 25, or could be associated with some other factor that is merely correlated with intelligence (such as, say, alcoholism which can lead to poverty which can lead to a less intellectually-nurturing home life).


    Basically, this article gives us a sound bite with almost no useful information---shoddy reporting.

    1. Re:StdDev = 15, but it doesn't matter by trout0mask · · Score: 3, Interesting

      Unfortunately, the linked article is one of the less informative ones. The Olympian http://www.theolympian.com/apps/pbcs.dll/article?A ID=/20051203/NEWS/51203003 has a lot more, including an estimate from Jirtle that 25% of the Caucasian population has the variant (low IQ) gene. Assuming the sample of 300 was half male and half female, that would mean about 37.5 males with the variant gene and an average IQ of 85, and about 112.5 had an average IQ of 105. That makes the IQ of the group average to 100; the population average now is higher than 100, so that's skewed a bit, but it doesn't really matter if we're talking about significance.

      It's been a while since I knew statistics, but I think a Chi square test would be appropriate.

    2. Re:StdDev = 15, but it doesn't matter by Darby · · Score: 1

      correlated with intelligence (such as, say, alcoholism...

      Are you saying that those are correlated, or was that just an example?
      It would be a pretty fun experiment, regardless ;-)

    3. Re:StdDev = 15, but it doesn't matter by Zoyd · · Score: 1

      IQ and alcoholism are indeed correlated. See the bullet lists "Variables correlated with g" and "Variables inversely correlated with g" at the following link:

      http://www.childrenofmillennium.org/science.htm

    4. Re:StdDev = 15, but it doesn't matter by Carewolf · · Score: 1

      The wikipedia entry is quite blurry. The standard derivation is almost always 24, or rather like many other things; the US uses 15, the rest of the world 24.

  43. Give those with low IQ jobs. by CyricZ · · Score: 3, Insightful

    Do you know what the bad ones who get "weeded out" under such a system do when they can't find a job? They steal your car and sell cocaine in order to get by.

    Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do. Sure, they don't have the IQ to design bridges or perhaps even to work a cash register. Nevertheless, society as a whole is better off if there are opportunities available to those who cannot compete in the job market based on their (lack of) intelligence.

    You can often employ several such people doing various tasks for the cost of one more police officer. It's better to keep them out of a life of crime than it is to "let nature take its course".

    --
    Cyric Zndovzny at your service.
    1. Re:Give those with low IQ jobs. by Velox_SwiftFox · · Score: 3, Insightful

      Oh, that would be wonderful. An incentive for clever people to take up a life of crime. I think you had better refigure this. Let's watch out for seemingly smart people who do not seem to be able to find a job, and employ them, before they find out they might be smarter than the person investigating their prospective crimes.

      Or just keep a close eye on them, at least.

    2. Re:Give those with low IQ jobs. by mrchaotica · · Score: 1

      Actually, the "best" (i.e. most efficient) solution for society would be to execute the unproductive members.* We don't actually do that, of course, because as a society we're more concerned with being humane than being efficient.

      *Note that people with the potential to become productive, such as children, wouldn't count.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    3. Re:Give those with low IQ jobs. by pintomp3 · · Score: 1

      and letting them fall off would be the opposite of "weeding out". the general trend is that the less education and money you have, the more kids you have. so we would end up with more "weeds" in the process.

    4. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      Not if you kill those with 'low' IQ's in the womb...

      great source of stem cells too, for those who know how to use 'em.

    5. Re:Give those with low IQ jobs. by WoodstockJeff · · Score: 5, Insightful
      But, who could afford it, given today's laws and taxes? Under current law, it costs an employer a minimum of about $500/week (depending upon the state) to employ a person for 40 hours at minimum wage. That's not what the employee gets - that's what it costs the employer to have them around. Anyone that doesn't produce at least $500/week in value to the business isn't going to be around for very long, no matter how "compassionate" it is to keep them.

      One of the local businesses used to hire students on summer vacation for clean-up of the property and shop. Few skills required, good hours, etc. But, once the minimum wage got over $3/hour, it was less expensive for the owners to do that work themselves. No more low-skill jobs there, and no chance to get your foot in the door for the high-skill, high-paying jobs in the rest of the plant.

      There are jobs out there that do not require a lot of skill. Several million of them, according to statistics on illegal immigration. The trick is convincing students that they're not worth $30K per year when they first leave high school, because they haven't proven themselves in the work place. And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!

    6. Re:Give those with low IQ jobs. by mOdQuArK! · · Score: 1
      Actually, the "best" (i.e. most efficient) solution for society would be to execute the unproductive members.

      If you're thinking this way, then you'd get a _much_ better efficiency by executing the people who actually cause _damage_ to the society, i.e., the parasites who tend to be at the "top" who loot the society for all it's worth & return relatively minor benefits. Compared to them, the "unproductive" members of society are insignificant matters.

    7. Re:Give those with low IQ jobs. by Knuckles · · Score: 1

      Depnends on your definition of "best". If Nazi Germany was a good society in your view, then yeah. I'll take the less efficient one, thanks

      --
      "When I first heard Daydream Nation it quite frankly scared the living shit out of me." -- Matthew Stearns
    8. Re:Give those with low IQ jobs. by Lectrik · · Score: 1
      Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do.


      I was wondering why a librarian would care... does that mean I fail?
      --
      --- As to make my comment seem, by comparison, more intelegent... doodie doodie doodie poop poop poop!
    9. Re:Give those with low IQ jobs. by mOdQuArK! · · Score: 1
      Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do.

      Also, brain development won't occur if people aren't _challenged_ to think. While genes might dictate a "maximum intelligence level", even the best genes won't get a chance to kick in if proper mental stimulation isn't provided while the kid is growing up. Even after reaching full brain growth, constant mental stimulation keeps existing neurons from disappearing & to continue developing & strengthening connections.

      Any economic system which doesn't provide a way for someone who might be marginally competent to improve themselves will guarantee a large economic underclass desperate for survival and a willingness to do almost anything to anybody that their limited imaginations can show them (probably based on TV & movies) to achieve that.

    10. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: -1, Flamebait

      You've obviously never had an argument with a strict enough libertarian. They'd probably insist that stealing your car clearly is a productive activity since the free market was willing to pay them for it :-)

    11. Re:Give those with low IQ jobs. by Darby · · Score: 1

      One of the local businesses used to hire students on summer vacation for clean-up of the property and shop. Few skills required, good hours, etc. But, once the minimum wage got over $3/hour, it was less expensive for the owners to do that work themselves. No more low-skill jobs there, and no chance to get your foot in the door for the high-skill, high-paying jobs in the rest of the plant.

      I'd say the extra cost should probably go under the heading of "investing in the future".
      Well, unless that is, they expect the government to pick up the tab for doing that training that is really their responsibility. If they want people to learn *their* business isn't it reasonable that they should pick up the tab for training them?

      Maybe not though. Were they in favor of huge tax increases on businesses in order to properly train their future employees?

    12. Re:Give those with low IQ jobs. by Darby · · Score: 1

      I was wondering why a librarian would care... does that mean I fail?

      Depends. Did she take off her glasses and dance for you around and whatnot?

    13. Re:Give those with low IQ jobs. by tau-lepton · · Score: 0, Flamebait

      I thought that Tom Delay was already employeed, at least for the time being.

    14. Re:Give those with low IQ jobs. by Al+Dimond · · Score: 1

      Yeah, but aren't Libertarians also the strongest believers in property rights?

      *laugh*

      Though, honestly, this is somewhat a laugh of ignorance. Any Libertarians 'round these parts (and I know y'all are!) care to explain Good Libertarian (tm) position on which side to take when the Free Market and Property Rights aren't on the same team?

      (For my money (karma?) I'd guess that it's something like, "Without property rights there can be no free market because without ownership there's nothing to sell; if your car is taken it's not part of a free market because you had no choice in the matter." At least that makes sense to me. But I'm not really a Libertarian.)

    15. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 2, Informative

      I assure you, the strictest libertarians would prefer to let the market decide that outcome (as opposed to letting any one person or group of people dictate the 'correct' outcome).

    16. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      How about euthenasia? Then again, I like cocaine as much as the next person. Make 'em a cocaine dealer, I have to buy from someone. (and I prefer my dealers nice and dumb)

    17. Re:Give those with low IQ jobs. by h4rm0ny · · Score: 5, Insightful


      All this talk of efficiency and none about what the goal is? Seems hard to calculate the "efficiency" of society without being able to measure our achieval.

      But I can make an educated guess that when you talk about efficiency, you're referring to productivity and GDP etc. Is that our whole aim as a species? To manufacture more and more goods? Because you need someone to sell them to and people buy to improve their lives. The greatest possible satisfaction for the largest possible number is the real goal of society in my book - and working in a frenzy to get by isn't it. Face it - ever since the invention of modern farming techniques, most of mankind has been facing a losing battle to make himself useful. We have the necessities of life (in the developed world), with modern transport, telecommunications, medicine, broadcasting, printing ad infinitem. By this point we should be working four days a week maximum and the rest of the time can be adapted to leisure, study, pursuit of all those things you really want to do.

      Improving the efficiency of society by weeding out the unproductive? Don't you know that the level of ability needed to be productive is rising and rising? Your idea leads to either fewer and fewer people under more and more pressure to be brilliant, or else a halt to technological development.

      Higher education ought to be the biggest growth industry in the developed world right now. Why isn't it?

      --

      Aide-toi, le Ciel t'aidera - Jeanne D'Arc.
    18. Re:Give those with low IQ jobs. by montyzooooma · · Score: 1

      They can let other people's governments invest in the training and then employ those people when they become economic migrants. The original government benefits in wages being sent home and increased real world experience when their wayward sons and daughters return home. The people who "lose out" are obviously the graduates left wondering why they spent all that money getting an education just to get a job flipping burgers. And to try to steer myself back on-topic - if only caucasians have been tested and found to have the gene for high IQ there would be an outcry about racial profiling if anyone tried using it as a measure of aptitude. Nor does IQ in any way relate to industriousness - remember it's 90% perspiration.

    19. Re:Give those with low IQ jobs. by C10H14N2 · · Score: 3, Interesting

      Erm, the minimum wage has been over $3/hr for TWENTY-FIVE !@#%ING YEARS, BUDDY.

      Now, then, going on that logic, if the owners of a business were making so little money that $3/hour was so much that their own labor was worth less, I hardly would fault the wage-earner in that equation as much as the "business" (read: lack of) owner...

      In 1980, when the minimum wage exceeded $3/hour, my family business--running out of, basically, our freaking garage--paid our employees $40k/year. Yeah, the minimum wage really got in the way.

      People who bitch about the minimum wage betray their utter ignorance of basic high-school level economics.

    20. Re:Give those with low IQ jobs. by michaelhood · · Score: 3, Insightful

      what does low-skill jobs have to do with illegal immigration? i live in socal, and most of the border jumpers are more competent in every single area (bar English) than their counterparts around here. i'm in favor of stricter border laws, but these people had the initiative to go on one hell of a journey to better themselves. you can't convince most orange county kids to do anything. they want, and expect, everything handed to them.

    21. Re:Give those with low IQ jobs. by TapeCutter · · Score: 2, Insightful

      "And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!"

      The whole thing is about IQ, low IQ people are quite often desperate to reach the level of "hamberger flipper". It rarely has anything to do with money, usually they want acceptance and TO BE USEFULL. A bussiness that gripes about the minimum wage is not worth working for, either for money or social reasons.

      PS: As others have pointed out $3/hr is from a bygone era (like your attitude). Worse than that you are comparing $3p/h to a more up to date figure of $500 p/w for wages + govt. red tape. This implies that govt. red tape costs $380 pp/pw, utter bullshit!!

      --
      And did you exchange a walk on part in the war for a lead role in a cage? - Pink Floyd.
    22. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0
      Nevertheless, society as a whole is better off if there are opportunities available to those who cannot compete in the job market based on their (lack of) intelligence.

      We allready do. We let them run for president.

    23. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      mrchaotica: Actually, the "best" (i.e. most efficient)

      Knuckles: Depnends on your definition of "best". If Nazi Germany was a good society in your view, then yeah. I'll take the less efficient one, thanks

      He GAVE you his definition of "best": most efficient. But notice that he put "best" in scare quotes? He's made clear he doesn't think it's the best, or else he wouldn't put the quotes there. I suspect you need more practice using your Internet machine.

      But thanks for trying to end the thread.

    24. Re:Give those with low IQ jobs. by odourpreventer · · Score: 1
      Actually, the "best" (i.e. most efficient) solution for society would be to execute the unproductive members.

      That's what Stalin did. And we all know how well that went.

      Besides that the idea is preposterous in itself, there are two big problems:

      1. How do one decide which people are productive?
      2. What if the people who make this decision become unproductive?
    25. Re:Give those with low IQ jobs. by Zoyd · · Score: 5, Informative

      brain development won't occur if people aren't _challenged_ to think.

      An illegitemate child named Isabelle was locked in a dark attic for years with her deaf and mute mother and no toys.
      http://www.google.com/search?q=%22locked+in+an+att ic%22+iq

      She caught up with her peers within two years of being rescued and was found to have a normal IQ. Apparently her brain continued developing normally in the absence of intellectual stimulation in the dark attic.

    26. Re:Give those with low IQ jobs. by Fred_A · · Score: 1
      1. How do one decide which people are productive?


      Easy, execute them and see if the productivity goes up.
      Frankly that's Dictatorship 101...
      --

      May contain traces of nut.
      Made from the freshest electrons.
    27. Re:Give those with low IQ jobs. by Woldry · · Score: 1

      Ah, librarian stereotypes. Always good for a cheap laugh.

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    28. Re:Give those with low IQ jobs. by 68k+geek · · Score: 1

      $3* 40h/week *4.2 weeks/month = $504/month.

      Are you honestly claiming that you can live anywhere in the US for $504 per month? Granted, last time I've been to the states was 8 years ago - but I highly doubt it has become that much cheaper to live there.

    29. Re:Give those with low IQ jobs. by indifferent+children · · Score: 1

      I've heard that a bunch of librarians are trying to convince each other to move to the same state so that they can form a voting block. That will be one very well read place (where do I sign?)

      --
      Censorship is telling a man he can't have a steak just because a baby can't chew it. --Mark Twain
    30. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      With heavily subsidized housing and utilities (HUD for example) it's possible and often expected for disabled/elderly/welfare people to subsist on $500/month before any entitlements stemming from children. Actually obtaining such housing is difficult, and the lifestyle of those that are forced to subsist off of $500-700/month is rather squalid and involves skipping meals and increasing snacking. The people that cannot obtain HUD subsidies and actually work minimum wage jobs are largely forced to take multiple part-time jobs and work 50-60 hours a week in order to obtain a quality of life that probably lacks health insurance. One immediately evil culprit is FICA, since as a regressive tax it consumes a comparatively large portion of the income of poor workers. The pittance social security recipients obtain is disproportionately obtained from the pittance minimum-wage workers obtain.

    31. Re:Give those with low IQ jobs. by CapnChode · · Score: 3, Insightful

      I'm afraid it is you who is demonstrating total ignorance of economics. The decision to hire a candidate is not based on how much money is earned by the business as a whole, it is determined by how productive that individual is. If the individual cannot produce more than his wage, no matter how much money the company is making it does not make sense to hire him. Minumium wage laws make it more difficult for people who are unable to be very productive to get jobs. Why would you hire someone at 3$/hr when he can only produce 2$/hr?

    32. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      The trick is convincing students that they're not worth $30K per year when they first leave high school, because they haven't proven themselves in the work place. And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!


      This is essentially corporate propaganda. There are a couple of orders of magnitude more burger flipping positions than management positions with any fast food company. Telling those hundreds of workers that if they stick in there long enough they are going to get the one cushy desk job that they all have to share is ignorance at best and bait-and-switch sales tactics at worst.
    33. Re:Give those with low IQ jobs. by smchris · · Score: 1

      Actually, I could see that becoming an accepted preemptive social policy:

      "I'm sorry Mr. and Mrs. Smith. The results of genetic testing show that your male fetus has a strong likelihood of subnormal intelligence. Let me discuss the options with you."

      That alone, or coupled with some other minor defects, might be the reason for an abortion.

      [As an aside, I believe it has been long-known that males have greater variance of IQ than females. We can wait for the research that finds the gene responsible for _higher_ than normal IQ too.]

    34. Re:Give those with low IQ jobs. by vertinox · · Score: 1

      That's what Stalin did. And we all know how well that went.

      No. No. No.

      You got Stalinism all wrong...

      Everyone was productive. Just a lot of people died in that process of being productive.

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
    35. Re:Give those with low IQ jobs. by yfkar · · Score: 1

      And if productivity doesn't go up, execute other people until you've found the right ones and productivity soars. :

    36. Re:Give those with low IQ jobs. by vertinox · · Score: 3, Interesting

      Actually, the "best" (i.e. most efficient) solution for society would be to execute the unproductive members.* We don't actually do that, of course, because as a society we're more concerned with being humane than being efficient.

      Actually, a better solution would be to offer vasectomies with a $1,000 bonus upfront for volunteering to be sterilized.

      Maybe $10,000 to women because of the medical complications involved.

      Anyone could volunteer regardless of race and wealth status. Those who were hard up for money (or of lower caliber who wanted money for drugs etc) would tend to gravitate towards this as an easy way to get money.

      Therefore they would not be producing unwanted children or children they could not support. Since the program was totally voluntary, anyone who really wanted children could just opt to not go through the process or perhaps reverse it with a more exspensive procedure down the road.

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
    37. Re:Give those with low IQ jobs. by raduf · · Score: 1



            Actually, I'd rather hire a guy with a lower IQ for a job (and I am in a position to hire, too). If he's equally qualified, it usually means he's more hard-working and reliable. If he's less qualified, I can afford to invest time in training him/her for a particular position, knowing it'll be harder to move to another job. High IQ guys are necessary in a lot less numbers then you might think, for most busineses. They tend to bring or cause trouble, they're expensive, need stuff to keep them busy etc. Granted, when they are necessary they really are, but not everybody is google and needs only phds...

    38. Re:Give those with low IQ jobs. by vertinox · · Score: 1

      Is that our whole aim as a species? To manufacture more and more goods?

      I'd hope our end goal as a species would be trying to reverse the 2nd law of thermodynamics. Barring that... Everything we do will be pointless in the grand scheme of things.

      Of course your suggestion of higher education and technological improvement will lead the road towards that goal. However, the human race might not survive long enough to even have to consider this problem, but I tend to be an optimist.

      However, don't discount technological progress through entertainment and mass production. The singularity might happen because we spent all our time trying to develop high end cpus and AI's for the PS5 or Xbox720.

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
    39. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      You missed the ref. to getting rid of OSHA (Occupational Safety and Health Administration). Without OSHA, putting the bad ones in a factory environment will result in their [permanent] demise.

    40. Re:Give those with low IQ jobs. by idobi · · Score: 1

      Not all jobs create production. Cleaning staff, secretaries, even teachers don't produce income for a business. But they are valuable. Such jobs are part of a business overhead.

    41. Re:Give those with low IQ jobs. by Fred_A · · Score: 1

      I can see you show great promise in the field of management :)

      --

      May contain traces of nut.
      Made from the freshest electrons.
    42. Re:Give those with low IQ jobs. by bigBlackSabbath · · Score: 2, Insightful

      Umm, sounds like a bad interpretation of Ayn Rand style "objectivism." Why would you guess his reference to efficiency was measured purely by the GDP? It seems as if the GPD is your metric in this case - and exactly the narrow definition the original post was criticizing.
       
      Your gloom and doom scenario of "dumbing down" society having a catastrophic effect is flawed. It is dependent upon your sense of a just society where we are allowed to work less time. Your solipsism ignores the greater issues the original poster was referring to. These "slower" people don't just go away, and by ignoring them and their needs you are creating social problems. Philip Slater referred to this as "the toilet bowl theory" - it's the reason people moved to the suburbs. Societies ills are too difficult to solve, so just ignore them, or move away from them, or pretend they don't exist.
       
      I'm sure you're frustrated that you have to work 40 hours a week because some guy with a GED needs something to do to keep him off the street - but the original poster's argument wasn't addressing GDP - it was pointing out how by ignoring these needs we are deferring their real expense (e.g. unemployment often leads to crime which is more expensive than minimum wage).
       
      And this business about the "pressure to be brilliant" sounds like elitist nonsense. Brilliant people aren't made that way because of society's pressure - they are that way because of development issues. Parental involvement, good schools, good teachers, stimulating opportunities - these things lead to brilliance, not some vague source of social pressure. Children are rarely aware of these social issues in their developmental years, and that's where brilliance emerges - not suddenly in the workplace somewhere in their 20s.

    43. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0
      Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do.

      Clearly, you lack a clue - or have this gene. Libertarians are not about having superfluous "systems" as the term is commonly used.

    44. Re:Give those with low IQ jobs. by CapnChode · · Score: 3, Insightful

      Cleaning staff - you hire them because your time is worth more than theirs. If you didn't have cleaning staff, at say $5 per hour, you would have to clean your place yourself. If you earn more than $10 per hour, hiring someone else at $5 per hour to do your cleaning means more profits for your business. Therefore, cleaning staff are productive. Secretaries - again, if the time you save not doing an hour's secretarial work earns you $10, it makes sense to hire a secretary costing $5 for the same period of time. Secretaries are productive. Teachers - Either you spend 6 hours a day educating your children, and miss out on earnings of $60 (assuming you can earn $10/hour), or you pay someone else $5 an hour to do it. All private sector jobs, hired without government coercion, must be productive, even if they are not directly related to production of the actual good or service.

    45. Re:Give those with low IQ jobs. by werewolf1031 · · Score: 4, Interesting

      Yeah, great idea. "Hey, that guy's smarter than most of us, which means he's a potential threat to society, therefore we should keep very close tabs on him even though he's done nothing wrong , we're just pretty sure he will eventually, because... well, he can."

      Hey, better yet, why not just preemtively lock up anyone with a sufficiently above-average IQ? After all, they're capable of far more than the average "sheeple", certainly more so than the average police officer or federal investigator (percieved as his "natural enemies" just because he's capable of outsmarting them, nevermind whether he would actually try), and worst of all these intelligent folks tend to question established norms that should never be questioned (eg. laws, rules of behavior, patterns of thinking, etc.).

      A friend of mine once made the observation that having a working brain in a society that values everything except intelligence is almost like having a real superpower. Yes, it means that smart people can do things that the majority of people can't. However, as parent so sadly illustrated, it also makes them a target, for the very same reason. The average person fears what they don't understand, and they don't understand people that possess greater mental faculties than themselves.

      And before anyone flames me too harshly, bear in mind that I'm not suggesting any kind of "superiority" of intelligent people -- human nature and failing knows no IQ score. I'm just pointing out the absurdity of fearing someone, of suspecting them to be of greater criminal inclination, than those of average (or lower) intellect. To associate one's predisposition to commit crime or harm others as being directly proportionate to intellectual capacity a "because they're smart enough to get away with it" is beyond asinine.

    46. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 1, Funny

      achieval

      Perhaps you do not have the gene.

    47. Re:Give those with low IQ jobs. by idobi · · Score: 2, Insightful

      I'm sorry, but your original premise is that hiring decisions is not based on how much money the business earns as a whole. The hiring of overhead staff is based on how much money the business earns as a whole. It determines whether it is more economical to have a staff or to outsource the work. The real word is not cold hard equation that must balance in the favor of maximized profits. Maximum productivity is not the ultimate goal.

      Why would you hire someone for $3/hr when they only produce $2/hr of productivity? Because having someone else take out the trash and vacuuming the carpet increases employee morale. In our small but not that small business, the $240/month overhead for a cleaning crew means that our employees can goof off some indeterminate hours every month.

      Does our budget allow for a cleaning crew? yes.

      Did our productivity increase? not in any measurable profit.

      Are we enjoying our time working. yes.

    48. Re:Give those with low IQ jobs. by Eli+Gottlieb · · Score: 4, Funny

      Moderately Intelligent Man AWAAAAAAY!

    49. Re:Give those with low IQ jobs. by CapnChode · · Score: 1

      Businesses don't exist to ensure you have an enjoyable time working. If the increase in productivity due to the increase in morale is worth more than $3/hr, it makes sense to hire a cleaner at $3/hr. Of course the world isn't a cold hard equation. Cost-benefit analyses of this type are difficult to perform. But businesses are inherently selfish. A reasonable business owner would only make those decisions which would benefit his business. And the degree of benefit is measured in profit.

    50. Re:Give those with low IQ jobs. by TheGavster · · Score: 1

      I think you misunderstand my point. There are many jobs available where mental faculties are not a requirement. There are, however, jobs where a smart worker is better. Unfortunately, you can't discriminate against people based upon their intelligence. I'm not saying that people with a low intelligence shouldn't be given work at all, I'm saying that people should be given work appropriate to their abilities.

      My comment on natural selection was not in reference to allowing those unsuited for some lines of work fall out of society; rather it was in reference to how some people would quickly die if given control of heavy machinery or dangerous chemicals without the current occupational safety rules.

      As a final point, the problem with cocaine sales isn't the street dealer or the addict, it's the system of organized crime needed to circumvent the drug laws and deliver the product. If CVS sold cocaine, they would probably not engage in gang warfare with Walgreens.

      --
      "Because Science" is one step from "Because old book". Try "Because of my experiment testing my falsifiable assertion".
    51. Re:Give those with low IQ jobs. by the_real_bto · · Score: 2, Insightful

      It is worth noting (IMHO) that there is nothing wrong with the business being selfish. Workers are selfish. I come to work to get paid, not to do a good deed.

    52. Re:Give those with low IQ jobs. by CapnChode · · Score: 1

      Agreed. Most of the fruits of civilisation were motivated by self-interest.

    53. Re:Give those with low IQ jobs. by idobi · · Score: 1

      Except that it's my company, and if I don't enjoy working here, and my employees don't enjoy working here, then I don't see the point. Overhead costs are part of doing business, and so long as we're profitible, the cleaners stay.

      Again, i was addressing your original premise that "hiring decisions is not based on how much money the business earns as a whole". In our case, it very much was... and for the majority of small businesses - nearly half of all businesses in the us employ

    54. Re:Give those with low IQ jobs. by idobi · · Score: 1

      Except that it's my company, and if I don't enjoy working here, and my employees don't enjoy working here, then I don't see the point. Overhead costs are part of doing business, and so long as we're profitible, the cleaners stay.

      Again, i was addressing your original premise that "hiring decisions is not based on how much money the business earns as a whole". In our case, it very much was... and for the majority of small businesses - nearly half of all businesses in the us employ < 500 people - hires such as these are considered overhead, not production.

    55. Re:Give those with low IQ jobs. by CyricZ · · Score: 1

      No, I'm completely correct.

      Why is that? Because this is not, as you put it, a "superfluous system". It has a very practical and effective purpose.

      A conservative (one who claims to be a Republican, if you will) would most often not realize that, and would thus be against such a system. A libertarian, on the other hand, has considered the situation and realizes that there is a benefit, and said benefit far outweighs the costs.

      --
      Cyric Zndovzny at your service.
    56. Re:Give those with low IQ jobs. by C10H14N2 · · Score: 1

      If you earn more than $10 per hour, hiring someone else at $5 per hour to do your cleaning means more profits for your business. ...and I thought you just said wages have nothing to do with revenue.

      Chung Mee: Opium is my business. The bridge mean more traffic. More traffic mean more money. More money mean more power.
      Lawrence Bourne III: Yeah, well, before I commit any of that to memory, would there be anything in this for me?
      Chung Mee: Speed is important in business. Time is money.
      Lawrence Bourne III: You said opium was money.
      Chung Mee: Money is Money.
      Lawrence Bourne III: Well then, what is time again?

    57. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      ah yes, the solution to the runaway train of welfare claims. But then you would be taking away their "raises", and with the climbing cost of living, who on welfare would do that for a one time bonus? I think a tax credit would be more of an incentive. -AC

    58. Re:Give those with low IQ jobs. by the_real_bto · · Score: 2, Insightful

      I believe the grandparent made an assumption that immigrants == low skill. That may not be always true, but it certainly is true some of the time. Those illegal workers are often paid beneath the minimum wage. That supports the grandparent's point that there are jobs available for people willing to accept less than minimum wage.

    59. Re:Give those with low IQ jobs. by mOdQuArK! · · Score: 1
      pparently her brain continued developing normally in the absence of intellectual stimulation in the dark attic.

      More likely her brain development occured rapidly _after_ being rescued that she was able to catch up with her peers within two years. The links you pointed to say that she was freed when she was 6 years old - at that age, there's still plenty of brain "elasticity" to show good improvement into her adulthood.

      It's hard to say how intelligent she could have been if she had received excellent mental stimulation from her infanthood, however. She could have possibly been much more intelligent than her peers.

    60. Re:Give those with low IQ jobs. by Eli+Gottlieb · · Score: 2, Insightful

      The parent poster is quite correct, and I'm at a loss to understand why this post has been so misread. Read your Huxley, people!

      As more and more can be done cheaply by machine or by a Third-World laborer whose work is priced comparably the pool of useful employment for those desiring a living wage actually shrinks to only those jobs that can't be replaced with either cheap uneducated labor or machines, ie: the jobs of the ever more highly educated and the jobs of management. However, even if everyone in the society possessed the innate intelligence and/or the will to study necessary to attain such education for such a job, there would not be enough work to employ them all.

      This is because capital flows in our economic system to those who make the most with the least, those who make widely demanded commodities or perform profitable services with the least skilled labor. Therefore, they will invest it in increasing their own profits, and an easy way of doing so has been found to be decreasing the amount of labor necessary to operate the business. Thus the laborer, both skilled and unskilled since the compensation in time, money and benefits of unskilled labor tend downward as technological progress tends upward, is forced into cycles of eternal retraining for the Next Big Innovation that will bring back demand for his hours, even though that Next Big Innovation will inevitably create a saturated labor market (example: the IT boom) that will eventually result in deliberate labor-cutting measures once best practices have been decided upon.

      Something fundamental in this system must change, by evolution or revolution, or the demand for labor will eventually shrink so low that only unionized government employees, managers, economic and political policymakers, and the bureaucratic glue-people who perpetuate a system they deliberately make too convoluted for any machine will be left employed.

      OK, you can start refuting me in 3... 2... 1... GO!

    61. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      All this talk of efficiency and none about what the goal is? Seems hard to calculate the "efficiency" of society without being able to measure our achieval.

      we'll take care of that. you shut the f*ck up.

    62. Re:Give those with low IQ jobs. by Bloke+down+the+pub · · Score: 1
      society as a whole is better off if there are opportunities available to those who cannot compete in the job market based on their (lack of) intelligence.
      Sounds like a justification for the existence of lawyers.
      --
      It's true I tell you, feller at work's next door neighbour read it in the paper.
    63. Re:Give those with low IQ jobs. by mrchaotica · · Score: 1
      How do one decide which people are productive?
      Well, executing everyone serving a prison sentence of, say, more than 5 years would be a start. Next you'd eliminate the nursing homes and homeless shelters, and then continue in that manner until you stop finding obvious candidates. Everyone else (e.g. those who are currently unemployed but previously worked enough to acquire enough assets that they aren't homeless, etc.) would get the benefit of the doubt.
      What if the people who make this decision become unproductive?
      That's the harder question. I suppose we'd figure that out the same way we do now (and it'd work just as poorly).

      By the way, part of Stalin's problem was that communism on a large scale like that has terminal issues to begin with, and another part was that he was incredibly paranoid and probably delusional. It would probably work much better to have a consistent and well-defined heuristic system to decide who to execute, instead of doing so at random as he did. A better analogy to the system I'm "proposing" (in the "A Modest Proposal" sense) would be Logan's Run, I think.
      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    64. Re:Give those with low IQ jobs. by CapnChode · · Score: 1

      idobi, if that's how you want to run your business, you're free to do so. Perhaps my premise needs to be reworded to reflect what I meant. Very well, "It makes economic sense to hire someone only if his productivity is greater than his wage. An employer who adhered to the principles of economics would hire without regard to current overall productivity, as in such a case hiring would only increase productivity". However, you provided three examples you thought were unproductive, and I countered with reasons that hiring those people would lead to greater productivity. Your original premise was that "cleaning staff, secretaries and teachers don't produce income for a business", and I proved you wrong by citing three simple examples. The crucial point is that the increase in productivity is provided by other employees, as their time is freed up by the hiring of this new employee, and hence the three jobs you listed are indeed productive.

    65. Re:Give those with low IQ jobs. by mrchaotica · · Score: 1

      Not quite. What you propose is a solution for those who are marginally productive, but not enough so to support raising children. I was talking about those who are so completely unproductive that they couldn't even support themselves.

      Also, I don't think letting successful members (wealthy, intellgent, etc) remove themselves from the gene pool is such a good idea. If you're going to start talking about eugenics, you might as well do the opposite and force them to breed.

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

    66. Re:Give those with low IQ jobs. by CapnChode · · Score: 1

      Read my revision, it's what I really meant.

    67. Re:Give those with low IQ jobs. by Slime-dogg · · Score: 1

      My experience has shown that IQ has very little, if anything, to do with the ability to do a job. Some of the most intelligent individuals that I have met have shown a distinct lack of creativity, for instance, while some of the most creative individuals I've known have not been able to solve their way out of a paper sack. Let the individual's talents and preferences dictate the job that they'll do, not their IQ.

      --
      You need to restart your computer. Hold down the Power button for several seconds or press the Restart button.
    68. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      It may cost more money to hire people, but if you have to do it yourself to save money, how much money are you losing by not being able to do the things you need to do. I am in business for myself, and it would be much more profitable for me to hire someone to help me out, than to do everything myself. But then it is hard to find competent help.

    69. Re:Give those with low IQ jobs. by omnix · · Score: 1

      Isn't it funny how they (those who abuse the welfare system) can't seem to keep a job (theoretically due to low IQ), but all of a sudden they become mathematicians when it comes to welfare vs paid sterilization. The irony astounds me...

    70. Re:Give those with low IQ jobs. by testpoint · · Score: 2, Interesting

      Anecdotal experience leads me to believe that if you stay on at a "burger flipper" job for more than a year you could be the manager. My son went to work for a pizza place to earn money while at college. The turnover was so high that he learned all the positions in 6 months. When the assistant manager quit, he got that job. When the manager quit he got that job. By the end of 18 months he was offered stock and a position in their corporate IT department.

      I also have a friend who started at McDonalds and now owns four McD's - so it can happen.

    71. Re:Give those with low IQ jobs. by omnix · · Score: 1

      Can we also execute those people who are intentionally "holding-out" by feigning ignorance?

      Does anyone know a word for this? Disingenuous comes close, but it has the wrong connotation.

      Education ought to be the biggest growth industry in the developed world right now... - Yeah, it's a stolen sig, whatcha gonna do about it?

    72. Re:Give those with low IQ jobs. by VAXcat · · Score: 1

      That reminds me of the situation in IT I've encountered at my last two jobs. The sysadmins and network people at these two mega corporations are all of the sort that just fell into computers from other fields, with no real background, education (or, in many cases, interest) in computers. They sort of flail along, day by day, rebooting things and clicking on wizards to get by. You't think I, with a lifelong burning interest in computer science, lots of education on the subject, and wide experience in admin, networking, and programming could really stand out in these situations? Oddly enough, it's not the case. These homegrown computer types are extremely suspicious of any high falutin' technical concepts, and certainly don't trust anything they can't understand. The mere ability to write a Perl script to automate a simple task at these two sites is viewed with exterme suspicion. At these two places, it's a case of the one eyed man in the country of the blind being in for a rough ride....anyone else encounter similar IT departments?

      --
      There is no God, and Dirac is his prophet.
    73. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      Yeah, and your one data point obviously represents the norm.

    74. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      I don't know were you are from, but in New York State (known for one of the highest minimum wages in the USA) I was making $2.85/hour (minimum wage) working at a burger joint in 1992. As far as I know, that is only 13 years ago, not 25.
      But my ignorance of high school economics might be effecting my ability to subtract 1992 from 2005.

    75. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0
      People who bitch about the minimum wage betray their utter ignorance of basic high-school level economics.

      And you seem to betray your ignorance of the millions of immigrants currently in the U.S. working illegally for less than minimum wage.

    76. Re:Give those with low IQ jobs. by arpk4n3 · · Score: 1

      Erm....Federal minimum wage, at $5.15 an hour, is well below the poverty level for a normal (40 hour) work week.

      However, state regulations MAY vary! In Ohio, for example, if a company makes under $150,000 a year, as many small businesses do, minimum wage is $2.80/hour. Employers who make $150,000 to $500,000 annually? $3.35 an hour. State law mandates $4.25 an hour as minimum wage.

      Your anecdote about your family business, is quaint, but does nothing to address the issue. People who bitch about minimum wage have a right to bitch about it--it's interdisciplinary economics. The idea of a living wage isn't exactly new, that was the POINT of minimum wage at one point in time, until rampant inflation occured. The fact is that many capitalist/consumerist establishments, ie businesses, seek only a larger profit margin and by paying their employees less--even the $5.15 an hour federal minimum wage--as companies such as Wal Mart often do, it impacts society as a whole. The rich make more money, the lower class works more in order to be able to live. The middle class decreases as poverty increases (which it has, since Bush took office in 2001). Capitalism rose within the middle class and cannot exist without it.

      So no, I can't let you get away with that blatant ad hominem against those who support a living wage. People who bitch about the minimum wage don't 'betray their utter ignorance of basic high-school economics'--(a) it's neither basic, nor high-school level, (b) it has profound impacts upon a society, and (c) your appeal to authority/emotion were cute but don't do anything to muffle your argumentem ad ignorantiam.

    77. Re:Give those with low IQ jobs. by arpk4n3 · · Score: 1

      Link to Ohio minimum wage law, here. Forgot to include it in the post.

    78. Re:Give those with low IQ jobs. by gg3po · · Score: 1

      An illegitemate child named Isabelle was locked in a dark attic for years with her deaf and mute mother and no toys. http://www.google.com/search?q=%22locked+in+an+att ic%22+iq

      She caught up with her peers within two years of being rescued and was found to have a normal IQ. Apparently her brain continued developing normally in the absence of intellectual stimulation in the dark attic.

      Then she was the exeption and not the rule. Most feral children (the ones that don't learn speech, etc. in the formative years) never learn speech and basically behave like animals for the rest of their lives.

      --
      ---
    79. Re:Give those with low IQ jobs. by Lord+Ender · · Score: 1

      I came from a rather large high school in the US. We didn't have any courses in economics available to us. What is "high school level economics?" Or did I just miss out?

      --
      A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
    80. Re:Give those with low IQ jobs. by Ignignot · · Score: 1

      It is a little odd that you would reference a paper focused on debunking the importance of genetic predisposition and then say how her brain continued development without any social interaction. One can only assume that such development was the result of nature, because there was no nurture. I think you missed the entire point of the paper - she scored a zero on an IQ test given shortly after she left the attic, and only once outside stimulation was introduced did her intelligence develop. Now you can argue that her intelligence is not the same thing as her brain, but your intelligence is what usually matters when determining how productive you are in society.

      --
      I submitted this story last night, and it didn't get posted.
    81. Re:Give those with low IQ jobs. by Lord+Ender · · Score: 1

      It seems like your area is different than the rest of the US. In the midwest, the only times I encounter mexican immigrants (legal or not) are in food service or other low-skill occupations. I've been to socal. There are a lot more mexican immigrants and so there is more spread in terms of job skill level. But the average still tended toward the low end of the skill spectrum. You obviously have more experience with socal than I do, though.

      --
      A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
    82. Re:Give those with low IQ jobs. by japhmi · · Score: 1

      In 1980, when the minimum wage exceeded $3/hour, my family business--running out of, basically, our freaking garage--paid our employees $40k/year. Yeah, the minimum wage really got in the way.

      So, what you're saying is that because you paid more than minimum wage to your employees, that means that companies that were paying minimum wage weren't impacted by any minimum wage increases? That your company's experiences are universally applicable?

      --
      "Giving money and power to government is like giving whiskey and car keys to teenage boys" P. J. O'Rourke
    83. Re:Give those with low IQ jobs. by C10H14N2 · · Score: 1

      You got the implication of my statement quite backwards. First, a logical argument wasn't my goal. This "we don't need no stinkin' minimum wage" line is such a tired old saw, I see little need to respond with a perfectly formed sophomoric logical argument, since the offending remark certainly is anything but.

      Second, yes, it was an anecdote, duh. Yes, I have a social sciences degree. I get the difference between anecdotal evidence and statistical significance, okay? Neither one negates the other.

      Third, the rest of the body of your statement WAS PRECISELY MY POINT, albeit, stated purely as derision. This harkening back to the bad old days of yore with unbridled capitalism is just a laughable folly of those who wish they were rich, but most of the time aren't. They'd prefer a world where you could have slave labor, at their own peril, if only they could have slaves.

      Frankly, such people don't deserve a polite, well-reasoned, logical response.

    84. Re:Give those with low IQ jobs. by mandolin · · Score: 1

      In the situations I've seen, not speaking passable English is a good way to keep yourself limited to the lower end of the job spectrum. Also, most higher-ranking jobs demand proof of citizenship. Sorry if this seems like flamebait.

    85. Re:Give those with low IQ jobs. by Hognoxious · · Score: 1

      I've got the 1970s on the other line. Apparently, they want their politics of envy back.

      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
    86. Re:Give those with low IQ jobs. by Frank+T.+Lofaro+Jr. · · Score: 1

      People who bitch about the minimum wage betray their utter ignorance of basic high-school level economics.

      That describes a whole political party in the US.

      --
      Just because it CAN be done, doesn't mean it should!
    87. Re:Give those with low IQ jobs. by Hognoxious · · Score: 1
      IQ has very little, if anything, to do with the ability to do a job. Some of the most intelligent individuals that I have met have shown a distinct lack of creativity
      Yes, there are so many undiscovered ways to fry a burger. First on this side, or first on that side?
      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
    88. Re:Give those with low IQ jobs. by Gilmoure · · Score: 1

      Are you refering to the idea that 4000 years of recorded history provides evidence that people with inherited wealth and power are more destructive to society than the average Joe?

      --
      I drank what? -- Socrates
    89. Re:Give those with low IQ jobs. by ccmay · · Score: 1
      However, state regulations MAY vary! In Ohio, for example, if a company makes under $150,000 a year, as many small businesses do, minimum wage is $2.80/hour

      State regulations may mandate a minimum wage higher than the Fed standard, but not lower.

      -ccm

      --
      Too much Law; not enough Order.
    90. Re:Give those with low IQ jobs. by h4rm0ny · · Score: 1


      I would at least like criticism to be directed to what I said, rather than what you thought I said. I'll go through your points quickly:

      Why would you guess his reference to efficiency was measured purely by the GDP?

      The OP said that eliminating society's less intelligent people would increase its efficiency. I think my interpretation of his statement was a reasonable guess. My first point was that talk of efficiency without a stated goal was an invitation to question the underlying assumptions the poster was making. And I accepted.

      Your gloom and doom scenario of "dumbing down" society having a catastrophic effect is flawed. I didn't project a "dumbing down" of society. At all! If you read my post, you'll find I'm addressing the problems caused by an increasing capability on the part of mankind.

      These "slower" people don't just go away, and by ignoring them and their needs you are creating social problems.

      What part of "adult education should be the biggest growth industry" did you not understand. I am not creating social problems. I'm saying that reducing the need for work to get by creates a social problem.

      I'm sure you're frustrated that you have to work 40 hours a week because some guy with a GED needs something to do to keep him off the street - but the original poster's argument wasn't addressing GDP

      No, I'm not. Spending on benefits here in the UK is a tiny part of the overall distribution of public spending. And I actually enjoy my work. It is socially useful and I'm relatively proud of it. You seem to have fixed on some stereotype of who you're arguing against and as a result you are addressing things I've never raised.

      And this business about the "pressure to be brilliant" sounds like elitist nonsense.

      What I said that as technology enables necessary work to be done by fewer and fewer people (automation, computation, transportation, telecommunication), in order to find work, we require ever greater levels of ability (education and dedication) which translates into pressure to be brilliant. What is elitist in that? It applies to all of us. What is nonsensical in that? The logic seems clear enough to me?

      Children are rarely aware of these social issues in their developmental years, and that's where brilliance emerges - not suddenly in the workplace somewhere in their 20s.

      Now that sounds like nonsense if anything does. Many scientists and artists only begin to show their brilliance after university years. I'm one of them. And depending on your definition of children, many are very aware of social issues. If you grew up in a family dependent on benefits, or in a third-world country, or in Eastern Europe, you would be from an early age too.

      It's insulting to make assumptions about people you don't know. And you have made several assumptions about me in your post that are contradicted by an actual reading of what I said.

      --

      Aide-toi, le Ciel t'aidera - Jeanne D'Arc.
    91. Re:Give those with low IQ jobs. by Forge · · Score: 1

      It's not an IT thing.

      Dumb people try really hard to not have subordinates smarter than they are.

      It just shows them up.

      I have for instance seen an entire government jeopardized because the prime minister is an ass and surrounds himself with ministers even dumber than he is. Those ministers then employ senior civil servants, board members and consultants at an even lower level of the intelligence scale so that the only competent people in the whole government beurocrasy are are at relatively low levels and conceal this fact so as to not louse the job.

      Note: I said "Prime Minister", Not President. Not everything is about America.

      --
      --= Isn't it surprising how badly I spell ?
    92. Re:Give those with low IQ jobs. by h4rm0ny · · Score: 1


      THANK YOU! I think people are so primed and ready to argue with some stereotype that they dislike, that they see it where it isn't. So far I've been accused of being both anti-capitalist and a social elitist. Heck of a combination for someone who was proposing that adult education should be a growth industry!

      Maybe I didn't put it as clearly as you did, though. I think of your predicted outcomes, the stealthy coup of the bureaucratic glue people is the one that's currently coming true. Certainly in the sector I work in (the UK's National Health Service), there seem to be more and more people appearing whose sole function is to either fill in forms or demand forms, none of which are needed.

      I think the way the UK is heading, there will ultimately be three sectors of society. Those who create forms, those who fill in forms, and one person whose job is to press a button every morning to make the machines work.

      --

      Aide-toi, le Ciel t'aidera - Jeanne D'Arc.
    93. Re:Give those with low IQ jobs. by arpk4n3 · · Score: 1

      ...actually there are occupational exceptions, as well as exceptions based upon the revenue of a company. That's what I specified, and again, check the Dept of Labor's website if you don't believe me. http://www.dol.gov/esa/minwage/america.htm

    94. Re:Give those with low IQ jobs. by stanmann · · Score: 1

      Concur. After 3ish years at Wendy's I was offered a Store of my own. I elected not to go that route, even though I would likely be earning as much or more than I am now.

      --
      Food not Bombs is a nice platitude but it breaks down when you notice that the Bombees are usually well fed
    95. Re:Give those with low IQ jobs. by Knuckles · · Score: 1

      1. The fact that he gave me definition doesn't change the fact that it depends on it
      2. The quotes don't make it clear to me at all, he still said that most efficient could be considered best
      3. If I had a nickel for each time someone misapplied Godwin's law, yadayada. It's not intended to prevent every reference to Nazism

      --
      "When I first heard Daydream Nation it quite frankly scared the living shit out of me." -- Matthew Stearns
    96. Re:Give those with low IQ jobs. by soren42 · · Score: 1

      So, basically, you're saying "Find all the people who spend their work days reading and posting on Slashdot, and execute them."

      Probably not a popular idea on here. :)

      --

      "Adventure? Excitement? A Jedi craves not these things."
    97. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      um, inflation ring a bell?

      Ironically, inflation tends to counteract the effects of minimum wages, which is to price the lowest-end jobs out of existence (in the same way unions do for higher-end jobs).

    98. Re:Give those with low IQ jobs. by C10H14N2 · · Score: 1

      There's a mythology here that the minimum wage is the driving force of inflation. It's not. If we legalized slavery, we'd still have inflation. The fact is, if you roughly doubled the minimum wage every twenty years, for nineteen of those years, employers would actually be paying LESS each year over the previous year. When the adjustment is made, they would likely still be paying less than they were the first year, since all their other revenue and costs would have been _continuously_ adjusted for inflation, minimum wage increase or not.

    99. Re:Give those with low IQ jobs. by ccmay · · Score: 1
      Look again, pal. It says this right at the top of the page you directed me to:

      Note: Where Federal and state law have different minimum wage rates, the higher standard applies.

      A state law that allows a lower minimum wage than the Federal law for any given employment circumstance is moot.

      --
      Too much Law; not enough Order.
    100. Re:Give those with low IQ jobs. by sandmaninator · · Score: 1


      A goal for society is a very subjective idea. Obviously people will disagree on what that goal should be. But, it's irrelevant because the truth is that humans are subject to the same evolutionary forces that the rest of the species on this planet are.
      As long as there is a group of people on this planet willing to put in the long hours and then use all their excess resources to bomb the piss out of anyone not like them, arguments about what a societal group _should_ do is irrelevant. Evolution does not take morality into account. The one who kills the other is the winner and that is not a "good" or "bad" thing. It just is.

    101. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0
      Note: I said "Prime Minister", Not President. Not everything is about America.

      Would it be culturally insensitive to ask whether you're being ironic?
    102. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      Perhaps you are thinking of a utilitarian for whom such calculations may matter. For a libertarian, it is a non starter. The math doesn't matter. Consider the number of anarcho-libertarians for which there is no (government) system.

      As for Republicans, perhaps you have massively underestimated the growth of government (or systems, if you will) under their leadership. Bush 2 has outdone LBJ in the spending growth and that is just his first term.

      You are misusing the term libertarian because you fancy yourself one and similarly you confuse your beliefs for that of libertarian philosophy (or philosophies - as it is not strictly codified like Objectivism). Not like Republicans or "conservatives" you take a shot there ignorant of how much you likely have in common. Libertarian = mimimal and/or no state. A make-work scheme to keep idle, devilish hands busy is a harbinger of the welfare state - the Republicrats or whatevers. It has jack to do with classical liberalism or libertarianism. Find a reference that states otherwise. Please!

      http://en.wikipedia.org/wiki/Libertarian

    103. Re:Give those with low IQ jobs. by Morgalyn · · Score: 1

      ..... well, that's hyperbole for you. But you're making a point here which I'd like to expand on. If you want to go with the logic that people with low IQ (a measurement of 'brightness' in our current society: the ability to do a job, make rational decisions, follow cause and effect, function in society, etc.) end up outside the work system, then a further thing to consider is /welfare/. I used to have neighbors with way, way too many kids. Their entire income was welfare-based, because they professed an inability to get jobs due to lack of training. They had as many kids as they could, since that provided them more income.

      If you want to make a connection between intelligence (based on an IQ test) and genetics, then you have to examine a situation like this. It's only encouraging people who could not fit into the system already to have MORE offspring, thus creating MORE people with the same problem. Meanwhile the rest of us are generally waiting until 'the time is right' to have our 1-3 (on average) children.

      --
      You say you got a real solution
      Well, you know
      We'd all love to see the plan
      (The Beatles)
    104. Re:Give those with low IQ jobs. by werewolf1031 · · Score: 1

      Touché. :)

    105. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      Hmmm. Maybe the initial and subsequent comment were too harsh. Maybe by "system" you simply meant it would be nice if society had such work available (clue: in an unfettered economy, they almost always do - no economies are even unfettered for anybody anymore). However, nothing could be reconciled with your misconception of what a conservative (or Republican, if you will) would think. First of all, conservative is not as never has been any particular philosophy. It is hodgepodge and it is impossible to predict outside of narrow, pointless issues and only then within the confines of the USA. However much I despise all politicians of both branches, when you brand one side for distinction without qualification, it is only your own ignorance that is revealed. The similarities have long outweighted any differences.

    106. Re:Give those with low IQ jobs. by schon · · Score: 2, Funny

      it's better to have a system in place that gives such people something productive to do

      You mean like Telephone Sanitizers, Management Consultants, and hairdressers? :o)

    107. Re:Give those with low IQ jobs. by arpk4n3 · · Score: 1

      You're telling me that there aren't people in Ohio who get less than $5.15 an hour, then? Because that's just simply not true. Even among waiters and waitresses who are supposed to get subsidised by tips, they make less than $4 an hour. Note, that's just the minimum wages for those occupations not taken with exceptions, or as you called it 'employment circumstance'.

      "Like the Federal wage and hour law, State law often exempts particular occupations or industries from the minimum labor standard generally applied to covered employment. Particular exemptions are not identified in this table. Users are encouraged to consult the laws of particular States in determining whether the State's minimum wage applies to a particular employment. This information often may be found at the websites maintained by State labor departments. Links to these websites are available at www.dol.gov/esa/contacts/state_of.htm."

      RT[whole]FA

    108. Re:Give those with low IQ jobs. by michaelhood · · Score: 1

      I grew up in Ohio. I'd say the reason for that is no one speaks Spanish in Ohio, so they can only put the immigrants in positions that don't require much communication. I'm not saying it's the employers' fault at all, but simply that I expect thats the reason they are placed in lower-skill jobs. There is a correlation between lower skill and lower level of communication necessary.

    109. Re:Give those with low IQ jobs. by japhmi · · Score: 1

      There's a mythology here that the minimum wage is the driving force of inflation. It's not.

      I never said it was (in fact, I didn't mention inflation). However, since you brought it up, minimum wage is a driving force, not the driving force.

      My problem with minimum wage is that some people try to claim that one person minimum wage should be able to support a family. If someone is working a minimum wage job to support a family, then what they need is a better job (and more opportunities), not a higher minimum wage.

      --
      "Giving money and power to government is like giving whiskey and car keys to teenage boys" P. J. O'Rourke
    110. Re:Give those with low IQ jobs. by Velox_SwiftFox · · Score: 1

      Well, in a society that would reward stupidity as proposed in the subject -- and where doing too well on an intelligence test while applying for a police officer job can get you excluded, as in our current one -- Darwin's theories might really kick in should the economy get bad enough, assuming that ability counts for anything.

      Should any portion of the criminally population be intellifgent, I still contend that it would be counterproductive to concentrate on preferentially removing the evidently stupid ones.

    111. Re:Give those with low IQ jobs. by C10H14N2 · · Score: 1

      ...at $5.15/hr that's $29/day ($872/month), even renting a room in most american cities, a round cost of about $300/month, that leaves $572/month. Consider, say, that that person is spending $3/day in bus fare. That's $100/month, leaving them with $472. Sure, they need a better job, but, face facts, at less than that, save for infinitessimal chance, it is nearly impossible for someone to move up from that. That's what minimum wage is for -- to ensure that the majority of people who find themselves at the bottom of the economic barrel are paid just enough to be able to lift themselves up. If they were paid less, there would be no hope. It's one thing to say "gee, get a better job" when you don't factor in how much it _costs_ to get a better job. Really reveals a great deal about the people casting stones...

    112. Re:Give those with low IQ jobs. by big_daddy_mpd · · Score: 1

      "Hey, better yet, why not just preemtively lock up anyone with a sufficiently above-average IQ?" It's happened already, in China. It was called the "cultural revolution". One way to get locked up, was to be "an intellectual", which is "redspeak" for "smart". Being smart is already its own punishment. We have to work for power hungry politicians, that constantly force us to carry out their ludicrous initiatives without complaint. I've always said it is indeed stressful to be a smart person in a world full of dullards. Especially when you work for them, and they control you and your family's prosperity! Regards, Big

    113. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0
      Do you know what the bad ones who get "weeded out" under such a system do when they can't find a job? They steal your car and sell cocaine in order to get by.

      I have to disagree with this commonly held view.

      Every drug dealer/criminal that I have ever known did it because they liked the lifestyle/image, not to get by. When I used to do it it was for the same reasons, easiest time I ever had getting laid, no effort at all. Lots of the ghetto looking thugs you won't look at when you see on the streets are in reality just bored, well above poverty suburban kids, not anyone struggling to get by. That's why they do such dumb shit, they're trying to live an image, not to survive. How do you think they can afford those rims?

      People who are really struggling don't have time for that shit. They're usually too busy bouncing around shit jobs and trying to forget about their life.

      If you want to lower crime, kill the criminal image to those who like it. And good luck with that, don't ask me how to do it.

    114. Re:Give those with low IQ jobs. by mOdQuArK! · · Score: 1

      That's kind of the reasoning I was follownig, although I was primarily poking fun at the simplistic, brutal idea of the poster who I was responding to.

    115. Re:Give those with low IQ jobs. by japhmi · · Score: 1

      That's what minimum wage is for -- to ensure that the majority of people who find themselves at the bottom of the economic barrel are paid just enough to be able to lift themselves up.

      Except that I lived at minimum wage for a long time, so I know a little bit from experience. I was able to live, eat, and pay for half-time tuition at a state university (no financial aid) (granted, my state has a higher than federal minimum wage, but I also was working on campus and couldn't work full time). The problem is that you have to pay the same minimum wage to high-school kids who dont need say $436/month of spending money (that's half of what you said for someone working full time).

      If there was age-graudated minimum wages, this would help.

      --
      "Giving money and power to government is like giving whiskey and car keys to teenage boys" P. J. O'Rourke
    116. Re:Give those with low IQ jobs. by Anonymous Coward · · Score: 0

      Umm.. did you read the article you posted?

      When she was first released she acted like a wild animal to strangers (fear, hostility).
      She scored a zero on an IQ test because of her inability to communicate.
      It was only after two years of training that she was brought up to normal levels.

      That sounds a lot like "brain development won't occur if people aren't _challenged_ to think."

    117. Re:Give those with low IQ jobs. by Forge · · Score: 1

      Nope.

      But thanks for pointing that out.

      --
      --= Isn't it surprising how badly I spell ?
    118. Re:Give those with low IQ jobs. by Error+of+Ruto · · Score: 1

      Actually, the strictest of libertarians would disagree. They'd be wrong, but they'd disagree.

    119. Re:Give those with low IQ jobs. by C10H14N2 · · Score: 1

      There is. The federal minimum wage exempts 15-18yos and unpaid for children under 15 working in family businesses (with time restrictions), tipped employees and allows for interns and academic work-study. For most of those, iirc, it is $2.85. States can require higher, but they cannot allow lower. Most businesses do not take advantage of that because it's just bad form and doesn't encourage much effort. However, in a work-study program, the universities only have to pay $2.85 and the federal government pays $2.30. There's PLENTY of graduation in the current system.

      As for the campus routine, a university experience hardly comes close to a "real-world" experience. You're probably living in on-site subsidized housing, eating subsidized food, have subsidized medical care on-site, most likely have roommates essentially provided for you in guaranteed housing with fully paid utilities.

      That's a far cry from an adequate example to prove that the minimum wage is anything but poverty level. But, $10,712 per year, yes, is enough to survive. That's the !#%ing POINT. If it was less, it would NOT be enough to survive without some other subsidy, be it the local homeless shelter, food bank, welfare, generous uncles, street johns, whatever.

    120. Re:Give those with low IQ jobs. by japhmi · · Score: 1

      However, in a work-study program, the universities only have to pay $2.85 and the federal government pays $2.30. There's PLENTY of graduation in the current system.

      I guess I'm just used to my state - where the minimum is the minimum.

      As for the campus routine, a university experience hardly comes close to a "real-world" experience. You're probably living in on-site subsidized housing, eating subsidized food, have subsidized medical care on-site, most likely have roommates essentially provided for you in guaranteed housing with fully paid utilities.

      I lived off-campus, got food at the supermarket, never had anything to do with on-campus medical care, and I had to pay utilities with my roommates in the place we rented. Plus I had to pay tuition.

      But, $10,712 per year, yes, is enough to survive. That's the !#%ing POINT. If it was less, it would NOT be enough to survive. without some other subsidy, be it the local homeless shelter, food bank, welfare

      Okay, so we come to the point (after going through inflation, and how it's not enough to live alone etc.) Less then the minimum wage requires some sort of help to get out of it. Even the minimum. I'm all for that. If someone comes to a government agency saying "I want more out of life, and I can work for it," then I say we try to get them whatever they need to get that better job. If we just keep raising the minimum wage, then THAT becomes the solution to the problem of the working poor, not education or something to give them a real leg-up on life. It's a patch, not a true fix.

      --
      "Giving money and power to government is like giving whiskey and car keys to teenage boys" P. J. O'Rourke
  44. Use the Preview Button! by tepples · · Score: 2, Insightful

    Who would have though the letters between "" would be filtered out when selecting html formatted?

    Anybody who can read and understand the notice "Use the Preview Button!", written immediately below the comment textarea, could have predicted it.

  45. What is smart exactly? by bigberk · · Score: 4, Insightful

    Yes some people definitely have, genetically, an intellectual advantage over others... but as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.

    Let's say you're a genius, some child prodigy who's super at calculus or something.

    Can you charm women and get laid?

    Can you get along with strangers and keep a stable job?

    Are you smart enough to stay out of trouble? Avoid fights, etc.

    Are you smart enough to choose good friends?

    Are you disciplined enough to manage our finances?

    Are you street smart enough to protect your wealth from crooks?

    Do you get regular exercise and stay in shape?

    These are all things that are very important for a good quality of life, and you don't necessarily get 'em just because you are smrt.

    1. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      Yes, smart people can do those things when they wish. I wasn't born with any common sense at all, yet I've consciously learned everything on your list. Women are easy as shit if you know how to handle them, I can arrange my facial expression however I please and thus get along with _anybody_ when it suits my purpose, and anyone in the world can carry a clearly displayed knife to avoid muggers. You don't have to be born with those things, but you do have to be born with intelligence.

    2. Re:What is smart exactly? by Anonymous Coward · · Score: 1, Funny

      Yes some people definitely have, genetically, an intellectual advantage over others... but as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.

      Let's say you're a genius, some child prodigy who's super at calculus or something.

      Can you charm women and get laid?
      Are you smart enough to stay out of trouble? Avoid fights, etc.

      Aw... You're seventeen now rather than twelve. Isn't it cute how people's priorities change once they hit high school..?
    3. Re:What is smart exactly? by An+Onerous+Coward · · Score: 1

      A lot of the attributes you allude to have more to do with personality and temperament than intelligence.

      For example, I'm not exactly "disciplined" about money, but I always seem to have enough for my needs, because I have a deep-seated, irrational aversion to spending money. I've been that way for as long as I can remember. I think it means some genetic switch is stuck on "scarcity". The alternative--that I have incredible foresight and discipline--seems really farfetched to me.

      "Staying out of trouble" and "avoiding fights" also seems to be primarily driven by temperament, not intelligence.

      My guess is that you're referring to these things as kinds of "intelligence" because these differences in temperament lead some people to behave in ways that act to their long-term benefit, while leading others to act self-destructively. But that definition of intelligence seems overly broad to me.

      --

      You want the truthiness? You can't handle the truthiness!

    4. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      Aw... You're seventeen now

      Curses, you're actually about twenty two. Doesn't change the fact that you're a social reject who can't get laid, though.

    5. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      Let's say you're a genius, some child prodigy who's super at calculus or something.

      Can you charm women and get laid?


      That would lead to my partners getting arrested for statutory, unless no one else found out ;)

    6. Re:What is smart exactly? by penguinoid · · Score: 1

      Hm, can we count genes for health and longeivity as genes for intelligence? Because, you know, dead people have an IQ of 0 :-). I think that one of your questions is answered by EQ, the emotional/social version of IQ.

      --
      Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
    7. Re:What is smart exactly? by syousef · · Score: 2, Insightful

      Let's say you're a genius, some child prodigy who's super at calculus or something.

      Can you charm women and get laid?


      Given this is number one on your list of things I'd hazard a guess that you:
      a) Are desperate
      b) Don't have any understanding of how to relate to women
      c) Not all that smart

      There's more to life than getting laid. Even when you're not getting any it shouldn't be number one on your priority list!

      --
      These posts express my own personal views, not those of my employer
    8. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      Or more importantly: are you smart enough to not want children? If smart people don't want children, can see the consequences of their action further then other people, than that smartness gene is not going to have an advantage over others.

    9. Re:What is smart exactly? by DNS-and-BIND · · Score: 1

      Let me guess, you're a virgin. Or a woman. How can any man say that getting laid is not priority one? Of course it's top priority.

      --
      Shutting down free speech with violence isn't fighting fascism. It IS fascism!
    10. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      Not everyone thinks the same way. Sure, sex is important, but I would give it up before a lot of other things in my life.

    11. Re:What is smart exactly? by jgardn · · Score: 1

      In my experience, as someone with a high IQ, IQ has little or nothing to do with success or even smarts. I've looked around myself and I see people with average IQs perform better than myself and IQ-equivalent peers. Why? Because they work harder.

      In the end, it's not what you are given that determines your success. It is what you do with it. And that means work.

      --
      The radical sect of Islam would either see you dead or "reverted" to Islam.
    12. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      Idiot.

    13. Re:What is smart exactly? by syousef · · Score: 1

      Let me guess, you're a virgin. How can any man say that getting laid is not priority one?

      Let me guess. You're in your late teens or early twenties and sex is all shiny and new to you, besides you don't know how to get it very often, so it's your top priority. If your attitude is that getting laid is priority one, chances are that's why it stays number one - it's a viscious cycle - women can smell desperation and it ain't pretty. What's more mindlessly going after sex can get you into a heap of trouble. You can lose your money or go to jail for example all because you meet someone that's willing to give you some sex.

      For the record, I'm actually engaged, and while my sex life is none of your business I will say I'm not deprived. I have gone without in the past (before I met my fiancee) and you know what - it sucked, just not so badly I'd put it ahead of everything else.

      --
      These posts express my own personal views, not those of my employer
    14. Re:What is smart exactly? by ObsessiveMathsFreak · · Score: 1

      Let me guess, you're a virgin. Or a woman. How can any man say that getting laid is not priority one? Of course it's top priority.

      Uhhhhh... OK Let's try this again.

      "In this country, you gotta make the money first. Then when you get the money, you get the power. Then when you get the power, then you get the women."


      Tony Montana was crude and rather curt at times, but he certainly had an advanced understanding of how the world works. Ergo, he also possessed the smart gene.

      --
      May the Maths Be with you!
    15. Re:What is smart exactly? by Albinoman · · Score: 1

      Actually this is probably more valid than you think. Intelligence is certainly an evolutionary advancement, and some are more advanced than others. Someone who can naturally charm others will likely be more evolutionally successful. Some are more charming than others. If youre not picky, sex is easy cause everyone wants it. But, to be able to charm a specific person is a talent.

      Your last comment is perfect too. Intelligence was evolved to take over where evolution lacked enough time to adjust. It overrides your instincts. You dont eat your boogers anymore, dig through the garbage like your dog, or stay in a burning building. It also tells people that they dont have to hump everyone in sight. Well, most people anyways.

    16. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      I am disciplined enough to manage your finances.

    17. Re:What is smart exactly? by Ihlosi · · Score: 1
      Let me guess, you're a virgin. Or a woman. How can any man say that getting laid is not priority one? Of course it's top priority.



      Let me guess, you're not married.

    18. Re:What is smart exactly? by Anonymous Coward · · Score: 0

      You know, if it sucked then technically you're not 'not getting any'.

    19. Re:What is smart exactly? by Xugumad · · Score: 1

      I'd more read it as targetted to the /.ers with severe long-term problems with their love/sex lives, than a serious "Are you bright enough to be getting laid frequently". Maybe that's just me, though...

    20. Re:What is smart exactly? by hackstraw · · Score: 1


      I believe all of the above (except, smart is spelled smart and not smrt :)

      IQ is best described as a score on an IQ test. Sure, there is some correlation (external validity in the psychology testing vocabulary) to the outside world.

      There are aspects of IQ that are never measured on an IQ test. Ever play basketball with someone that was really good, and the guy was always at the right place at the right time? Some of these guys are exceptional at this and make millions a year. That is entirely a cognitive effort. Being tall and/or strong will not continuously put you in the right place at the right time on the court.

      What about one's ability to hunt and kill an animal and prepare it for food? This is basic stuff, but most everybody on the higher end of the "IQ" scale would not know how to do this. In fact, I would guess there is an inverse relationship between "IQ" and one's ability to do a basic survival technique like getting something to eat.

      Just some things for those with higher IQs to think about.

    21. Re:What is smart exactly? by DNS-and-BIND · · Score: 1

      Dude. Pussy is always top priority. No matter how much you get, and I'm certainly not deprived. The shiny and new never wears off of women...as long as you get a regular supply of shiny and new ones. Man of the world, my friend.

      --
      Shutting down free speech with violence isn't fighting fascism. It IS fascism!
    22. Re:What is smart exactly? by Forbman · · Score: 1

      But you should also look around and find the people who seem to work harder than anyone else around them, and yet they can barely keep their boat afloat, as they're constantly bailing water from one wave sweeping over the gunwales after another. They could be flippin' brilliant, but you'd never know just by watching them.

      If "it's not what you are given that determines your success. It is what you do with it. And that means work" were really true, most of the people in the world would probably feel like they should have the life of Donald Trump. Could we have asked John Henry (of the song) this question, he probably would have popped you a good one when the railroad crew boss wasn't around.

    23. Re:What is smart exactly? by TheRealSync · · Score: 1
      What about one's ability to hunt and kill an animal and prepare it for food? This is basic stuff, but most everybody on the higher end of the "IQ" scale would not know how to do this. In fact, I would guess there is an inverse relationship between "IQ" and one's ability to do a basic survival technique like getting something to eat.
      I would guess that one's ability to do a basic survival technique, like getting something to eat, would correlate highly with the quality and time spent training in this area. And considering that those with higher IQs are faster at learning, I'd guess those with high IQs would be better at providing for themselves (in a situation where everybody had the same training).
      --
      -- A good compromise leaves everyone mad. --Calvin and Hobbes
    24. Re:What is smart exactly? by smithmc · · Score: 1

        Let's say you're a genius, some child prodigy who's super at calculus or something.
      Can you charm women and get laid?
      Can you get along with strangers and keep a stable job?
      Are you smart enough to stay out of trouble? Avoid fights, etc.
      Are you smart enough to choose good friends?
      Are you disciplined enough to manage our finances?
      Are you street smart enough to protect your wealth from crooks?
      Do you get regular exercise and stay in shape?

      And how do we know that those traits aren't genetic as well? Certainly the ability to attract the opposite sex would be a trait ripe for natural selection, wouldn't it?

      --
      Downmodding is the refuge of the weak. Don't downmod, make a better argument!
    25. Re:What is smart exactly? by hackstraw · · Score: 1

      I would guess that one's ability to do a basic survival technique, like getting something to eat, would correlate highly with the quality and time spent training in this area. And considering that those with higher IQs are faster at learning, I'd guess those with high IQs would be better at providing for themselves (in a situation where everybody had the same training).

      It has yet to be proven that intelligence has any survival value.

      --Arthur C. Clarke

      Its a know fact that the higher your intelligence and education, the fewer offspring you have. Although, those do have a higher survival rate, but even accounting for that, there are and it seems as though that there will always be fewer "intelligent" guys than not.

      Maybe this will change, but the data do not support it.

    26. Re:What is smart exactly? by syousef · · Score: 1

      Here's a site you might find a use for:
      http://www.epigee.org/guide/stds.html

      Yeah have fun with that oh "man of the world".

      --
      These posts express my own personal views, not those of my employer
    27. Re:What is smart exactly? by cavemanf16 · · Score: 1

      OK, Tommy Boy...

      "There's two kinds of smarts, book smarts, which waved "bye-bye!" to you long ago, and street smarts, the ability to read people."

      You really shouldn't be learning your life lessons from a comedy movie starring Chris Farley and David Spade.

    28. Re:What is smart exactly? by PMuse · · Score: 1

      as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.

      People often say: play to your strengths. Why is this good advice? Because one trait can be used to compensate for another. Some examples:

      While actual social skills are the easiest way to get what you want from people (including bosses, employees, children, and objects of sexual desire), you can use high amounts of book smarts to manipulate people with varying degrees of success. Around here, we call it "social engineering".

      Actual self-awareness and control of one's emotions is the best way to maintain stable relationships (e.g. at work), but again, a smart person can get by just on weighing the odds and chosing an action calculated to acheive the best outcome.

      Intelligence is probably the best tool for managing finances, but a dummy who is a great judge of people can find some smart guy to trust with that task.

      Self-discipline and persistence can substitute for many other gifts, including lack of smarts. Few of the problems that we have to solve to lead comfortable lives require genius-level flashes of insight. Those who can force themselves to work hard at unfun tasks can pull ahead in the race when swifter competitors get distracted.

      To reduce this to a computing metaphor, a blazing fast processor will not get you through life if your other components (especially your operating software) suck.

      --
      "We reject as false the choice between our safety and our ideals." --The American President (20.1.2009)
  46. Re:IQ testing not science, has a history of bigotr by Cheapy · · Score: 1

    Hey, give it some slack. It gives geeks something to brag about.

    --
    Would you kindly mod me +1 insightful?
  47. Re:I have no problems if I find out my genes dumb by Anonymous Coward · · Score: 0
    For example, maybe I wouldn't have bothered taking calculus and done something else instead.

    So instead of trying to become a physicist, you could have tried become a plumber instead...

    ...and probably have made more money.

  48. Article Summary by strider44 · · Score: 5, Funny

    "All men are created equal, except for those guys."

    1. Re:Article Summary by tau-lepton · · Score: 1

      Funny, but a little scary. I hope that we all know that this line (which, while being self evident, may not be completely obvious in its meaning) is generally accepted as meaning, that while all men are certainly not equal, our legal and culture must treat all as if they are... even if they are "these guys".

  49. Re:Genes (sp?) Jeans. by CyricZ · · Score: 1

    Women have always told me that my brain is in my Jeans.

    Why do you keep your brain shoved up your asshole?

    --
    Cyric Zndovzny at your service.
  50. Socioeconomic status and race by Anonymous Coward · · Score: 0

    Did they control for the fact that in some communities, race (and hence frequency of certain alleles) is correlated to socioeconominc status (i.e. private education), which could help on an IQ test?

  51. Who funded this research? by CyricZ · · Score: 2, Insightful

    Does anyone have any information regarding who funded this research?

    --
    Cyric Zndovzny at your service.
    1. Re:Who funded this research? by AnotherDaveB · · Score: 1

      The article doesn't say but I'm guessing it was either, a mail order gene test retailer, or a quality guaranteed sperm bank

    2. Re:Who funded this research? by Anonymous Coward · · Score: -1, Flamebait

      Remember moderators: +5, Post by CyricZ.

      Shitbag.

  52. ah, the predictable denial by r00t · · Score: 5, Insightful

    Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.

    Sure, the tests will never be perfect. That doesn't make them useless or irrelevant.

    Unless you're an idiot-savant, splitting hairs about different types of intelligence isn't all that useful. Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.

    BTW, 20 points could qualify as "extremely major differences".

    1. Re:ah, the predictable denial by Anonymous Coward · · Score: 0

      I disagree with the cultural one. Two examples:

      1. A smart person with poor English skills. They're going to do badly but not because they have a low IQ.

      2. I've seen IQ that have references to American cities and politicians. I.e. who was a politician first, which city is further north, something along those lines. Not being an American, I don't have a clue about such questions. Likewise, if the question said "who is the current prime minisiter of Australia" or new zealand, etc, I doubt many Americans could answer it.

    2. Re:ah, the predictable denial by RodgerDodger · · Score: 3, Insightful

      If you can get a high score on an IQ test, then yes, you're probably "smart", "intelligent" or "brainy". But a low IQ score doesn't mean you are not, either. That's the problem with them - all the false negatives.

      --
      "Software is too expensive to build cheaply"
    3. Re:ah, the predictable denial by danhirsch · · Score: 1

      "BTW, 20 points could qualify as "extremely major differences"."

      Yes..I think I learned somewhere that 20 points is an entire deviation from the norm. There is a Major difference between 120 and 140..of which over mid to high 140's I am told is difficult to even quantify accurately.

    4. Re:ah, the predictable denial by Anonymous Coward · · Score: 1, Funny

      Rrrh? Wrrrr, rrrwarww. warrrswarw. Rrrrrrrrrrrrr. [br][br] Arrwww.

    5. Re:ah, the predictable denial by r00t · · Score: 1
      A "smart" person with poor English skills is either:

      • not really smart
      • taking the test in the wrong language

      I suppose there is a third possibility: the smart person does not know any language because they were raised by wolves in a cave. (well, communication may exist, but it's hard to write a test using wolf howls and butt sniffing)

      References to American cities and politicians are rare AFAIK. To some extent this knowledge comes with the English language no matter where you are, and to some extent the test may be flawed. Note that such questions might not count toward the IQ score. They may serve some other purpose, perhaps related to sanity-checking the quality of the test itself.

      Hey, I admit the tests are far from perfect. They are fairly repeatable though, and they match up well with our ideas of what it means to be "smart".

    6. Re:ah, the predictable denial by Anonymous Coward · · Score: 0
      Although I'm sympathetic to the "IQ tests suck" cause, there are already so many posts saying this same thing. So I'm modding the parent up to counter-balance. It feels as if many /.ers really are in denial - that their intelligence is an untouchable turf, something they stake their pride in and will defend at all costs.

      Both sides have good points, but one side seems rather emotionally charged...

    7. Re:ah, the predictable denial by Brandybuck · · Score: 1

      But a low IQ score doesn't mean you are not, either.

      The real world test of this is a one hundred dollar bill. I will wager you a one hundred dollar bill (against your one hundred dollar bill) that two out of three randomly selected persons with IQ scores of less than 80 will not be considered smart, intelligent or brainy.

      IQ scores are not perfect, but their statistical correlation to subjective "intelligence" is inarguable.

      --
      Don't blame me, I didn't vote for either of them!
    8. Re:ah, the predictable denial by asavage · · Score: 1

      20 points is also the difference between the average IQ and the IQ of the average collage graduate. (although the average IQ group includes the collage graduates which brings it up so the gap is a bit bigger)

    9. Re:ah, the predictable denial by ObsessiveMathsFreak · · Score: 1

      Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.

      I don't know about you, but I've met a lot of suppossedly "smart" or "brainy" people, who were in fact, really quite stupid. I've met a lot of suppossedly "less intelligent" people who were leauges ahead of most academics intelligence wise.

      Being able to unjumble mixed up words or rotate cubes in your head does not make you smart. It's a skill like any other.

      --
      May the Maths Be with you!
    10. Re:ah, the predictable denial by danhirsch · · Score: 1

      "20 points is also the difference between the average IQ and the IQ of the average collage graduate. (although the average IQ group includes the collage graduates which brings it up so the gap is a bit bigger)"

      I would probably have to think that the IQ of the average college graduate is higher not due to the education, but rather the aptitude they have shown which allowed them the education.

    11. Re:ah, the predictable denial by Overzeetop · · Score: 1

      You're probably referring to common sense - a trait which is developed more acutely when intellegence is not a driving ability. Yes, there are professors who can't seem to tie their shoes. I know a very smart aerospace engineer with a PhD who put regular dishsoap in a dishwasher. Stupid. The poor boy would go out in public with read sweats and an orange shirt, or wear stripes and plaid together. No concept of fashion, whatsoever. Still, he was very smart, and does amazing work in his field.

      Being able to unjumble mixed up words or rotate cubes in your head does make you smart. Just as being able to bench press 500 pounds makes you strong. There are lots of strong people who couldn't run a marathon, though. Smart is just an ability, like any other. It doesn't say anything about social adjustment, practical knowledge, or interpersonal skills. Those are different abilities.

      Also, be careful not to mix up academics with smart people - they are not necessarily the same. You must remember that academics offers a very cushy lifestyle for those who do not find the "regular" world of business inviting. They serve a purpose, but don't put them on a pedestal just because of the campus office. That would be as erroneous as assuming that a CxO has a great deal of insight into the operations of their company. No doubt many do, but there are quite a few who have found that social skills can mask professional incompetance.

      My point is that I agree with the GP - the tests work well. The measure raw ability, as will a similar set up for testing muscle strength. It does not predict their usefulness in society.

      --
      Is it just my observation, or are there way too many stupid people in the world?
    12. Re:ah, the predictable denial by Anonymous Coward · · Score: 0
      Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.


      Socioeconomic status and childhood environment makes a big difference. The Flynn effect (the general increase in average IQ in a population over generations) is thought to be mainly due to improved nutrition and education - it cannot be genetic and has to be environmental. When a country suffers an economic disaster, average IQs go down.

      In the US, average black IQ is lower than average white IQ. With the Flynn effect this means they lag behind white IQ by 10-15 years.

      Economic studies show the average standard of living for black people lags behind whites by 10-15 years.

      A coincidence? Hardly.

      I remember when spelling tests used to ask children to spell words like 'regatta'. Cultural and class bias is everywhere.
    13. Re:ah, the predictable denial by flyinwhitey · · Score: 1

      "Being able to unjumble mixed up words or rotate cubes in your head does not make you smart. It's a skill like any other."

      But acquiring skills more quickly, and using them more effectively, does indicate intelligence.

      --
      How pathetic are you that you follow me from topic to topic and waste all your mod points at once modding me down?
    14. Re:ah, the predictable denial by Anonymous Coward · · Score: 0

      Also, their are multiple types of tests, and scales. The "stanford" test is the one that suposedly shows how "smart" you are. It's also a load of crap-For example, if you prove a logicle falicy in the test you aren't "smart". Theirs a Weis(sp) test. Their are a many kinds of ways people mesure audults vs children. Then their's a littany of country specfic test. For example the french who originally created these types of Psycho-----logicle tests based them primarly on tests of reasoning and applications of logic, and given a letter (btw also the origin of alphabeticle letter assignments to measure performance) Given all of these things, what's the eficacy? Do the acount for these types of devianions? What kind of scale are they using, and how do they know how well that scale works?

    15. Re:ah, the predictable denial by asavage · · Score: 1

      Of course. An ideal IQ test shouldn't be affected by anything learned in university. As this gene could be responsible for a 20 point difference in IQ I meant to imply having this gene could play a large part in determining whether or not you get a collage degree. As the study was only done on young children, the gene might just mean they develop IQ faster but equal out when they are 18 or 20.

    16. Re:ah, the predictable denial by RodgerDodger · · Score: 1

      Of course, there's also the so-called "LQ" or Literacy Quotient. It's determined by how readily you can post to Slashdot without containing spelling or grammatical errors. This test is also a high predictor of intelligence, but is subject to bias - notably against LOE subjects and dyslexic people

      --
      "Software is too expensive to build cheaply"
    17. Re:ah, the predictable denial by r00t · · Score: 1

      So childhood environment affects you. The test would be wrong if it didn't show this. Even a kid with great potential (via genetics) will be dumb if raised on a diet of French fries and lead paint chips.

  53. oh boy by patonw · · Score: 1

    here comes Gattaca

  54. Eugenic history by Anonymous Coward · · Score: -1, Offtopic
    Here's a history of eugenics and how this sort of stuff can get abused by the wrong sort of people.

    --Mike Perry, Seattle

  55. Re:IQ testing not science, has a history of bigotr by anethema · · Score: 1

    Maybe you are missing the sense of humor gene too?

    --


    It's easier to fight for one's principles than to live up to them.
  56. Re:Genes (sp?) Jeans. by BCW2 · · Score: 4, Funny

    It's partially true. God gave man two heads, unfortunately he only gave us enough blood to use one at a time!

    If your thinking with the little head, the big one is in standby.

    --
    Professional Politicians are not the solution, they ARE the problem.
  57. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    Yeah, I guess when the whole story is full of crass and sophomoric humor, asking for even a remedial level of intelligent discussion is out of the question.

  58. New Rules! by bluestrain · · Score: 1

    Speed dating males must be able to present genetic documentation on request, along with their bank balance.
    It's just Lunch is now It's Just Lunch with Smart Guys.
    "He's really cute, and really sweet! And just look at those genes!"

    It's good to be old and off the market sometimes....

    --
    My wife is like Unix. Lots of commands. Lots of arguments.
    1. Re:New Rules! by Anonymous Coward · · Score: 0
      It's good to be old and off the market sometimes....

      As an oldie myself I agree with you. To be more specific, those times are:
      1. When you forget you have a penis
      2. When you forget how ugly your wife has become
  59. If so...so what? by bcrowell · · Score: 4, Insightful

    Why would this be interesting, if it was true? Any trait is determined by some combination of (1) genetics, (2) prenatal environment, and (3) environment after birth. Studies of twins have already shown that genetics accounts for a very large percentage of the variance in IQ scores. On the other hand, there is no consensus about what IQ scores measure, except that they measure...the property possessed by people who do well on IQ scores. So we already knew there are genes that are important in determining it, but we don't know what "it" really is. What does this particular study (if correct) tell us that we didn't already know?

    1. Re:If so...so what? by headkase · · Score: 1

      One definition of "it" could be the ability to predict and act on events.
      Wish I could remember where I read that.

      --
      Shh.
    2. Re:If so...so what? by flyinwhitey · · Score: 1

      "Any trait is determined by some combination of (1) genetics, (2) prenatal environment, and (3) environment after birth."

      No. Some traits are from a combiantion of factors, many are purely genetic.

      How did such a grossly inaccurate post get modded insightful?

      --
      How pathetic are you that you follow me from topic to topic and waste all your mod points at once modding me down?
    3. Re:If so...so what? by Lord+Ender · · Score: 1

      There is no consensus on what IQ scores measure? That's wrong. It is clear that IQ correlates strongly with financial and social success (social being likelyhood of getting divorced, etc.). It may be hard to define "intelligence," but IQ is certainly a meaningful measurement of the likelihood of success.

      --
      A slashdotter who didn't build his own computer is like a Jedi who didn't build his own lightsaber.
    4. Re:If so...so what? by bsmoor01 · · Score: 1

      Agreed.

      I'm adopted, and my younger sister is not. We both had very successful academic careers (both consistently > 90th percentile). We've also scored well on 'intelligence' tests, though I personally don't believe you can accurately measure intelligence. I think that how you actually perform in life is a better measure.

      Now... there's a slight chance we may both have similar genes that dictate that we have similar academic performance. I think it more likely that our parents encouraged us to do well, and were more influential in our lives than our genes.

      My families experiences have still greatly influenced my personal thinking on nature vs. nurture. My whole life has taught me that how one is raised/cared for/loved translates into what you are at least as heavily as your genetic makeup. Mostly, I feel, personal success (academic and otherwise) is due to your personal values, and values are not inherent. They are taught.

  60. Bullshit detector by HooliganIntellectual · · Score: 1

    Seeing how "IQ" is a score related to how well a person does on a *specific* test created by humans, are they really saying that this gene relates to intelligence in general? I find it hard to believe that a gene would code for something as specific as an IQ test, or, for that matter, a Slashdot poll.

  61. This gene and sexual orientation by Anonymous Coward · · Score: 2, Interesting

    It is very interesting that this gene only seems to be expressed in males. I wonder what the result would be if they tested the effect of this gene in gay people? Would they score more like straight males (- 20 points) or females (no difference)?

    If the gene doesn't affect gays, it might provide some explanation for why an apparently genetic trait that limits reproductive success (homosexuality) nevertheless seems to be present in a significant percentage of the population.

    Mod me troll for this if you want, but it's a serious question.

    1. Re:This gene and sexual orientation by weierstrass · · Score: 1

      a stupid serious question.

      --
      my password really is 'stinkypants'
    2. Re:This gene and sexual orientation by Anonymous Coward · · Score: 0

      Are you that thick headed? Gays can reproduce, haven't you ever seen Queer as Folk? You use a turkey baster and a donor female. I'd guess you'd want the smarter gened guy's sperm, but it's up to you to decide who. Or mix it for a nice blend! Anyhow, it is possible. And if not, there are plenty of unwanted children up for adoption that otherwise would have no chance.

    3. Re:This gene and sexual orientation by penguinoid · · Score: 1

      I seriously doubt that genetic disorders that affect males have anything to do with sexual orientation. Most or all of these genes are related to the X chromosome (women with backup X are unaffected, but carriers) or the Y chromosome.

      On that note, does anyone know how well or if the ancient Jewish "cure" for homosexuality worked? How many homosexuals are of Jewish descent? I'm pretty sure they cured hemophilia with circumsicion.

      --
      Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
    4. Re:This gene and sexual orientation by Woldry · · Score: 1

      Speaking as a gay man, I don't consider your question trollish. I'll try to address it in earnest.

      Even granting the assumption (yet to be proved) that homosexuality is genetic -- yes, it "limits reproductive success". But it doesn't prevent reproduction. I know of many gay men who married & reproduced first, and then came out of the closet (or didn't, and fool around on their wives with other men).

      This is just one way in which the "gay gene" (if it even exists) can be propagated. The stereotype of gay-man-as-woman's-best-friend has a certain truth to it; perhaps this evolved as a means of enhancing the reproductive success of the sisters of those born homosexual, thereby affording another way of propagating the "gay gene".

      However, I fail to see what your question really is asking. Are you assuming that homosexual behavior somehow correlates with the lack of intelligence that the gene in the study may cause? It almost sounds as though you're claiming that homosexual behavior is a manifestation of stupidity. How do you reconcile this with the studies that show a higher average IQ in the gay community than in the general population?

      Or am I completely off the mark?

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    5. Re:This gene and sexual orientation by Ihlosi · · Score: 1
      Actually, didn't some Italian researchers of the University of Padua claim a while ago that they found a gene which in females increases fecundity while in males it increases the likelyhood of being attracted to the same sex ?

      Combined with the fact that males are fairly unimportant for the survival of the species as a whole, this would explain why the gene has not died out yet - its effect on females is more advantageous than its effect on males is detrimental as far as reproduction goes.

    6. Re:This gene and sexual orientation by Anonymous Coward · · Score: 0

      Except that possessing the gene lowers the average IQ score by 20, and he is asking whether a homosexual with the gene tends to respond to IQ tests more like a straight male (thus scoring 20 lower than is typical) or more like a female (giving an unaffected score). It really is an interesting question, since there are known differences in typical brain structures (such as larger connective regions between the hemispheres in homosexual males) between straight and homosexual males, and the answer would suggest which parts of the brain may be effected by this gene.

    7. Re:This gene and sexual orientation by gg3po · · Score: 1

      Sorry, the "gay gene" was a popular myth of the late 90's.

      --
      ---
  62. If jounalists were better educated about genetics by Cafe+Alpha · · Score: 2, Interesting

    Most probably the reason that that " females also can carry the variation, [and] it does not appear to affect their IQ" is that females carry two mostly different X chromosomes and therefor have a backup for any defective gene, while men have only one X chromosome plus some dumb little Y chromosome that encodes our dicks and little else.

    If they knew what they were talking about they'd ask whether a women with TWO of this gene had a lower IQ just like a man with one.

    Probably they do, but also, no doubt, they couldn't find a large enough population of women with two of this gene to know.

  63. Trade-off? by Anonymous Coward · · Score: 0

    Assuming the results cited are correct, it would be interesting if the "IQ depressing" gene conveys some benefit that makes up for the loss of intelligence. A gene that depresses intelligence, without any trade-off, would be quickly eliminated by natural selection, so there would be no reason for it to be common in a population. It would be interesting to find out what the beneficial effects associated with the gene are.

    1. Re:Trade-off? by Anonymous Coward · · Score: 0

      The post just above this one gives a hint as to what the trade-off might be. Since the gene only seems to affect males, guys with female-like gene expression in their brains would not be affected so much. In other words, the trade-off is that there are more gay people.

    2. Re:Trade-off? by Anonymous Coward · · Score: 0

      Having this gene ensures a large penis. Therefore, 'natural selection' does not apply to this gene.

      Hm. Black men are supposed to have larger penises that our caucasian friends. Coincidence?

  64. Large Offspring Syndrome by Puf_Almighty · · Score: 1, Informative

    It's a little technical, but here's a rundown for the biochemically inclined: M6P/IGF2R introduction.

    Turns out it's a cancer suppressor, too- a growth suppressor all around. It was suppressed it in early (animal) clones, and so the fetuses/feti grew too big in the womb and aborted. At least, according to the guy who wrote that rundown.

    It causes LOS, "Large Offspring Syndrome" when deactivated, because of stuff detailed in that article there. Unfortunately we can't say whether this form of the protein mentioned in the article is more or less active, because the article doesn't specify. Does anyone know?

    Also, they should do a correlation between the same set of subjects, and see if it also shows correlation of body size. To check the use of IGF2R as a growth suppressor.

  65. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0
    the whole concept of "IQ" is absurd. even a cursory undertanding...
    What I find absurd is that some people find capitalizing the first word of a sentence too difficult. The poster managed double quotes and a capital "I" and "Q" mid-sentence, so I assume the shift key works.

    Somebody let me in on the gag. Is this some sort of virtual Masonic handshake or just the stupidity gene at work?
  66. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    Who cares? Can't contribute to the topic at hand?

  67. when will they..... by dartarrow · · Score: 1

    ...find the gene that causes people to blame every lil' thing on genes?

    --
    I love humanity, it is people I hate
  68. Correlation? by erikharrison · · Score: 5, Insightful

    Let's not forget what we are testing for here. We're not saying that this gene makes people dumb. We're saying that boys with this gene score more poorly than boys without this gene. We're using a purely operational definition of intelligence (IQ score), and not making a value judgement.

    This is interesting science, despite those who are spending their energy railing against IQ tests. IQ tests are terrible indicators of how "bright" someone is, but they are fairly consistent tests, in which people tend to get the same results over time, so they are measuring something with accuracy. And whatever that is, is hurt by this gene.

    Is it attention? Does this gene make your balls itch, thus distracting you from standardized tests (also explaining why it only affects boys)? Perhaps, does it affect mathematico-spatial ability specifically, which boys tend to do better on than girls (very likely for social reasons), and thus the generally poor performance of girls in this part of the test accounts for the gender variation (a floor effect)?

    Who knows. But a strong correlation between a gene and a standardized test score (especially a well established one like most IQ tests) in a not insignifigant sample (300 kids) is nothing to sneeze at - 20 points in a sample that large tends to indicate it's a real effect. Don't let the articles journalistic simplifications ("Gene makes boys dumb") throw you from seeing what that is.

    1. Re:Correlation? by X · · Score: 2, Interesting

      One of the funniest bits of this article was on the subject of correlation:

      But so far, connections between IQ and specific genes have been just correlations, with little supporting evidence. The new research, Jirtle and other experts said, will need to be replicated before it is considered definitive.

      Unless there is something in the research that the article failed to capture, I don't see how this would amount to anything other than a correlation, as there isn't any evidence of the mechanism by which the gene is causing this effect, or an observation of the gene causing the effect (tricky with genetics, but nonetheless).

      --
      sigs are a waste of space
    2. Re:Correlation? by RoLi · · Score: 1
      We're not saying that this gene makes people dumb.

      Is that the royal "we"?

    3. Re:Correlation? by Anonymous Coward · · Score: 0

      You'd need to be pretty dumb to pay serious attention to an IQ study of any kind, and especially one that involves genetics.

      Unless of course you're a libertarian or laissez-faire advocate, hoping to justify your vile anti-social beliefs.

      In terms of science thsi type of study is simply a larger than average pile of crap. Name the type of validity that might be required for such a test as IQ, and it doesn't have it.

  69. Age by Epistax · · Score: 1

    What's there not to understand? At 20 years old the difference was 20 points. If that's not what he meant, I'm completely backwards in English.

    1. Re:Age by Anonymous Coward · · Score: 0

      Where exactly does it indicate they meant age in that sentence? Is "marked at 20" another way of saying "20 years old"? That thar be very peculiar.

    2. Re:Age by buck_wild · · Score: 1

      With the average age of the test subjects being 10 years old...I don't get it either.

      --
      If all you have is a hammer, everything looks like a nail.
  70. Accuracy of IQ tests by lysergic.acid · · Score: 1

    I thought that IQ tests had a margin of error of about 20 points. Can anyone confirm or deny this?

    1. Re:Accuracy of IQ tests by Lars83 · · Score: 1

      Mmm, it's about +/- 4 points, depending on the test and where you are in the scale (like the retarded end vs. the gifted end).

    2. Re:Accuracy of IQ tests by buck_wild · · Score: 1

      Deny. 15-16 points is the deviation.

      --
      If all you have is a hammer, everything looks like a nail.
    3. Re:Accuracy of IQ tests by kaosrain · · Score: 1

      IQ tests as they are used today have a margin of error of about 100%. They were never meant to measure intelligence.

      /Psych student.

    4. Re:Accuracy of IQ tests by Grand+High+Wonko · · Score: 1

      Standard deviation is not the same as margin of error, the poster above is more accurate with a 3 or 4 point margin. This obviously excludes online IQ tests which will frequently have an upwards margin of error of up to 30 points or more

    5. Re:Accuracy of IQ tests by buck_wild · · Score: 1

      "This obviously excludes online IQ tests which will frequently have an upwards margin of error of up to 30 points or more"

      Then perhaps either my source is incorrect (http://en.wikipedia.org/wiki/IQ#Distribution) or (more likely) I'm not interpreting the data correctly.

      --
      If all you have is a hammer, everything looks like a nail.
    6. Re:Accuracy of IQ tests by Grand+High+Wonko · · Score: 1

      Even your source talks about the problems with upward distortion in online tests in the block right above your link. Having said that I've done numerous actual and online tests. If you're curious the test on tickle.com gave me the same result as the real test so it might be accurate. As for the link itself as I said deviation is not the same as margin of error. What a standard deviation of 15 means is that most people fall with 15 points of the mean (75 to 115) not that the test is inaccurate to 15 points.

    7. Re:Accuracy of IQ tests by buck_wild · · Score: 1

      Interesting. Thank you for the information and the correction.

      --
      If all you have is a hammer, everything looks like a nail.
    8. Re:Accuracy of IQ tests by buck_wild · · Score: 1

      Here are my results from taking the tickle IQ test, though I didn't pay to see how I compare.

      Bryan, your Super IQ score is 125

      Your overall intelligence quotient is the result of a scientifically-tested formula based on how many questions you answered correctly. But it's only part of what we learned about you from your answers on the test. We also determined the way you process information.

      The way you think about things makes you a Creative Theorist. This means you are a highly intelligent, complex person. You are able to process information of nearly every kind with ease, using both creativity and analysis to make sense of the world. Compared to others you also have a very rich imagination.

      How did we determine that your thinking style is that of a Creative Theorist? When we examined your test results further, we analyzed how you scored on 8 dimensions of intelligence: spatial, organizational, abstract reasoning, logical, mechanical, verbal, visual and numerical. The 3 dimensions you scored highest on combine to make you a Creative Theorist. Only 6 out of 1,000 people have this rare combination of abilities.

      --
      If all you have is a hammer, everything looks like a nail.
  71. New IQ test instructions by Think+Loudly · · Score: 5, Funny
    Instructions:
    Please read all instructions before beginning this test.
    For this test you'll need:
    • Two #2 sharpened pencils
    • A non recessive IQ gene
    • Four sheets of blank paper
    • etc...

    If you did not bring the proper pencils or paper, please see the administrator. If you lack the proper genes, please turn this test over and place your head down upon the table. Your test will be administered later; when we have time for you. If you cannot read this sentence, stare blankly out into space until somebody comes by to escort you away.
  72. Note on parent by Dogun · · Score: 1

    He's not talking about the number of subjects compared to the apparent IQ delta. He's talking about the number of subjects compared to the number of candidate genes to effect such a change. The study could very well have selected for noise.

  73. Something Missing? by MonkWB · · Score: -1, Redundant

    and those that didn't being marked at 20 approximately 20 points.

    Clearly somethings missing.

  74. Life imitates art again by craXORjack · · Score: 3, Interesting

    This explains that Simpsons episode when Lisa was depressed because she thinks she will turn out to be a loser, but then it turned out only the male Simpsons were like Homer and all the females were doctors and scientists.

    --
    Liberals call everyone Nazis yet they are the closest thing to it.
    1. Re:Life imitates art again by Wargames · · Score: 1

      Homer was also a genius except he stuffed too many crayons up his nose.

      --
      -- Each tock of the Planck clock is a new world and here we are still life. --
    2. Re:Life imitates art again by c4ffeine · · Score: 1

      Torrent?

      --
      "73% of quotes on the Internet are made up" -Ben Franklin
    3. Re:Life imitates art again by Adam+Avangelist · · Score: 1

      Even though Homer may appear stupid in the T.V. show, remember he works at a nuclear power plant. They do not allow people without education to work at a nuclear power plant, atleast in the position Homer works, which appears to be a technician. I can't recall a Simpsons episode where they discuss Homer's education or lack of.

  75. Any other studies that show the relationship by ClosedSource · · Score: 1

    between genes and other non-scientific measurements. We can't define intelligence, but we know how to measure it!

    Maybe there's a gene that controls the length of your hand's lifeline! Then we can figure out how long you will live!

  76. Re:I wonder if prestigious Universities in the fut by Anonymous Coward · · Score: 0

    Why the hell would it suck? My observations have shown that smart people don't want to be immersed in stupidity, and stupid people want to ignore their stupidity by being with their kind. A simple genetic test to separate the two would be wonderful.

  77. Average age of 10, only caucasians tested by j1m+5n0w · · Score: 2, Insightful
    From the article:
    The researchers studied about 300 children with an average age of 10. The children, all Caucasian, came from six counties in the Cleveland area. As a group, males -- but not females -- who had the variant gene had IQ scores about 20 points lower than males who didn't.
    It would be interesting to know if the same findings hold true in older populations; it may be that the gene only affects the rate at which the brain develops, not its eventual capabilities.
    1. Re:Average age of 10, only caucasians tested by Anne+Thwacks · · Score: 1
      came from six counties in the Cleveland area.

      But does this generalise out? Maybe these people are all related and have a family tradition of eating something that boosts their IQ? Or working with dangerous farm machinery that is prone to killing tenage boys with low IQ? (see Darwin Awards)

      Environment is very largely inherited. Of course I have not RTFA, but it would appear from the original posting that ScuttleMonkey does not ave this gene! being marked at 20 approximately 20 points

      --
      Sent from my ASR33 using ASCII
    2. Re:Average age of 10, only caucasians tested by Woldry · · Score: 1

      Please tell me that you don't seriously believe that Cleveland is farm country ... ?!?

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    3. Re:Average age of 10, only caucasians tested by geoffspear · · Score: 1
      Please tell me you don't believe that there are 6 urban counties surrounding Cleveland.

      Hell, I don't know about Cleveland, but driving to Columbus you enter the actual "corporate limits" of the city, then drive through 30 miles of cornfields before you see a building bigger than a barn.

      --
      Don't blame me; I'm never given mod points.
    4. Re:Average age of 10, only caucasians tested by Woldry · · Score: 1

      According to a bulletin issued by the Ohio State University Extension Data Center (which if anything has an interest in overstating how rural Ohio counties are), there are five urban counties surrounding Cleveland (Cuyahoga, Lake, Medina, Summit, and Stark) and only one rural (Geauga).

      To quote from the bulletin:
      As of 1990, the majority of Ohio's 88 counties were rural, (i.e. 50% or more of the population were living in places of less than 2,500 people or are living in open country, Figure 29). An urban county is defined as people residing in places of 2,500 or more or those living in densely settled urbanized areas adjacent to central cities of metropolitan areas (Rural and Urban Population for Ohio Counties, 1990, Don Thomas). The state of Ohio as of 1990 had 25.9% of its population living in a rural area and 74.1% living in an urban area.

      Subjective impressions derived from your view from an interstate highway leading into a completely different city than the one mentioned in the study do not qualify as data.

      --
      How can a post be modded "overrated" or "underrated" when it hasn't been rated yet?
    5. Re:Average age of 10, only caucasians tested by geoffspear · · Score: 1

      Ok, fair enough, I shouldn't have used the term "urban county" if they're defined as such. There's still a hell of a lot of farmland around, even if less than half the population lives on it.

      --
      Don't blame me; I'm never given mod points.
  78. correlation != causation by tfoss · · Score: 1
    But so far, connections between IQ and specific genes have been just correlations, with little supporting evidence. The new research, Jirtle and other experts said, will need to be replicated before it is considered definitive.

    And even supposing it is replicated, that does not change the fact that it is also just a correlation.

    -Ted

    --
    -=-=- Quantum physics - the dreams stuff are made of.
  79. The gene is also found to cause... by saskboy · · Score: 1

    Over-use of alcohol. Those with the "bad" gene are prone to drinking too much, and killing off their brain cells with intoxicants. They also prefer NFL, George Bush, Slashdot, and C#. Emacs is their favourite text editor.

    In women this gene has no affect, because the duplicate on the other X chromisone cancels the effect so none of them prefer any of the above things that are the result of a lower IQ.

    -/Karma burning made up stuff.

    --
    Saskboy's blog is good. 9 out of 10 dentists agree.
    1. Re:The gene is also found to cause... by Triple+Click · · Score: 1

      Hey. I resent that Emacs remark.

  80. Upper bound on the ethical implications by Chris+Snook · · Score: 4, Insightful

    People are treating this like there's a "smart gene". That's not at all the case. All they've done is identify a genetic defect which tends to lower the IQ of people who have this defect. They don't know the mechanism, and they still have a wide range, so it's probably one of many factors that is meaningless in isolation. Testing a particular living person for it wouldn't tell you anything useful about their intelligence.

    So, what about potential people who do not yet have an intelligence that can be tested? Well, it turns out that IGF2R is a very, very special gene for other reasons. There are certain genes that are "imprinted" in sexual reproduction. You might wonder why, with all the mutations and screwups that nature seems to allow, we don't see female mammals occasionally giving birth to their own clones, from meiosis that doesn't go as planned. Well, inheriting two of the same chromosome is almost always fatal because of these imprinted genes. With imprinted genes, genes are expressed if and only if they come from one particular parent. IGF2 is expressed exclusively from the father. IGF2R is expressed exclusively from the mother. The upshot of this is that while you could use this to discriminate among egg donors, using it to discriminate among sperm donors would be useless. As the mechanism that causes the correllation is still unknown, and ova are in much shorter supply than sperm, people are unlikely to be terribly selective about it in ova. Given all the other things we can test for, it's unlikely people would make a sperm decision based on how smart the grandsons of their designer daughters would be. If we're assuming babies with pre-selected genetic makeup, the next generation could do the same, rendering the decision moot.

    Read more: http://users.rcn.com/jkimball.ma.ultranet/BiologyP ages/I/Imprinting.html

    --
    There's no failure quite as dissatisfying as a complete and total solution to the wrong problem.
    1. Re:Upper bound on the ethical implications by Anonymous Coward · · Score: 0

      Calling a lack of the gene a 'defect' is an imaginative spin...

      Until we discover that the distribution varies with ethnicity.

      The spin then comes back around to IQ being merely an indication of potential and that your basic microcephalic is equally deserving of those $36million a year spiffs as Nardeli...sorry, bad example...see 'G.E. follows Sears and Roebuck down the tubes'.

    2. Re:Upper bound on the ethical implications by Anonymous Coward · · Score: 0

      The validity of this entire study is thrown into question, when you come across that the gene they were REALLY looking at was the ID10T gene.

    3. Re:Upper bound on the ethical implications by Chris+Snook · · Score: 1

      Would you call sickle-cell anemia a defect? We know that one varies with ethnicity. Specifically, ethnicities that come from parts of the world where malaria is prevalent have it in high concentration, because a single sickle-cell gene offers some resistance to the disease, but having two of them is crippling even with life-long intense medical care, and fatal otherwise.

      Calling it a defect isn't a comment on the quality of the ethnicities in which it is present, just a recognition that evolutionary pressures in different parts of the world have caused some populations to tolerate moderate levels of genes that yield proteins that are not optimal for their primary task, due to side effects that may or may not harm the person in other ways, depending on other factors.

      --
      There's no failure quite as dissatisfying as a complete and total solution to the wrong problem.
  81. Re:Genes (sp?) Jeans. by Coneasfast · · Score: 1

    If your thinking with the little head, the big one is in standby.

    You must be using your little head atm.

    --
    Marge, get me your address book, 4 beers, and my conversation hat.
  82. Finally... by Errandboy+of+Doom · · Score: 1

    ...we've found something IQ tests actually correlate with.

    All this time we've just been testing for a gene and we didn't know it, go figure.

    1. Re:Finally... by Zoyd · · Score: 1

      Here are more things IQ has been found to correlate with:

      http://www.childrenofmillennium.org/science.htm

  83. Obligatory citation about absurdity of IQ testing by shanen · · Score: 0
    First, if you take any of this seriously you should read The Mismeasure of Man to learn about the high bogosity quotient of all of this kind of research. (Note that all of these 'IQ' tests consistently evaluate me near in the top 1%, except for the lawyers-only test that ranked me in the top 10%. Getting off the topic, but you can already make the obvious inference about lawyers and IQ--but would you want to be one?) Essentially, 'intelligence' is not well defined, and any attempt to reduce it to simple metrics such as single numbers is stupid at best, but rationalizing racist eugenics at worst.

    My own take is that human variation within any population is way above what the genes can account for. If there was such a thing as 'good' or 'bad' genes, they might make it easier or more difficult to acquire certain skills, but no guarantees. The reason is that our human behavior is fundamentally related to our mental-model-building capacities, and there are only very weak linkages between our mental models and anything else, including the real world.

    --
    Freedom = (Meaningful - Coerced) Choice != (Speech | Beer^2), and sad sock puppets' bad mods avail them naught.
  84. Good summary or bad summary by Anonymous Coward · · Score: 0
    "The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20 approximately 20 points."

    I know this has been mentioned a few times already, but I was just wondering, in the present internet culture, is it a good summary or a bad summary when you still have to RTFA to find out what the summary is talking about?

  85. D'oh! by mearzuh · · Score: 1

    No, it's not the gene. We all know that males have a crayon stuck up their nostrils that make them 60 IQ points dumber! Hmmmmm...donuts...aaaggghhhhh...

  86. Does anyone have a link? by Austaph · · Score: 1

    I'll entertain my skepticism this time. Where can I find the published study? Why males and not females?

  87. Re:Genes (sp?) Jeans. by DigitalReality · · Score: 1

    I think your comments are both uncalled for and highly immature. boobies. You should really consider growing up. sexual intercourse. People don't find this kind of humor funny, in the lease. vagina. I think you need the help of a professional. love-the-booty.

  88. Re:IQ testing not science, has a history of bigotr by Lars83 · · Score: 1

    Sounds like someone got a low score....

    You sound like the ugly woman who says that true beauty is "on the inside."

  89. Siblings... by Belial6 · · Score: 1

    While I agree the genetics does have an impact on intellegence, the reason that simblings with vastly different IQs exist is because contrary to PC belief, very few parents actually treat all of their children the same. First children tend to be more restricted in what they are allowed to do, and last children tend to be more pampered and thus have to do less. Obviously this is not absolute, and you can make your own determination as to what these environmental effects have on children, but it is common.

    The answer to the age old question of environment or genetics is an obvious "Yes".

    1. Re:Siblings... by Hognoxious · · Score: 1

      ... plus ordinary siblings don't have the same genes. Identical twins do, hence the number of studies that attack the problem from the other side - hold the genes constant, but let the environment differ. Usually, this involves finding twins who have been adopted separately.

      --
      Confucius say, "Find worm in apple - bad. Find half a worm - worse."
  90. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0
    You are clearly an idiot. I'm always amused by idiots who claim that the concept or measurement of IQ is nonsense. They must be related to the idiots who promote Intelligent Design - because underlying their denial of Evolution is their own failure to grasp that Science is complicated, and their inability to understand Evolution is their own fault, not that of Science.

    Please do not say that IQ and IQ testing are meaningless, to justify your own low score.

  91. Re:I wonder if prestigious Universities in the fut by Inaffect · · Score: 1
    "We accept people who have the Intelligence gene only. All other entries are rejected."

    It wouldn't "suck" as much as someone named Henry Goddard creating the IQ-standard and then saying we needed to stick all of the "feebleminded" people in their own segregated colonies... And he's the benchmark..

  92. Re:If jounalists were better educated about geneti by Lars83 · · Score: 1

    Wrong. You clearly don't know much more about genetics than the journalists do.

    Males only have the Y chromosome in the 23rd pair (e.g. it's the 46th chromosome). This gene's location appears to be on the 6th chromosome, which would mean that both males and females will have an X.

  93. What a horrible question I must ask.... by Anonymous Coward · · Score: 0

    Are scientists prepared to state that Nazi views of genetics and IQ were right, despite that their methods were quackery?

  94. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    I think IQ tests are meaningless. I made a high score but I don't believe I am significantly smarter than everyone else. There is a characteristic trait between high IQ and socioeonomic status.

    My parents are doctors and lawyers (mom and dad) and make well into the six figures. My parents took the effort to raise me up in a quality environment, put me through good private schools, and purchase test coaching sessions so that I would make a good SAT score to get into Cal Tech (I wanted to go to a state university with all my friends but my parents insisted on a "better" university).

    Testing is nothing but a measure of how dedicated you are to your school work and how much you practiced for tests. Pure and simple.

    Your bitter and sarcastic tone would suggest that you may be the one who scored low and want to pass on your failures to other people who dare question "scientific" dogma.

  95. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    Actually, it sounds like someone who doesn't have a narrow unidimensional view of the distribution of patterned human behavior and events.

  96. And only groups benefitted. by jd · · Score: 1
    IQ tests are notoriously regional. Someone who did well on a UK IQ test would do badly on a USian one, and vice versa. Someone who did well in either would likely fail an Australian one. And even within each country, there are often multiple IQ tests and people are going to score better on the one targetted at their part of the country or their ethnic group or whatever.


    Unless the people carrying out the study took this into account, their results would not show differences in intelligence at all, but rather differences in the specific skill(s) that that IQ test emphasised.


    This, very likely, would explain why they observed a group benefit - you would see a benefit to those groups whose culture emphasised those skills that the gene enhanced - individuals overall would have a random chance of doing so, so would not appear to show any benefit.


    If we go with this theory, then my guess is that the skill(s) that benefit are culturally deemed masculine and that those females tested who ignored gender stereotypes would show an identical distribution of benefit as per the males.


    This is the problem with studying things by statistical analysis. It is only valid if you have no unaccounted-for variables, and that is usually not the case. Such studies are often simplistic, don't dwell too much on the mechanisms, and don't conduct genuinely random tests (for whatever reason) on a statistically-significant sample of the population.


    In a case like this, where you are dealing with multiple unknowns (the impact of regionalization of the test, cultural biases, gender biases, etc), you would have to be extraordinarily careful in the study - and would STILL need to perform an n-way analysis of variance to prove that none of the other unknowns were statistically significant. (And, because n-way AoV requires that much larger a sample to work, you'd need to scale up the study accordingly.)


    Oh, to complicate things further, the brain's and the body's gender are determined by different mechanisms at different times, so you'd have to conduct further tests to see WHAT gender was significant. Since intelligence is in the brain and not the body, one would assume that the gender differentiation of the brain was more important than that of the body, so a trivial "male/female" analysis doesn't cut it.


    If you REALLY want to get in-depth, you also need to look at the gender-determining chromosomes. You've the XX of the typical female, and the XY or YX of the typical male, but other combinations also exist - XYY and XYYY "supermales" and XXY "superfemales" are rare, but they are there. If we are to assume a link between biological gender and this discovered gene, then "supermales" and "superfemales" should show different results than regular males or females. If it is not a pure genetic relationship, then no such skewing will occur.

    --
    It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
    1. Re:And only groups benefitted. by Anonymous Coward · · Score: 0

      > IQ tests are notoriously regional. Someone who did well on a UK IQ test
      > would do badly on a USian one, and vice versa. Someone who did well in
      > either would likely fail an Australian one.

      Yes for sure, if you take a dime in a dozen online "IQ test". Now seriously, you have obviously no understanding of proper IQ tests. The better ones are not culturally bound, definitely not as much as to affect the results between populations of western countries. They do not ask culture specific questions or questions that require acquired knowledge such as "who is the prime minister of Australia". Usually they rather involve a logic puzzle formed with shapes.

      The rest of your post shows the same misunderstanding so I won't bother to comment on it more. It would do you good to read up on what the scientific consent on so called IQ and what its relation to intelligence is undestood to be. A good summary is this one:
      http://www.psychpage.com/learning/library/intell/m ainstream.html

    2. Re:And only groups benefitted. by swv3752 · · Score: 1

      What the hell is an USian test? Is that like an UKian test or an EUian or an AUian test?

      --
      Just a Tuna in the Sea of Life
    3. Re:And only groups benefitted. by Da_Biz · · Score: 1

      What the hell is an USian test? Is that like an UKian test or an EUian or an AUian test?

      I'm not sure if you meant this in jest, but for example, I believe WAIS-III (Wechsler Adult Intelligence Scale) norms are created with people living in the US.

      Also, let's not forget the other theories (Steinberg's Triarchic Theory of Intelligence, for example) which I think put a different--and very utilitarian--spin on what intelligence is.

      Just because someone's smart doesn't mean that they're guaranteed to be successful. Lots of smart people flounder because they're poor communicators, are socially inept, etc. Hence, I think Steinberg's theory is intriguing.

  97. Homer gene... by Anonymous Coward · · Score: 0

    Wow, there's a Homer gene. You mean we don't have to look for stray crayons anymore?!?!?

  98. Estimate of the proportions by Anonymous Coward · · Score: 0

    Jirtle says about twenty-five percent of Caucasians have the variant of the gene. The study used 300 children, all Caucasian. So if the study used equal numbers of girls and boys, and if selection for testing was independent of the presence of the variant, then I estimate a sample of

    (37.5 +/- 5.3) boys with the variant gene, and
    (112.5 +/- 5.3) boys without the variant,

    where the errors are statistical and totally anticorrelated.

    And same for the girls, of course.

    The articles say he presented results at a November conference in Durham, NC. That would seem to match this conference. This abstract refers to the result briefly.

  99. Re:Genes (sp?) Jeans. by ath0mic · · Score: 1

    "God gave us a penis and a brain, but only enough blood to run one at a time."

    ~Robin Williams

  100. Nevermind... by penguinoid · · Score: 1

    Now I wonder if *I* have this gene :-)

    --
    Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
  101. women? by Anonymous Coward · · Score: 0

    There's no effect with women because they already know eveything.

  102. I believe I've figured it out by Anonymous Coward · · Score: 0

    The individual variations in IQ that this gene caused when manipulated has an almost-perfect correspondence with derivations in penis size.

    Upon further research, it will undoubtedly be concluded that this gene replaces the bearer's corpora cavernosa with a corpus callosum -- that is, the subject will actually have a brain in his dick instead of just trying to think with it.

  103. It's called by bredk · · Score: 0

    Testosterone..

    --
    http://slashdot.su/
  104. OT:sig by Darby · · Score: 1

    I've done two things that very few legislators in this country have... I've read the constitution, and I understand it.

    Not that you haven't, but...
    Take the third step: Believe in it, and you will have made yourself entirely unelectable.
    Sad but true.

  105. These were stupid kids by blonde+rser · · Score: 1

    From the article The researchers studied about 300 children with an average age of 10.

    Heck these kids weren't just stupid they were pretty much vegetables with that IQ. Of course I could give the writer the benefit of doubt and assume that the 10 was a typo of 100 but I prefer thinking that these were a group of kids who could barely figure out how to breath (at least on average).

    1. Re:These were stupid kids by wfWebber · · Score: 1

      From TFA, the kids had an average *age* of 10. You may want to read instead of scan...

      --
      Never underestimate the bandwidth of a station wagon full of tapes hurtling down the highway. -- Andrew S. Tanenbaum
    2. Re:These were stupid kids by blonde+rser · · Score: 2, Funny

      Maybe I'm the one with an average IQ of 10.

    3. Re:These were stupid kids by wfWebber · · Score: 2, Funny

      Actually, it takes an IQ of 70+ (if I recall correctly) to be able to learn how to read. Reading /. might require a max of 50, but I still think you should be over 10. So no worries, your resume won't be affected by this remark ;)

      --
      Never underestimate the bandwidth of a station wagon full of tapes hurtling down the highway. -- Andrew S. Tanenbaum
  106. Right, so, uh... by solios · · Score: 1

    ... how is it that given the Standard IQ Tests that Pennsylvania public skoolz distributed during the 80s, my SISTER and I both scored THE SAME* ??

    It might be A gene, but I seriously doubt it's THE gene.

    * Plus or minus the usual five point margin of error but we're talking an "average" score around a third again above the norm. :P

    1. Re:Right, so, uh... by Zoyd · · Score: 1

      how is it that [...] my SISTER and I both scored THE SAME

      Perhaps you both performed equally well on the test.

    2. Re:Right, so, uh... by tedrlord · · Score: 1

      Maybe that means you don't have it? =)

      Actually the way they write the article, it almost sounds like people with the bad gene have lower IQs than is normal, rather than people with the gene being geniuses. That would make more sense (if there really is a direct link), because a genetic defect may cause the brain not to function correctly.

      --
      [insert witty quote here]
  107. Not a gene by squoozer · · Score: 1

    According to my SO intelligence is found only in that bit of chromosome that women have that men don't. I suppose you don't need to be all that bright to hit dinosaurs over the head with a club and make babies. We are proving the latter on a daily basis.

    --
    I used to have a better sig but it broke.
    1. Re:Not a gene by hodma727 · · Score: 1

      Uhhh... guys have X and Y chromosomes (usually one of each), women have X chromosomes (usually two). Your SO needs to go back to school :)

    2. Re:Not a gene by squoozer · · Score: 1

      Erm that was my point. Men are XY women are XX - Y is like an X with a missing leg. That leg contains all the genes that encode for intelligence. Perhaps I screwed it up the first time. I'll go and have a look....

      --
      I used to have a better sig but it broke.
  108. Re:IQ testing not science, has a history of bigotr by Zoyd · · Score: 1

    Jensen responded and Gould never responded in turn:

    http://www.debunker.com/texts/jensen.html

  109. Informative??? by Nicolas+MONNET · · Score: 1

    No, the above comment is not informative. A sample of 300 for that kind of testing is huge. Many pharmaceutical studies for instance are done on less than 100 patients. And 20 IQ points is a huge differential, too. Again, drugs have been deemed efficacious with much less of a margin.

    1. Re:Informative??? by Wiwi+Jumbo · · Score: 1
      "Many pharmaceutical studies for instance are done on less than 100 patients."
      Oh wonderful.
      --
      Wiwi
      "I trust in my abilities,
      but I want more then they offer"
  110. Mod parent up / weird numbers from the study by Dire+Bonobo · · Score: 1
    Thanks - that's a much more informative article.

    What's odd, though, is that 2 of the variant-guys had 160 IQs. While 2 of 40 is pretty noisy data, the chance of finding even one is about 1-in-30,000, making the odds of finding 2 in a group of 40 about 1 in a million (assuming random kids, of course). While it's rampant speculation on my part, I'm curious if that's a statistical anomaly or whether the variant group has a low mean but an unusual number of extremely high values.

    It also means (again, assuming 40 variant boys) that those two kids personally accounted for almost 10% of the summed IQ in the group, meaning that if they are just a statistical anomaly, the group mean would be about 4 points lower than measured, increasing the difference between them and non-variant boys by 25%.


    Hmm - with the standard distribution of intelligence in the population (same link), 25% of people have an IQ 10% or more below the population mean. If that's true for this group, they alone would account for 50% of 25% of 25% or 3% of the overall population with an IQ below ~74, but the given frequency for an IQ below 74 is only about 5% for the entire population, and about 2/5 are female (link), leaving only about 0% of the total population, or suggesting that non-variant males have IQ below 74 only a miniscule fraction of the time. Since 20-25% of mental retardation is due to some kind of damage (i.e., should be roughly equally distributed), that seems implausible. So it kinda seems likely that either (a) the difference between means isn't as large as this study suggests, or (b) the IQs of this group don't follow the normal distribution that overall IQs (and, with tweaks, most other human traits) follow.

    Based on that, in my largely ignorant opinion, I suspect that any actual difference between the means is less than is suggested by this study. FWLTW.

    1. Re:Mod parent up / weird numbers from the study by Zoyd · · Score: 1

      Dire Bonobo wrote: It also means (again, assuming 40 variant boys) that those two kids personally accounted for almost 10% of the summed IQ in the group

      IQ is a quantification of variance within a population. It does not sum.

    2. Re:Mod parent up / weird numbers from the study by Savantissimo · · Score: 1

      "25% of people have an IQ 10% or more below the population mean"

      IQ is not a ratio scale, so you can't relate IQ scores as proportions like that. If you were talking about Rasch measures like the CSS scale on the new Stanford Binet 5, it'd be a different story. The IQ score as used today is nothing but a measure of standard deviations on a normal curve which does not match the closer to log-normal distribution of raw scores. On an ratio scale humans don't vary that much - say 440 for a 3 year-old, 500 for a ten year-old, 520 for an adult and 592 for the highest score in their large and high-IQ enriched norming sample. (I am too lazy to link but Google "riverside service bulletin 5 - Deborah Ruf and look at CSS scores and also search "Grady Towers IQ Rasch" if you want sources.)

      --
      "Is life so dear, or peace so sweet, as to be purchased at the price of chains and slavery?" - Patrick Henry
  111. IGF2R by MillionthMonkey · · Score: 5, Informative
    According to build 35.1 of GenBank and version 124 of dbSNP, the following 66 genetic polymorphisms have been found to occur within the 48 exons of IGF2R in humans:

    rs_number|alleles|position (on chromosome 6)
    rs8191692 C/T 160360652
    rs2975115 C/G 160360684
    rs2975116 C/G 160360687
    rs8191704 A/G 160382749
    rs11759563 C/T 160416104
    rs8191746 C/T 160416109
    rs8191753 A/G 160418673
    rs8191754 C/G 160418735
    rs8191758 A/G 160421034
    rs8191763 C/T 160424152
    rs1570070 A/G 160424389
    rs13198308 C/T 160432052
    rs8191776 A/C 160434644
    rs6413489 A/G 160434696
    rs894817 A/G 160434700
    rs8191797 A/G 160437232
    rs1050004 A/G 160437257
    rs8191798 A/G 160437267
    rs998075 C/T -160438689
    rs6413491 A/G 160438720
    rs8191808 C/G 160439921
    rs8191809 A/G 160439953
    rs8191810 A/G 160439956
    rs8191819 A/G 160441967
    rs8191820 C/T 160441987
    rs8191840 C/T 160452138
    rs8191842 C/T 160453003
    rs8191843 A/G 160453053
    rs8191844 C/G 160453340
    rs2274850 C/G 160450541
    rs2230043 A/C 160454948
    rs8191859 A/G 160455901
    rs8191860 A/G 160455961
    rs2230048 A/T 160459759
    rs8191869 A/G 160459815
    rs8191881 C/T 160463358
    rs8191886 A/G 160464245
    rs2230044 A/G 160464245
    rs629849 A/G 160464820
    rs11552587 C/T -160465339
    rs1050005 C/G 160465360
    rs8191904 A/G 160471039
    rs8191905 A/G 160471123
    rs8191906 C/T 160471223
    rs8191908 A/G 160471609
    rs2230049 C/T 160471684
    rs614754 C/G -160475610
    rs1805075 A/G 160475618
    rs8191933 C/T 160487883
    rs3190229 C/T 160487892
    rs1803989 C/T 160487892
    rs8191955 C/T 160496427
    rs8191956 C/T 160496750
    rs8191957 C/T 160496859
    rs8191958 A/G 160496868
    rs8191959 A/G 160497049
    rs8191960 -/ACAC 160497143
    rs8191961 A/G 160497202
    rs3832385 -/TTTG -160497316
    rs8191962 -/ACAA 160497322
    rs8191963 C/T 160497586
    rs1050015 A/C 160497591
    rs8191964 C/T 160497662
    rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
    rs8191966 A/G 160497672
    rs14531 G/T 160497919


    (Sorry about the formatting; the lameness filter forced me to make it look like that.)

    Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
    You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.

    The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:

    Interestingly, M6P/IGF2R in mice is imprinted in all tissues except for the brain where both alleles are expressed. It is highly expressed in neurons of the forebrain, with the highest expression in the pyramidal cells, the polymorphic layers of the hippocampus, and the granule cell layer of the dentate gyrus; regions involved in emotional behavior, information processing, and memory formation. These findings indicate that M6P/IGF2R may assist in the development of these brain functions. This postulate is reinforced by the identification of M6P/IGF2R as the first putative "IQ gene." By comparing children with an IQ of 160 or higher to those with an average IQ, M6P/IGF2R was shown to be linked with general cognitive ability ("g"). The role of this receptor in the development of cognitive function can now be systematically assessed with M6P/IGF2R conditional knockout mice.

    Tissue-Specific Inactivation of Muri

  112. Age matters by more · · Score: 1
    In Finland, boys and girls are somewhat similar in math and science performance until the age of 14 or so, at which the brightest of the boys start to excel over the brightest of the girls. Testing at the age 10 should be much more gender-independent than testing at a later age, say 18. Some of the genes seem to activate in teens, giving a clear nerd-advantage for guys.

    Also, it is less important to test for the average. Much more can be achieved at higher intelligence levels. Finding out about the highest 10% IQ could be the economically important thing.

    --

    -- Imperial units must die --

    1. Re:Age matters by kria · · Score: 1

      Interesting when observed evidence suggests that in the US, males don't catch up to females until after high school. For example, my high school graduating class had eight girls in the top ten.

    2. Re:Age matters by swv3752 · · Score: 1

      That is more of a cultural thing as well as more rowdiness caused by high levels of testosterone.

      Consider insurance statistics, Males under age 25 have very high insurance rates, primarily because fo this rowdiness. For girls to have a higher grade point average when in US high schools acting up in class wil lead to lower grades seems to be a natural given. grades have more to do with being well behaved than with aptitude.

      --
      Just a Tuna in the Sea of Life
    3. Re:Age matters by Heian-794 · · Score: 1

      Interesting when observed evidence suggests that in the US, males don't catch up to females until after high school. For example, my high school graduating class had eight girls in the top ten.

      At the risk of making a flagrant generalization, I'd say that this is more due to current US policies of doing everything possible to help girls in their education while simultaneously ignoring boys' needs almost entirely, rather than being the result of any difference in Finnish versus US IQs. It's not until the working world that the "girl power" system's influence dissipates. I am loath to educate my young son in the US given the conditions today.

    4. Re:Age matters by Pray_4_Mojo · · Score: 1
      That is more of a cultural thing as well as more rowdiness caused by high levels of testosterone.

      Please don't say you don't actually buy into that myth.

      Teens mis-behave because high schools these days resemble a jail better than they anything educational.

      If high testosterone was the cause of all the acting up, why didn't we hear about renaissance painter apprentices getting into scuffles all the time, and being thrown out of their profession because they stayed up late, drinking too much wine, riding their horse too fast, and chasing after girls.

      They didn't act up because they were doing something that was a) real b) valuable to them and c) were treated as young adults to be mentored.

      Modern education doesn't have a), b), or c) right now. Why do you think college is now a requirement to prove a candidate is mature, responsible, and educated?

    5. Re:Age matters by kria · · Score: 1

      Oh, woah. I didn't received any extra help, nor did I ever hear of any programs at my school that specifically helped girls. My school district was lucky to have things like Art classes at an elementary level. We had pay-for-play sports and the marching band paid for their own busing to competitions. They did not have the money to pay teachers to specifically support girls in anything.

      I _did_ attend several summer programs at local colleges with district monetary support, but that's because I was a top student, not because I was female.

      Now, on the other hand, I have spoken with many fellow engineering/science professional women and heard about the discouragement they received to focus on those classes, though I was lucky enough to not have that problem, either.

  113. Roof by MancunianMaskMan · · Score: 2, Insightful
    Before Bernard could answer, the lift came to a standstill.

    "Roof!" called a creaking voice.

    The liftman was a small simian creature, dressed in the black tunic of an Epsilon-Minus Semi-Moron.

    "Roof!"

    He flung open the gates. The warm glory of afternoon sunlight made him start and blink his eyes. "Oh, roof!" he repeated in a voice of rapture. He was as though suddenly and joyfully awakened from a dark annihilating stupor. "Roof!"

    He smiled up with a kind of doggily expectant adoration into the faces of his passengers. Talking and laughing together, they stepped out into the light. The liftman looked after them.

    "Roof?" he said once more, questioningly.

    Then a bell rang, and from the ceiling of the lift a loud speaker began, very softly and yet very imperiously, to issue its commands. (Aldous Huxley: Brave New World)

  114. Apologies to Orwell by Anonymous Coward · · Score: 0

    All men are created equal, but those guys are more equal than the rest.

    or

    That gene good. No gene better!

  115. Re:IQ testing not science, has a history of bigotr by LParks · · Score: 2, Insightful

    I fail to see how it is absurd, IQ tests pretty accurately measure one type of intelligence. That's not reductive and in fact can be useful to some. High IQ people are often strong problem solvers, so it may help to know your IQ if you are curious about what type of job you might be good at (assuming you like all jobs equally). Similarly, if you can leg press 1,000 lbs., it doesn't mean that your whole body is strong, but that doesn't mean its not an accurate measure of your leg strength. And like IQ, that test says nothing about how successful in life you will be, but it is also far from useless.

  116. Societal Good isn't measured in GDP by PseudoGod · · Score: 4, Interesting

    I agree with h4rm0ny with a couple of things to add. At our point in civilization, the greatest societal good seems to be the greatest good for the greatest number, also known as utilitarianism. But I think the true criteria for "advanced" society is the degree to which it provides for all people. A society is only successful when the needs of everyone are met. Consider that 50,000 people are born every day and 40,000 people die from starvation on a global level. Is civilization "succeeding" because more people born then are dying because of a lack of food? I would say that as advanced as we humans claim to be that our claim to greatness is lacking if as many as 40,000 die from famine each day. Consider that native american tribes and the hunter-gatherer tribes before them had no "class" of people who were homeless, and only starved in the case that there was no food for anyone. Capitalism, does not seem to be the best system in place for meeting societies needs. Also consider a civilization of Indians (that is, in India) who existed 1,500 years ago and did not require police, advanced government, or a military to enforce rules. They lived in cities, farmed, and lived in peace until their lack of military means led to their being forced into slavery by their invadors, the Caucasions from the Caucaus mountains. This ancient civilization was just ahead of its time, it was not stupid, for those of you who will contend that it is. If society today resembled theirs, we would not behave because of the rule of law, we would do good unto our neighbors because we would understand it is in our best interests and the societal good to do so. Post-Newtonian logic argues that there seems to be an inter-relatedness or oneness to the world. That is, what we do to another, we do to ourselves. If we behave in a self-interested manner we see the obvious evil that arises because of it. This was the main point that both Buddha and Jesus shared: that selfishness and not loving another as you love yourself (in Jesus' case) was the cause of societal woes. Humanities main problems stem from its short-sighted approach to its needs in that we feel that once we have met the needs of our individual person, we are satisfied. If a new paradigm were established and societal good and its success were determined on the basis of the degree to which every person in said society is provided for, you would see a very different culture and economy than you see today. Instead of a GREATLY disproportionate distribution of goods that is say, 90% of the wealth being in the hands of the top 5%, you would see wealth be at LEAST more EQUALLY shared among all sectors of society, knowing that societal good is measured in its ability for all to be satisfied. Also, Rousseau's social theory in part bases itself on a theory that if we were all waiting to be born, and did not know whether we would be born rich or poor, we would, assuming that the rich would be, by far the minority, would rather have a roughly equal society where all are basically provided for. This would seem more logically than playing the "lottery" and merely hoping to be one of the few fabulously rich people in the world yet to be created. But as for the original point about intelligence, it seems that a society obsessed with production would value innovation and technology which would make intelligence important. However, I know plenty of intelligent people who have somehow missed the point of life and who also think things which are ridiculous becase they fail the wisdom check to make informed observations and form accurate opinions about the facts of life. And again, the featured article in this story says there is a great deal of variance among those who had the genes just as a group. That means that some who have the altered gene and have an IQ which is 20 pts less than it would be may, in some cases, be smarter than people who don't have the altered gene and therefor and 20 pts more than they otherwise would. If you think intelligence is key to living the good life,

    1. Re:Societal Good isn't measured in GDP by Foobar+of+Borg · · Score: 2, Insightful

      Learn
      To use
      Paragraphs
      And line breaks
      Or else!

    2. Re:Societal Good isn't measured in GDP by Anonymous Coward · · Score: 0

      Otherwise, some decent content there if you can manange to read it. PseudoGod does eventually address TFA.

    3. Re:Societal Good isn't measured in GDP by wave-E · · Score: 2, Interesting
      Also consider a civilization of Indians (that is, in India) who existed 1,500 years ago and did not require police, advanced government, or a military to enforce rules. They lived in cities, farmed, and lived in peace until their lack of military means led to their being forced into slavery by their invadors, the Caucasions from the Caucaus mountains.
      There's no truth to this. You're referring to the Indus Valley Civilization, the super cool early civilization with pluming that declined around 3000 years ago. It is true that there are no signs of large scale conflict about the cities, just as it's true that this is entirely nontopical. This was a civilization of large scale commerce and trade. The cities' decline seems due to shifts in climate, a shift in the flow of the Indus river, and probably internal problems. The Indo-European Aryans of this area didn't raid or conquer cities. Wars and raids were quite common in India 1500 years ago, however.

      Meaningful survival best be at least some of our purpose, and we must see that with the current generation's shift in information distribution, tomorrow's social institutions reflect survival's needs.

    4. Re:Societal Good isn't measured in GDP by Columcille · · Score: 1

      I guess we know who *doesn't* have the gene. :)

      --
      I love my sig.
    5. Re:Societal Good isn't measured in GDP by PseudoGod · · Score: 1

      You are right that I got the time period wrong, I got out my book written by Dr. Vajpeyi and the Indus civ. existed between 3000-2000 b.c. It came to an end around 1750 b.c. at the latest. Vajpeyi "It is believed that the invading Aryans destroyed the civlization." And Vajpeyi also maintains that "whatever authority controlled the people did so without much force."

      On this point, he told our class that they did not have conventional police as we would think of them today. Vajpeyi has about 3 doctoral degrees, and is a native to a region of India especially valued for having one of the most sacred parts of the Ganga river, making him and most of the residents of the region a rather high Braman caste.

      So I'm just telling you, what I said about the Indus valley civilization can be substantiated, but I will concede that much of what we do know may not be universally accepted.

      As far as this being non-topical, my original post was in response to someone's post that we should simply kill everyone with a low IQ. And I was merely contrasting such a view with another alternative practiced by a civilization that, perhaps, was more evolved for meeting the needs of its members better than ours does.

    6. Re:Societal Good isn't measured in GDP by colman77 · · Score: 1

      Congratulations; you earned a "Read More" without mentioning the GNAA! Automatic +5 insightful!

      You, my friend, clearly had more than a few things to add.

    7. Re:Societal Good isn't measured in GDP by wave-E · · Score: 1

      I just really don't think your professor's argument can be substantiated. There is no sign of warfare or mass migration about the archeological sites, that much is agreed. Moreover, people continued to live in the cities for hundreds of years after the decline of the traditions and vast trade networks that seem to mark the cities.
      Information supported by Kenoyer's Ancient Cities of the Indus Valley Civilization.

    8. Re:Societal Good isn't measured in GDP by PseudoGod · · Score: 1

      What we know:

      In 1925 while building a railroad archeologists found urban ruins which were unknown up to that point. They were the remains of two cities: Mohenjo-daro and Harappa. One thing they noticed was that although they had the ability to make sharp tools such as knives, whose size indicates that they were probably for cooking, there wasn't the typical additional application of this technology for warfare.

      There was a steady decline and people continued living in the cities, but we do know that around 1500 b.c. the invading Aryans destroyed the city of Mohen-Jordaro. However, what happened to Harappa is uncertain.

  117. Yes, yes, it's a rich tapestry by Snuggly_Soft · · Score: 1

    Why play the gender card? We all judge on a case-by-case basis, don't we? Although, I've noticed that most of my male friends are eihter brilliant or dumb, whereas my female friends lie across a broad spectrum. No pun intended.

  118. 20 points ? by codeboost · · Score: 1

    Cool! I want ten of those genes. How much did you say they cost? Do you sell them in the mall ?

  119. Well there is certain question... by JollyFinn · · Score: 1

    There is plenty of ways that the gene can do that...
    One is to reduce the effect of gene that make males think sex more and earlier in their life.
    There is even small chance of just increasing activity in early age.
    There are plenty of indirect and direct things that affect IQ tests, and a gene that just correlates with those result might just be one of those indirect things that just can be overcome.

    --
    Emacs is good operating system, but it has one flaw: Its text editor could be better.
  120. You are smrt? by tomzyk · · Score: 1

    Ahhh.... in the words of Homer:
    "I am so smart. I am so smart. S-M-R-T! I mean S-M-A-R-T!"

    --
    Karma: NaN
  121. From the data I have seen... by Ogemaniac · · Score: 1

    IQ does not change significantly after age 7 or so. I wouldn't get my hopes up about things "leveling out". Your reasoning sounds here more like wishful thinking. Otherwise, good post.

    This could explain a lot, though. It is known that males have a larger variability in IQ than females. A single gene (or small set of genes) that swings IQ by 20 points only in males would be consistent with this observation.

    1. Re:From the data I have seen... by paulsgre · · Score: 2, Interesting

      My comment was indeed speculative, however, I would be interested to see longitudinal data of IQ tests repeated across a varied population over time, following them from early childhood through adulthood. As an aside, the article noted that the "scientific conference" was in Durham, NC. The researchers are from Duke, which if i'm not mistaken, is in Durham, NC. Is anyone familiar with this conference? Or are we talking about a Duke biology department poster session.... BIG difference.

    2. Re:From the data I have seen... by Zoyd · · Score: 1

      paulsgre wrote: I would be interested to see longitudinal data of IQ tests repeated across a varied population over time

      http://www.google.com/search?q=nlsy+bell+curve

  122. Please Her More Greatly on Dinner Table by tezza · · Score: 2, Funny
    Newest Geene Th3rapy Pills. Garanteeed to wqork. Ignore useless im1tatiuns.

    Never feel stoopud over the Dinner conversation. Solve Sudoku puzz in seconds.

    Most best source on the Net.

    100 Tablets £100
    200 Tablets £125
    300 Tablets £150

    --
    [% slash_sig_val.text %]
  123. Chicks are for popping/nurturing babies, no more by Anonymous Coward · · Score: 0

    Chicks are for popping babies. No need for any more IQ than what's needed for that. The less IQ the better since if you had any brains, popping babies would be the last thing on your list of things you wanted to do. Find any guy and ask him if he'd want to pop a kid. You have got to be stupid to say "why yes, I would like to carry and pop a seven pound kid out of my body through a teeny-tiny hole".

  124. Wrong in so many ways by BerntB · · Score: 3, Informative
    I guess we have this to compensate. I wonder how many other positive genes manifest only in males?
    Anyone with a teeny bit of biology knowledge can tell you that it doesn't work that way.

    Start with Googling for a definition of allele, to understand the concept.

    If some gene-dependent trait is "positive" or not depends upon the environment. (See e.g. malaria resistance and red blood cells.)

    In general, there are two things influencing wether a trait is on for males/females.

    • Males only get one copy of the genes on the X chromosome, so a non-dominant trait shows up easily because there is only one copy (e.g. colour blindness).
    • Also, genes are often regulated differently for between males/females (i.e. what genes are on or not).
    --
    Karma: Excellent (My Karma? I wish...:-( )
    1. Re:Wrong in so many ways by Savantissimo · · Score: 1

      If some gene-dependent trait is "positive" or not depends upon the environment.

      Yes, the desirability of a gene's effect is sometimes affected by certain environments, but that does not change the fact that some genes are good and some are bad, particularly when dealing with a given range of environments, for instance such as exists in the US or the developed world in general. In our environment smarter is better.

      --
      "Is life so dear, or peace so sweet, as to be purchased at the price of chains and slavery?" - Patrick Henry
    2. Re:Wrong in so many ways by BerntB · · Score: 1
      smarter is better.
      The usual definition in biology for "better" is that a gene is increasing it's share in the next generation. I am not at all certain that intelligent people get more children in the area where I live.

      Even if so, we have genes with multiple effects. How much trade offs are worth it for intelligence?

      --
      Karma: Excellent (My Karma? I wish...:-( )
  125. The "stupid" gene in Men... by EmagGeek · · Score: 1

    I wonder if there was a strong correlation between the 10 year-olds that had the gene and membership on slashdot..

    *nyuk nyuk*

    Come on, you know that's funny...

    1. Re:The "stupid" gene in Men... by chawly · · Score: 1

      Yes, that's funny. Made me wonder why you picked on 10 year olds. I'd have thought 5 year olds and without the gene would be the group to pick. And you have to know I'm serious !

      --
      How many beans make five, anyhow ? ... Charles Walmsley
  126. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 1, Insightful

    "Testing is nothing but a measure of how dedicated you are to your school work and how much you practiced for tests. Pure and simple."

    Even if that were true (it's not, since IQ tests are highly consistent), how does it make IQ tests meaningless? Sure, IQ tests, and SAT scores, are far from perfect, but they are also far from useless.

  127. Because as pointed out in Dillbert... by Lanboy · · Score: 1

    ....Intelligence has far less practical use than you might think.

  128. Studies that don't show a relationship by Anonymous Coward · · Score: 0

    Some claim that genes don't have as much influence as we assume. See e.g. The Biology of Belief by Bruce Lipton, a cell biologist.

  129. semantics by tezbobobo · · Score: 1

    I think what they mean is that they have found a gene which 'indicates' a difference in IQ in males - not 'affects'. There is a BIG difference between correlation and causation. My fiance wishes me to add, "GET IT RIGHT."

  130. obSimpsons by Anonymous Coward · · Score: 0

    A gene that makes men stupid but has no effect on women? Isn't that a Simpsons plot?

  131. Do your own math by ThinWhiteDuke · · Score: 1

    Under current law, it costs an employer a minimum of about $500/week (depending upon the state) to employ a person for 40 hours at minimum wage.

    40 hours a week, $3 per hour makes $120 per week. I honestly can't see how your cognitive system can reconcile this with the $500/week minimum cost. Do you really believe that, in the US, wages taxes add up to more than 300%?

    --

    It would be nice to be sure of anything the way some people are of everything.
    1. Re:Do your own math by Zoyd · · Score: 1

      ThinWhiteDuke: minimum wage [...] $3 per hour

      http://www.dol.gov/esa/minwage/america.htm

  132. IQ != intelligent by Anonymous Coward · · Score: 0

    Hi,
    IQ is irrevelent to intelligence or capable to do something "smart" etc.

    1. Re:IQ != intelligent by indifferent+children · · Score: 1

      Warning to intelligent people: there is a campaign being waged against the very idea of intelligence. Attacking IQ is just one part of it. There is an attempt to 'redefine' intelligence out of existence by making the term meaningless. Do you remember 'Emotional Intelligence' (aka people skills), 'Musical Intelligence' (aka talent), 'Sports Intelligence' (aka athletic prowess)? The goal behind calling these things 'intelligence' is to deny that some people are smarter than others. If you've ever known (or worked for) an idiot, you should not fall for this!

      --
      Censorship is telling a man he can't have a steak just because a baby can't chew it. --Mark Twain
    2. Re:IQ != intelligent by Bloke+down+the+pub · · Score: 1
      Warning to intelligent people: there is a campaign being waged against the very idea of intelligence.
      Is it being waged by people like the grandparent? In other news, being tall isn't all it's cracked up to be, claims National Association of Midgets.
      --
      It's true I tell you, feller at work's next door neighbour read it in the paper.
  133. Nope, not found in beer by hemanhedman · · Score: 1

    My tests has shown that this gene isn't found in beer.

  134. $500/wk? by mjrmjr · · Score: 2, Informative

    How do you arrive at that figure? $5.15/hr @40hrs= $206. The employers tab for social security taxes is 6.25% of that, so add $13. Do employers pay a matching portion of the medicare tax, too? If so, add another $2-3. Now we're at $222. Where does the other $275 come from? It can't be health care costs, since we're only talking about what the law requires. Unemployment insurance? Required payments into a workman's comp fund? Maybe you can elaborate?

  135. X gene by sonictheboom · · Score: 1

    bet its really really similar to the X gene...I know most geeks loose a lot of intelligence when there are too many of those nearby

  136. the CA border by CiXeL · · Score: 1

    we moved from los angeles to miami. cubans are flooding over the CA border now and migrating through the southern states to get to miami. they discovered its much MUCH easier to jump the border there than float across to miami. add 1 more country to the list of illegal immigrants. heh, and they think they can keep suitcase nukes out.

    1. Re:the CA border by Frank+T.+Lofaro+Jr. · · Score: 1

      add 1 more country to the list of illegal immigrants. heh, and they think they can keep suitcase nukes out.

      Illegal immigrants aren't radioactive and don't give off gamma rays and neutrons.

      --
      Just because it CAN be done, doesn't mean it should!
  137. How many Slashdot articles said IQ score is bunk? by almound · · Score: 1

    It speaks volumes about human intelligence that, 100 years later, the most common reference to intelligence metrics is the Stanford-Benet score. What did Stanford-Benet do to warrant such worship?

    Little, apparently. IQ has been marketed admirably well over the decades, but that is not the fault of psychologists. IQ score appeals directly to the ego of certain individuals and, therefore, reference to it is remarkably effective as a marketing ploy. (Sorry people.) It pays Madison Avenue to play up IQ as much as possible. Many slashdotters go ga-ga over it.

    (For the record, this is the first that I have commented on IQ in the /. forums ... and my Stanford-Benet test score went off the scale. Does that make me a super genius? No. It means while still a child I was able to answer a question at the superior adult level. That sounds like an outlier to me, not a trend. The item analysis of the Stanford-Benet is just not that accurate.)

  138. They're testing "G" by Tau+Zero · · Score: 1
    The whole point of using an IQ test instead of a math or vocabulary test is that IQ changes little over time. Individuals have good and bad days, but population scores are relatively stable.

    It goes without saying that this test needs to be repeated with a larger group. If there's a way to prevent a large population with distinctly sub-normal IQ's from gumming up the works on the job, in schools, the criminal justice system... we'd be far better off. Maybe all we need is a test like the one for the cystic fibrosis trait, to find people who shouldn't have children with each other.

    --
    Time is Nature's way of keeping everything from happening at once... the bitch.
    1. Re:They're testing "G" by CastrTroy · · Score: 1

      This is partly why I think humans will start to de-evolve at some point. It's becoming easier and easier as society progresses to survive, without any survival skills. Also, the people who have less desirable traits end up having more children than those with more desirable traits. I think at some point, humans will reach a high point, at which point, things will start going down hill, because anybody survive and reproduce, regardless of how useful they are to the species.

      --

      Anthropic principle: We see the universe the way it is because if it were different we would not be here to see it.
    2. Re:They're testing "G" by Anonymous Coward · · Score: 0
      It goes without saying that this test needs to be repeated with a larger group. If there's a way to prevent a large population with distinctly sub-normal IQ's from gumming up the works on the job, in schools, the criminal justice system... we'd be far better off. Maybe all we need is a test like the one for the cystic fibrosis trait, to find people who shouldn't have children with each other.

      Yes, then we could have a master Arya^H^H^H^H intelligent race!

    3. Re:They're testing "G" by 3GMobile · · Score: 1

      Agree with this fully, its easy to see the effects of too much in social handouts in the UK...the main people getting them are those unwilling to work/learn/obey the law and then have the most kids who grow up just like them. In many cases teenage mums just make a job out of having kids as soon as they can for free housing and a host of benefits are then theirs for the taking. Even more anoying is being on a flight to go on holiday and you overhear someone talking about it being their 3rd holiday that year while on social security and I`m only able to have 1 holiday a year working my ass off!! Yes im aware Ive tarred a huge number of people with one brush....

  139. Another one by Anonymous Coward · · Score: 0

    Another good gene to have carried by the female: Male Pattern Baldness. On a male it looks distinguished.

  140. Old News... by gwayne · · Score: 1

    Females have known for years that the Y chromosome affects IQ.

  141. I agree, actually by Dr.+Eggman · · Score: 1

    Yes, IQ tests generally match up our expectations and no, imperfections does not nullify the implications of their results. Yes, it is very likly that this gene does affect the IQ test results to some degree.

    However, IQ tests are affected by other factors as well. All tests are affected to some degree by unforseen variables, but the IQ test is one in which those variables can have a very strong affect on the results. That is why I do not think that IQ tests should be used as evidence for saying certain genes affect intelligence short of cases in extreme difference (which I do not see 20 points as covering.)

    I'll be the first to admit, my original post completly missed the point I was trying to get across. I should have made it more clear that I saw the lack of cultural/gender standard as an example of problematic factors in IQ tests rather than as an invalidation of this study's results.

    --
    Demented But Determined.
  142. How meaningful is it? by mosb1000 · · Score: 3, Interesting

    The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested. If they don't relate to ones actual ability to be a productive member of society, it's hard to argue that they're meaningful.

    1. Re:How meaningful is it? by Surt · · Score: 2, Insightful

      Maybe the smarter you are the less interested you are in being a society drone all your life. Hence the lack of correspondence on that scale.

      A more interesting question might be: how well does it correspond to the multi generational success of your genetics.

      --
      "Who is the Journal of Quantum Physics going to believe?" --Stephen Hawking
    2. Re:How meaningful is it? by Eli+Gottlieb · · Score: 1

      It probably correlates negatively. Or has someone on here gotten married?

    3. Re:How meaningful is it? by VAXcat · · Score: 1

      That's because your family class, and family and social connections are far far more connected with sucess than any actual ability you have.

      --
      There is no God, and Dirac is his prophet.
    4. Re:How meaningful is it? by egomaniac · · Score: 2, Interesting

      The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested. If they don't relate to ones actual ability to be a productive member of society, it's hard to argue that they're meaningful.

      Fortunately, in the real world people are actually doing research on this and not just speculating.

      Taken from http://en.wikipedia.org/wiki/Intelligence_quotient :

      Research shows that intelligence plays an important role in many valued life outcomes. In addition to academic success, intelligence correlates with job performance (see below), socioeconomic advancement (e.g., level of education, occupation, and income), and "social pathology" (e.g., adult criminality, poverty, unemployment, dependence on welfare, children outside of marriage). Recent work has demonstrated links between intelligence and health, longevity, and functional literacy. ...

      General intelligence (in the literature typically called "cognitive ability") is the best predictor of job performance by the standard measure, validity. (emphasis mine)

      There are some great charts relating IQ to things such as welfare dependence (31% of under-75 IQs, 0% of over-125 IQs) and being incarcerated (7% of under-75 IQs, 0% of over-125 IQs). Pick a statistic relating to "life success" and you'll find it to be positively correlated with IQ.

      --
      ZFS: because love is never having to say fsck
    5. Re:How meaningful is it? by Krach42 · · Score: 1

      The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested.

      Funny... I had a really high IQ, but I did very poorly in school. Of course, I was lazy and did little homework. Now, granted I always did well on tests (unless I just had no idea at all about anything that the test was asking. This has happened about 2 or 3 times in my life.)

      "Academic ability" is more related to the personal drive and ambition of the person, not their actual intelligence. "Academic capability" is definitely more related to their IQ than their personal drive, but that's more of a theoretical capacity than an actual application.

      Theoretically, someone with a high IQ is more capable for success in the real world, too, but it doesn't mean that they will apply themselves and actually succeed.

      Honestly, we complain that IQ and academic performance don't indicate well the real world success of a person, because of common exceptions, but on the average, these indicators are actually the best indicators we have.

      --

      I am unamerican, and proud of it!
    6. Re:How meaningful is it? by mosb1000 · · Score: 1

      "these indicators are actually the best indicators we have."

      True, but that doesn't mean that they're an adequate measure of someone's ability to succeed. Using IQ tests to place people in jobs (or to determine how accessible education, which may allow them to take on a job, should be to them) is completely unacceptable because of the inadequacies of the tests to truly gauge what someone is capable of.

    7. Re:How meaningful is it? by mosb1000 · · Score: 1

      Well that, but also your social intelligence. Remember, your ability to interact with others is a vital life skill, and it is not really addressed by IQ tests (neither are those other things).

    8. Re:How meaningful is it? by Krach42 · · Score: 1

      Honestly, there's no way to accurately gauge how someone would do in a job except hire them and try them out.

      We pick arbitrary reasons to cut the chaff out. We're not really looking for any sort of procedure that produces the best or most successful candidate for a job, we're just trying to find one that's reasonably productive.

      Seriously, just about everything sucks for figuring out if someone would be well suited to a job. But if one can dazzle a company with what they know... well, that's just like a magic trick. It's pretty cool, and people fall for it.

      Ideally, we could plug people into a VR machine and they could live out 25 years of work in the machine in the blink of an eye, then we'd know if they were worth hiring or not...

      Of course that's just stupid.

      --

      I am unamerican, and proud of it!
    9. Re:How meaningful is it? by r00t · · Score: 1

      Intelligence was great for the multi-generational success of your genetics until...

      1. we invented birth control

      2. we let women support themselves

      3. we made kids costly by banning child labor

      So, on a genetic basis, the civilized part of the world probably peaked about 50 to 150 years ago. The effect has been hidden by better nutrition, etc., but someday we'll be hurting.

  143. IQ is supposed to level out with age by evenprime · · Score: 3, Informative
    IQ does not change significantly after age 7 or so. I wouldn't get my hopes up about things "leveling out".

    Got a reference handy? I may be reading this incorrectly, but Psychology Today published an article that appears to disagree with you.

    FACT 5: IQ evens out with age

    Imagine interviewing two biological siblings, adopted by two different middle class families, at age five and again at 18. Will their IQs be more alike when they are younger and living in the homes of their adoptive parents, or when they are older and living on their own? Many people reason that IQs will be more alike when they're younger because they are under the influence of their respective middle class parents. Once they are on their own, they may diverge as they become exposed to different experiences that may influence their intelligence differently.

    But according to data, this isn't true. As these siblings go out on their own, their IQ scores become more similar. The apparent reason is that once they are away from the dictates of their adoptive parents, they are free to let their genotypes express themselves. Because they share approximately 50% of their segregating genes, they will become more alike because they are propelled to seek similar sorts of environments. Genes may be more potent in making siblings alike than similarities in home environments.

    --

    "Weapons should be hardy rather than decorative" - Miyamoto Musashi
    I think that goes for OS's too
    1. Re:IQ is supposed to level out with age by Zoyd · · Score: 2, Informative

      evenprime wrote: > IQ does not change significantly after age 7 or so.

      Got a reference handy?


      The g Factor.

    2. Re:IQ is supposed to level out with age by Henry+V+.009 · · Score: 1

      Yes, heritability of IQ increases with age. The highest heritability estimates tend to be from studies of adult identical twins.

    3. Re:IQ is supposed to level out with age by hackstraw · · Score: 3, Interesting

      Got a reference handy? I may be reading this incorrectly, but Psychology Today published an article that appears to disagree with you.

      Psychology Today is essentially the same as Redbook. It is very watered down, and almost pseudoscience. I would in no way put it in the same ballpark as Popular Mechanics or Popular Science, even though those are fairly watered down as well, they don't focus on relationships or gossip. The latter magazines also have a variety of topics in them.

      An example of the BS that psychology today puts out is what you quoted. Two siblings that have different measured IQ at one time will average to be basically the same after time.

      Duh!

      IQ can vary as much as 10 points or more within an individual at any given time. 15 points is the standard deviation. These scores can particularly vary in younger subjects that take the test because of things like they don't have a very long attention span, they don't give a shit sometimes if ever, they are stoned at the time, they are lazy, or whatever reason.

      Now, if Psychology Today said, "IQ is supposed to level out with age" and showed that all people over 60 years old had the same (I guess higher or lower) IQ, then this would be saying something. Maybe.

      The average IQ of a middle class American is about 110 (middle class is actually not "middle"), and the average IQ of the population is about 100, again with a standard deviation of 15.

      For the most part, kids have about the same sociological level as their parents, as well as many of the other traits due to genetics and 18+ years of training.

    4. Re:IQ is supposed to level out with age by Bloke+down+the+pub · · Score: 1

      The example you cited is two siblings. It says nothing about what the difference between the IQs of two unrelated people will do over time.

      --
      It's true I tell you, feller at work's next door neighbour read it in the paper.
  144. stupid. pre-mature science. by CDPatten · · Score: 1

    The science community has gotten out of control. They have started to make wild claims before they have ANY understanding of what they are talking about. This is a pathetic attempt to raise money.

    The reality is that gene may be a characteristic of what makes REALLY someone smart or not. Or it may have nothing to do with it at all. They have no idea, they just decided to make a wild claim based on a semi-conclusive survey that would barely hold wait in a political campaign never mind a scientific study.

    Let me give you an example;

    I found the secret to genius. No muscle mass. Have you noticed the smartest people around don't have a great deal of muscle mass? I surveyed 10,000 people and on average my results are conclusive. Muscle rots the brain.

    Obviously that is not true. My study could have shown those results, but muscle certainly doesn't rot the brain. Anyways, I think it's clear that these guys don't contain the gene ;)

    1. Re:stupid. pre-mature science. by tedrlord · · Score: 1

      The article actually mentions that so far they just see a correlation, and further study is required to determine if there is actually a direct link. That was fairly surprising compared to the way most scientific journalism presents these studies, I thought. Almost, you know, responsible.

      --
      [insert witty quote here]
  145. this would be great by Anonymous Coward · · Score: 0

    ...if crime were an economic issue.

    It isn't. You're wrong. You'll figure this out someday. Nothing's going to convince you lefties today, but someday you'll admit I was right.

    1. Re:this would be great by Chowderbags · · Score: 1

      Of course it isn't cause by people wanting more than they have, it's obviously caused by demons possessing people! Quick, call the priests, we need to exorcise everyone, just in case!

  146. Productivity != more stuff by sita · · Score: 1

    But I can make an educated guess that when you talk about efficiency, you're referring to productivity and GDP etc. Is that our whole aim as a species? To manufacture more and more goods? Because you need someone to sell them to and people buy to improve their lives. The greatest possible satisfaction for the largest possible number is the real goal of society in my book - and working in a frenzy to get by isn't it.

    Economic growth does not necessarily mean making more stuff (using more resources etc). It often means doing the same stuff better and cheaper, using less resources and less time. In the end it could mean work less for me, spending more time with my family and still have all the stuff we have now, not more, not less.

    1. Re:Productivity != more stuff by h4rm0ny · · Score: 1


      You're absolutely right. I was struggling to find a way to sum-up the value system of the OP and settled for productivity and manufacturing. What I should have said was: outcompeting other societies / countries economically.

      But it's /. . I'll live with it. ;)

      --

      Aide-toi, le Ciel t'aidera - Jeanne D'Arc.
  147. Wrong! by Anonymous Coward · · Score: 0

    How did scientists decide that intelligence was unipolar and quantifiable, and why did the standard keep changing over time? Gould's answer is clear and simple: power maintains itself. European men of the 19th century, even before Darwin, saw themselves as the pinnacle of creation and sought to prove this assertion through hard measurement.

    Amazing how everything in the field of IQ tends to relate to major changing social events - sudden immigration booms and civil rights movements amongst Blacks too.

  148. Typo? by imnojezus · · Score: 1

    I think they misspelled "JEAN"... but then that wouldn't be anything new; I've known since high school that there were jeans out there that instantly made me 30 I.Q. points dumber.

  149. What about Bush? by chiph · · Score: 1

    Anyone got a sample of President Bush's DNA to submit for testing?

    1. Re:What about Bush? by Anonymous Coward · · Score: 0

      More valuable would be a sample of his DNA that could get him impeached.

  150. Proposed name for the IQ lowering gene cluster: by Unknown+Poltroon · · Score: 1

    "Naked Chicks"

    --
    All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
  151. Intelligence vs wisdom vs charisma by Anonymous Coward · · Score: 0

    You are confusing intelligence, wisdom, and charisma. Go back and read the Player's Handbook.

  152. Correllation not Causation by Dareth · · Score: 1

    This variation, he and his colleagues found, correlates with a lower IQ.

    Even though they only tested Caucasians, might there not be some other causing factor?
    Is there another common factor(s) shared between these individuals?

    Why does it only affect males? I think the "norms" for the IQ test could be gender biased.

    Interesting for debate, but nowhere near the threshold of declaring that this gene directly affect IQ. Scores were averaged for groups. You could have this gene and still have a higher than average IQ.

    --

    I only look human.
    My mother is a halfling and my dad is an ogre, so that makes me an Ogreling
  153. Additional testing needed by Anonymous Coward · · Score: 0

    Do you suppose we could test the "most brilliant man" Harriett Miers ever met?

  154. Genetic race variation by SeanDuggan · · Score: 1

    At a conference I'm just about to fly back from, one of the talks detailed how one metabolic mutation was carried by 10% of Caucasians, this fell to 4% in Chinese populations, and only 1% in Japanese.
    Plenty of those genes. Just look at lactose intolerance. Those of western Eurasian descent can generally drink milk after weaning. The rest generally cannot. *wry grin* Unofrtunately, I'm one of the few of Eurasian descent who can't, although it's something that's developed as I get older and I produce enough lactase for about half a glass a milk at a meal, enough that I don't have to worry about checking for the presence of lactose in the ingredients of a meal.

    --
    This sig has absolutely no significance and serves only to take up screen space and waste the time of the reader.
  155. Having a high IQ is like having alot of money... by aw232 · · Score: 1

    Having a high IQ is like having alot of money: Everybody wants it, nobody knows what to do with it, and it doesn't coorelate with anything substancial like success or happiness.

    For every Dr. Hibbert there's a Comic Book Guy.
    "I am smart...much smarter then you...Hibbert"

  156. I have a theory by RobinH · · Score: 1

    I have a theory that men carrying this gene tend to reproduce more per generation than men without the gene, because IQ is correlated to income, and people with higher income have larger families.

    But it's just a theory. I'd like science to go and run some numbers to test it for me. Anyone looking for a grant? :)

    --
    "I have never let my schooling interfere with my education." - Mark Twain
    1. Re:I have a theory by tedrlord · · Score: 1

      People with higher income tend to have smaller families than people with lower income, actually. I don't have the numbers, but I believe they have enough kids on average to sustain the population (2 kids per two adults), while poor families are larger. It likely has to do with differences in education, as well as cultural differences.

      --
      [insert witty quote here]
    2. Re:I have a theory by chawly · · Score: 1

      Me too, brother, me too.

      --
      How many beans make five, anyhow ? ... Charles Walmsley
  157. Genetics and Race by SeanDuggan · · Score: 1
    At a conference I'm just about to fly back from, one of the talks detailed how one metabolic mutation was carried by 10% of Caucasians, this fell to 4% in Chinese populations, and only 1% in Japanese.
    Plenty of those genes. Just look at lactose intolerance. Those of western Eurasian descent can generally drink milk after weaning. The rest generally cannot. *wry grin* Unofrtunately, I'm one of the few of Eurasian descent who can't, although it's something that's developed as I get older and I produce enough lactase for about half a glass a milk at a meal, enough that I don't have to worry about checking for the presence of lactose in the ingredients of a meal.

    *grumble* Messed up closing the EM tag, forgot a virgule.

    --
    This sig has absolutely no significance and serves only to take up screen space and waste the time of the reader.
  158. Watching ESPN == Sign of NOT having the gene by sadler121 · · Score: 1

    This might confirm my theory of the dumbing down of the American male in relation to watching sports. You have to have a low IQ (not have this gene) in order to get any plesure out of sweaty men trying to put a little ball in a hoop, or a bunch of sweaty mean in protective gear falling on top of each other to stop another sweaty man from scoring.

    I swear, ESPN will be THE downfall of American socity.

  159. "The Marching Morons" by Anonymous Coward · · Score: 0

    Your idea was the underlying premise behind one of C.M. Kornbluth's most famous short stories -- "The Marching Morons".

    http://en.wikipedia.org/wiki/Cyril_M._Kornbluth "a satirical look at an overpopulated future, with a population consisting of a few geniuses and a huge number of stupid people, in which the few geniuses are working desperately to keep things running from behind the scenes."

  160. Of course you do by flyinwhitey · · Score: 1

    "other kinds of smarts -- notably, common sense and street smarts -- are really more important."

    Ah, the classic response from someone who is sensitive about their 100 WISC score, and is looking for an alternative way to measure their worth.

    It all the same thing man, it's just that people apply intelligence differently.

    --
    How pathetic are you that you follow me from topic to topic and waste all your mod points at once modding me down?
  161. Dude, the guy was just citing sources. by donscarletti · · Score: 1

    Seriously, the grandparent was just pointing out where he found out his information, not making any connections at all. I think it is a good thing that someone on slashdot actually pointed out where they got their info for once. You don't see that much at all around here and it gets interpreted as a "thems damn wetbacks took our jerbs!" discussion.

    --
    When Argumentum ad Hominem falls short, try Argumentum ad Matrem
  162. not that interesting by spammyd · · Score: 1

    the gene only lowers intelligence. there are dozens of genetic abnormalities that cause impaired intellegence. this is nothing that new. when they find a gene that causes above average intellegence, now that would be a great thing

  163. more evidence by buddyglass · · Score: 1

    ...against the premise that men and women are "wired" exactly the same. I wonder if this could explain some of the additional variation in male IQ compared to that of females? That is, if you believe Larry Summers.

  164. Duh! by mdielmann · · Score: 1

    People with different skills and talents will experience different challenges and benefits. News at 11!

    --
    Sure I'm paranoid, but am I paranoid enough?
  165. Females vs Males... by ThankfulJosh · · Score: 1

    What would be really interesting would be to compare IQ of:

    A. Females vs Guys w/ IQ gene
    B. Females vs Guys w/o IQ gene

    Then we would know whether 1) the females already have the advantage from some other gene, and so aren't affected by having another instance of that effector, or 2) guys really are the only ones with an IQ gene (that we know about).

  166. New Insgiht on These Gense Discovered by Anonymous Coward · · Score: 0

    The gene that makes men smart is mutualy exclusive with the gene that makes men fall in love. Ergo, love makes you stupid.

  167. Viability of genes by JSBiff · · Score: 1

    The question, in natural selection is, can a gene reproduce? Even if a lower IQ really correllated to a lower level of intelligence (which there seems to be a lot of debate about - I'm no expert in the field, but I've read that it is more an indicator of your education and culture than your actual intelligence), it still doesn't seem to have any effect on reproduction - dumb guys have children all the time.

    So, I contest your assertion that "A gene that depresses intelligence, without any trade-off, would be quickly eliminated by natural selection". Truth is, for a gene to be eliminated by natural selection, it has to have a highly negative impact on the host. Slightly negative impacts will not be detrimental enough to prevent propagation.

  168. High IQ does not necessarily mean intelligent by wealthychef · · Score: 1

    I am not convinced that IQ measurements are meaningful enough that a 20 point swing means all that much anyhow. There is a lot of controversy about what IQ really measures.

    --
    Currently hooked on AMP
  169. Watch your footing on that slippery slope by Medievalist · · Score: 1
    Maybe all we need is a test... ...to find people who shouldn't have children with each other.
    Sure, eugenics has always been popular with the voters.

    Poverty does far more harm to children than lack of societally-approved DNA.

    If you think about it, the rich are exposed to less evolutionary pressure than the poor. The "de-evolution" that the right wing worries about so much is far more likely to happen among the children of privilege than among the poor population, who are still subject to many types of sexual selection (poor people are uglier than those with expensive dental care) and predation (murder rates are higher in poor population) that have been completely prevented among the rich.

    Still, the rich will always appear to be smart, due to remedial surgeries and education (braces and prep school anyone?) while the majority of the poor will appear to be less genetically fit (due to poor nutrition, less access to expensive medical care, greater exposure to pollution, in-utero drug exposure, etc., etc., etc.).
  170. Some jeans reduce male IQ? No kidding! by The+Fun+Guy · · Score: 1

    Hell, I don't even need to RTFM - I could have told them certain jeans reduce IQ in males. Those low rise hip-huggers are the biggest culprit, although the kind with strategic rips that allow little flashes of blue panties also have a noticable negative impact on male cognitive ability.

    I'm just surprised the resultant decline in IQ was only 20 points.

    --
    The man who does not read good books has no advantage over the man who cannot read them. - Mark Twain
  171. Re:Obligatory citation about absurdity of IQ testi by tedrlord · · Score: 1

    IQ tests were originally developed to detect children with learning disabilities, and they're still good for that, though in a more detailed form. I took the Wechsler Adult Intelligence Scale test in college to determine if I had a learning disability, and I found it to be fairly comprehensive for what it does. It doesn't reduce a person's thinking ability to a single number either, which is nice.

    But I do agree in general. Using IQs as a general measure of a person's ability to think is pretty useless.

    --
    [insert witty quote here]
  172. Lets find the gene... by kirk26 · · Score: -1, Troll

    that makes people use Linux. We need to remove that from humans. Die Linsux Die!

    --
    Linux sucks. It is an underground OS that is completely unstandardized. Linux geeks, get the fuck over yourselves.
  173. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    It might have alot to do with the fact that Gould is dead.

  174. Call for additional research by DaveAtFraud · · Score: 1

    Thought of the same joke. Looks like the next thing these folks should investigate is the gene that determines whether someone has a sense of humor. I see from some of the other replies that its expression seems to not be especially prevalent on /. today.

    Cheers,
    Dave

    --
    They that can give up essential liberty to obtain a little temporary safety deserve neither safety nor liberty.
    Ben
  175. M6P/IGF2R history by TheSync · · Score: 1

    M6P/IGF2R has been considered to be an "IQ" related gene for a while, for example this claims: By comparing children with an IQ of 160 or higher to those with an average IQ of 100, it was shown that the M6P/IGF2R is strongly associated with general cognitive ability ("g").

  176. Mean = sum/count by Dire+Bonobo · · Score: 1

    > IQ is a quantification of variance within a population. It does not sum.

    It does when you're finding its mean value. By definition, mean = sum/count.

    1. Re:Mean = sum/count by Anonymous Coward · · Score: 0

      Yeah, if wikipedia says it, it must be true. just ask Siegnethaler.

    2. Re:Mean = sum/count by Dire+Bonobo · · Score: 1

      Do you dispute the mathematical definition of the arithmetic mean? Plenty of more authoritative sources, such as MathWorld or a 4th-grade textbook, would be more than happy to show you quite how wrong you are.

      There's nothing wrong with making a foolish comment based on a misunderstanding and being corrected - misunderstandings happen. Continuing to defend a literally-elementary mistake, though, shows willful ignorance or malice. Don't be that jerk.

  177. If I recall by onShore_Jake · · Score: 1

    I'm pretty sure that he said "wireless devices produce electromagnetic radiation ("signal"), for that reason they consume much power. This technique could enable another speed step of CPU's if it can be quickly adopted to industrial production process. if their claim about improvement of 10^4 - 10^5 is true, it will surely remove this kind of bottleneck for at least another decade!"

    That's the problem.

  178. wow... by Run4yourlives · · Score: 1

    That's the most retarded comment ever.

    Tell me more about your childhood traumas of being bullied by jocks, why don't you?

    Have you ever considered that perhaps the beauty of sport is actually above your comprehension level, not below it?

    That said ESPN is a pretty crappy channel.

  179. Yah, whatever. Kumbaya to you too. by Anonymous Coward · · Score: 0

    Paragraphs are your friend, you demented hippie.  Can you say "<P>"?

  180. Re:How many Slashdot articles said IQ score is bun by Hognoxious · · Score: 1
    What did Stanford-Benet do to warrant such worship?
    Firstly, knowing that only the "Binet" part refers to a person.

    And secondly, being able to spell "Binet".

    --
    Confucius say, "Find worm in apple - bad. Find half a worm - worse."
  181. Efficiency by Dire+Bonobo · · Score: 1
    > the "best" (i.e. most efficient) solution for society would be
    > to execute the unproductive members.

    Not necessarily. The fear created by such a policy could potentially lower the productivity of society by increasing the number of stress-related diseases, not to mention the damaging effects of societal unrest.

    Humans simply do not function as purely rational production machines, and any approach which does not take our humanity into account is likely to fail.

  182. Why would this be interesting, if it was true? by Anon.Pedant · · Score: 1

    This would be (and is) interesting because it is a specific result relating molecular mechanisms in the brain to observable and measurable mental characteristics. Do you really believe that the generalization that "any mental trait is determined by genetics and environment" is all we need to know about the genetics of brain function?

    Your dismissal of this result is like arguing that there is no point in studying any particular aspect of astronomy because we already know everything that's out there: matter and energy.

  183. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    He died two decades after Jensen's rebuttal. Nice try though.

    Gould's most important work was promoting Stephen Gould and little else.

  184. Re:minimum wage by DennisInDallas · · Score: 1

    we are sawing at the wrong end of the brach with minimum wage.

    You are correct that it's not that paying works at least this much is a burden to employers. But the minimum wage doesn't really drive the economy upward either.

    A maximum wage would...

    Yeah, when we have people that amass great wealth it does trickle down somewhat, but a single person and their dependents can only spend so much. If we could spread it around to more people it would circulate faster. And the rapidly spinning blades of consumption would lift the economy like one of those bell-textron whirly birds that LBJ used to sell to the military during his watch.

  185. An idea? by LadyShiva · · Score: 1

    Maybe this gene just controls how led by their personal bits a guy is? They said this gene doesn't seem to affect women....

  186. 7 types of intelligence by Anonymous Coward · · Score: 0

    Maybe this study isn't looking at all the aspects of intelligence. Current thinking (scroll down a little to see the chart) is that we have 6 or more dimensions of intelligence (Abstract, Social, Practical, Emotional, Aesthetic, Kinesthetic). Your classic geek is only intelligent along the first dimension and your classic IQ test only measures the first dimension.

  187. Was your reply in Vogon poetry? by Anonymous Coward · · Score: 0
    I think your comments are both uncalled for and highly immature. boobies. You should really consider growing up. sexual intercourse. People don't find this kind of humor funny, in the lease. vagina. I think you need the help of a professional. love-the-booty.

    I don't know what you responded to, and don't care, but I've got a Vogon poem for you too, that I just thought thorough with care...

    Hither wither pillow I see... roasting rump on edge of thee...
    Propped above the moon to be, bading to rent a dick from me.

    Mirror, mirror, on the wall; what doth thou Giver send to...uhm...ya'll?
    Is the crack a chip of trite, a gazing horror purged of fright.
    Hale inside the talmudic lair, of spiffy chocolate extraordinaire.
    great gaotse.cx, would thou return your company from Christmas Island full of breast?
    Sniffing your crustaceous island of the new, shimmering, sagging, dropping poo.
    Rise of your Christmas tomb, to uncease from serving hopeful unrest.
    1. Re:Was your reply in Vogon poetry? by DigitalReality · · Score: 1

      If I knew that was coming, I would have kept my mouth shut. wow.

  188. Enter Blonde joke here... by Anonymous Coward · · Score: 0
    Wow! I was waiting for fuel for another joke!

    this is wonderful.

  189. You should read the articles you link to. by mosb1000 · · Score: 1

    "IQ correlates highly with school performance but the correlations decrease the closer one gets to real-world outcomes, like with job performance, and still lower with income. It explains less than one sixth of the income variance [9]. Even for school grades, other factors explain most the variance."

  190. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    Jensen did not publish his rebuttal until Gould died. Can we say smear campaign? I think so.

  191. Huxley by Eli+Gottlieb · · Score: 1

    God damnit, is that horrible website the only one to have BNW online? Oy gevalt.

  192. Plenty by Archades54 · · Score: 1

    the ability to change a car tyre the ability to fuel the car the ability to drive that car the ability to put up with females... .....sorry rofl

    --
    If your neighbours roof is flying past your window, you know it's cyclone season.
    1. Re:Plenty by flamelord · · Score: 0

      But I guess intelligence is not one of them...

      I hope feminists don't become aware of this bit of information in the article. They might use it for the argument that men are on the average dumber than women. It's a lucky thing they're mechanically inept and clueless in other ways so they'll always need us.

  193. Whaddaya Wanna Bet... by eno2001 · · Score: 1

    ...there's an inverse relationship to this gene and how often these guys get laid? It pays to be stupid.

    --
    -"...bad old ideas look confusingly fresh when they are packaged as technology" - Jaron Lanier (Digital Maoism on Edge.o
  194. Re:IQ testing not science, has a history of bigotr by infoterror · · Score: 0

    Gould used quite a bit of bad science in his article. This article might help:

    http://www.wjh.harvard.edu/~cfc/Chabris1998a.html

  195. Few of your reports have numbers by Ogemaniac · · Score: 1

    but what I note is most of them do not talk about long-term effects. I agree that extra schooling temporarily affects IQ. Even in the most relevant case you cited, it was 1.8 points/year of school, and I doubt that much of this effect remained 10 years later.

    Do you have any numbers concerning the sibling effect over time? Saying that IQs become more equal is one thing. Are we talking about 2-3 points or 20? I bet is is much closer to the former.

  196. Yeah by Chmcginn · · Score: 1
    you might as well do the opposite and force them to breed.

    That's a great idea, if you want to get some more footage for "America's Worst Parenting Skills".

    The best genes in the universe won't make up for parents who don't want you.

    --
    Have you been touched by his noodly appendage?
    1. Re:Yeah by mrchaotica · · Score: 1

      What's your point? It's not as if we aren't talking about something that's a bad idea to begin with!

      --

      "[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz

  197. Re:IQ testing not science, has a history of bigotr by Zoyd · · Score: 1

    Anonymous Coward wrote: Jensen did not publish his rebuttal until Gould died. Can we say smear campaign? I think so.

    Jensen's review of Gould's "The Mismeasure of Man" was published in Contemporary Education Review in Summer 1982.
    http://www.debunker.com/texts/jensen.html

    Gould died in 2002.
    http://en.wikipedia.org/wiki/Stephen_Jay_Gould

    Gould had 20 years to respond to Jensen and never did.

  198. When did that get added in? by Chmcginn · · Score: 1
    Unfortunately, you can't discriminate against people based upon their intelligence.

    Umm... Yeah, you're just wrong on this one. That's all I've got to say.

    --
    Have you been touched by his noodly appendage?
  199. types of intelligence by PMuse · · Score: 1

    Do we really need the fancy labels (Abstract, Social, Practical, Emotional, Aesthetic, and Kinesthetic Intelligence)? One can call these things "6 dimensions of intelligence" if one wants to, but why is such labeling better than taking the position that there are other traits/virtues that are worth having but that are not "intelligence"?

    Abstract Intelligence (AKA intelligence/smarts): Conceptual reasoning, manipulating verbal, mathematical & symbolic information.
    Social Intelligence (AKA people skills/charisma): Interacting successfully with others in various contexts.
    Practical Intelligence (AKA common sense): "Common sense" capabilities; the ability to solve problems & get things done.
    Emotional Intelligence (AKA self-awareness/self-control): Self-insight & the ability to regulate or manage one's reactions to experience.
    Aesthetic Intelligence (AKA artistic insight): Appreciation of form, design and relationships.
    Kinesthetic Intelligence (AKA athleticism): Whole-body competence, e.g. singing, dancing, flying an airplane.

    To put it another way, what insight does calling these traits "intelligence" give us?

    --
    "We reject as false the choice between our safety and our ideals." --The American President (20.1.2009)
  200. Re:IQ testing not science, has a history of bigotr by Anonymous Coward · · Score: 0

    Wikipedia is wrong. Gould died in 1991.

    The fact that there have been numerous inaccurate articles cited by people (and quickly covered up and erased, such as the recent one accusing a person of being behind the JFK assasination) removes any shred of credibility from the article.

    Seems like more neo-Nazi racist propaganda from eugenics movement who want to kill all people except the "superior" people.

  201. digging deeper by beefubermensch · · Score: 1

    It's a mystery what research this article is referring to.
    We'll have to watch for a paper.

    The only related paper I could find from Jirtle is

    http://ajp.amjpathol.org/cgi/content/full/162/1/32 1

    which just describes a method for making mice with IGF2R
    knocked out only in certain tissues (total knockout is
    fatal).

    A big name in behavioral genetics is Plomin. A nice
    overview of the heritability of g, along with preliminary
    results of a DNA-pooling study pointing to IGF2R is

    http://bjp.rcpsych.org/cgi/content/full/178/40/s41

    The first paper I could find pointing to IGF2R goes back
    to 1998

    http://tinyurl.com/8yavr?__ChorneyEtAl1998

    -Carl

  202. Re:IQ testing not science, has a history of bigotr by Zoyd · · Score: 1
    AC wrote: Wikipedia is wrong. Gould died in 1991.

    http://www.google.com/search?q=stephen+j+gould

    The Unofficial Stephen Jay Gould Archive. Unofficial SJG Archive ... tephen Jay Gould (1941-2002) was among the best known and widely read scientists of the ...
    www.stephenjaygould.org/

  203. Re:An idea? If you like ..... by chawly · · Score: 1

    But don't ladies also have "personal bits" ? The last time I looked/felt ....... I'm very sorry. I just had to. Maybe I'm getting laid too often, or not often enough ? There is a lack of balance here. I really am sorry that I got into this. I'll not do it again. Apologies to one and all - and also all and sundry. However, I don't care what Laurel and Hardy think about it .....

    --
    How many beans make five, anyhow ? ... Charles Walmsley
  204. Whiskey Tango Foxtrot by Crazy+Eight · · Score: 1

    Jesus man, did you even read the ancestors of your post before you took that tack?