Gene Found That May Affect IQ in Males
Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."
I need a new brain..warranty on mine expired.
Wigger gene identified...
Company looking for a web designer with the proper IQ gene to design a website compatible with firefox, some javascript knowledge also required.
It would be very interesting to see the effects of this gene across different populations. If it does not adversely affect Caucasian females, perhaps other populations are also immune to its effects (or are particularly susceptible to it).
Jesus saved me from my past. He can save you as well.
300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.
Women are like electronics: you don't know how damaged they are until you try to turn them on.
So, now where can I get a genetic evaluation for my girlfriend and I, so we know if we'd risk passing this gene on to our children? Or, alternatively, when will we be able to genetically engineer them not to have it?
"[Regarding the 'cloud,'] ownership was what made America different than Russia." -- Woz
Women have always told me that my brain is in my Jeans.
Seriously, Don't take anything I say seriously.
Ey WuNDer EEF MB eY HavE tEH GENE Whart du U gUyS tiNK?
Maybe they have actually found the male-dumbness gene?
Bullshit
According to TFA, this research has yet to be peer reviewed or reproduced. We may want to wait a bit before getting too excited.
"...didn't being marked at 20 approximately 20 points."
;)
Maybe I have that gene, 'cuz I can't figure out what you're trying to say there...
"People will pay big bucks for the luxury of ignorance."
These gentlemen do not have this gene. The results of this prove nothing. It's impossible to do a study like this without a scientific baseline, and due to the fact that IQ is not a standard, you have no such evidence.
Guys it's back to the drawing board.
The researchers apparently didn't find any instance of the gene among Slashdot editors.
The Bush administration claims to have found the gene among members of the cabinet, but when investigated, no traces were found.
The gene was first observed by in 1894.
IQ tests are too unreliable for identifying gene that contribute to intelligence. They are far from standardized for all people/genders and until then its really not possible to definitivly say just how any gene affects intelligence short of extremely major differences, such as those found in cases of genetic disorders. Even then, determining the exact gene (if it even is just one) is very difficult. If only we could agree on a perfect definition of intelligence first, then maybe we could come up with a better way to measure it.
Demented But Determined.
The great academian Steven Jay Gould wrote an awesome book that has put decades of modern IQ "research" to shame and highlights the hidden agendas and racism/sexism that is often involved.
From Amazon.com:
The Mismeasure of Man, Stephen Jay Gould's masterful demolition of the IQ industry, should be required reading. Gould's brilliant, funny, engaging prose dissects the motivations behind those who would judge intelligence, and hence worth, by cranial size, convolutions, or score on extremely narrow tests.
How did scientists decide that intelligence was unipolar and quantifiable, and why did the standard keep changing over time? Gould's answer is clear and simple: power maintains itself. European men of the 19th century, even before Darwin, saw themselves as the pinnacle of creation and sought to prove this assertion through hard measurement.
When one measure was found to place members of some "inferior" group such as women or Southeast Asians over the supposedly rightful champions, it would be discarded and replaced with a new, more comfortable measure. The 20th-century obsession with numbers led to the institutionalization of IQ testing and subsequent assignment to work (and rewards) commensurate with the score, shown by Gould to be not simply misguided--for surely intelligence is multifactorial--but also regressive, creating a feedback loop rewarding the rich and powerful.
The revised edition includes a scathing critique of Herrnstein and Murray's The Bell Curve, taking them to task for rehashing old arguments to exploit a new political wave of uncaring and belt tightening. It might not make you any smarter, but The Mismeasure of Man will certainly make you think.
...what?
I'll wait to see their statistics. Why did they study this gene? It seems likely, for example, that given any group of 300 people, one could find a gene variant correlated with higher (or lower) IQ *in those 300 people*. With 30,000 genes, the statistics could be quite delicate. Another subject not discussed, apparently, is that a gene could presumably affect rate of development or growth, rather than eventual intelligence (this may be much more plausible, for example). This would manifest itself in 10-year olds, but not, for example, in 30 year olds. Why did they study 10-year olds? It seems like this may be an obvious objection.
It's called the beer gene, I thought everyone knew about that one?
Better still, let's develop ways to artificially increase everyone's IQ!
So I don't have to run around trying to do complicated crap. Seriously, if I knew what my limits or capabilities are, I could work with 'em instead of doing things the wrong way. For example, maybe I wouldn't have bothered taking calculus and done something else instead.
welcome our new male overloards... Oh wait...
uhmmmm were the men that inherited this gene blond haired?
Support NYCountryLawyer RIAA vs People
If it's that simple, sign me up for a six-pack. Thanks!
Maybe they could put the gene into rat brains and teach them to fly planes.
Am I the retarded person here? Here is a direct quote from the article:
The researchers studied about 300 children with an average age of 10. The children, all Caucasian, came from six counties in the Cleveland area.
Now, if you can tell me how the hell you figure that the females were anything but Caucasian, I'd really appreciate it. Perhaps I'm just a dumbfuck with this specific gene and my 20 point IQ gap is causing me to misunderstand "The children, all Caucasian".
We've talked in the past about numerous genes that raise IQ (in the ashekenazim discussion, though these genes affect others), this allele lowers IQ.
In wartime... truth is so precious that she should always be attended by a bodyguard of lies. (Churchill)
Meh.
Who would have though the letters between "" would be filtered out when selecting html formatted?
Geeze. Obviously I need an IQ gene booster shot.
the whole concept of "IQ" is absurd.
even a cursory undertanding of human nature and modern psychology and personality models show that using one test to characterize everyone is highly reductive and not very useful.
The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20 approximately 20 points.
Well now we know who doesn't have the IQ gene...
https://www.eff.org/https-everywhere
"even a cursory undertanding of human nature and modern psychology and personality models show that using one test to characterize everyone is highly reductive and not very useful."
Obviously YOU don't have the gene.
Ok. Here goes nothing...
Who would have thought the letters between a "less than" and "greater than" sign would be filtered out when posting in both html formatting and txt formatting.
(Sees Preview Button)
Aw crap. I really need those genes enhanced. When's this stuff going to be ready anyways?
We all new that the the Penis effects IQ & now they have discovered a new gene????
More ammunition for my girlfriend to insult my intelligence.
Wel. I mus oviously ahve thes jean.
Nothing like an article about IQ to bring out the most non-sensicle and idiotic replies from suposedly smart/nerdy people.
CMDRTACO A STUPID ASSHOLE
Every space probe/Hubble/whatever "may tell us about the origins of life/the universe", but we've really got no closer to the answers. Even mars (now looking like a rover junkyard) "may have sub surface water".
C'mon scientists, stop hyping. Call us when you've got something real to show. Unfortunately I think the hyping is an inevitable part of trying to rake up funding. Headlines-->good PR-->funding.
Engineering is the art of compromise.
...would ever pull something like "We accept people who have the Intelligence gene only. All other entries are rejected."
That would suck.
The study went on to find that those individuals without this gene tend:
/.
- to be picked as moderators on slashdot...
- to vote straight party tickets
- to claim that "anal leakage" is an acceptable side-effect for food additives
- to buy advanced copies of the Dukes of Hazzard DVD
- to work on the MSIE team
- to post stupid bogus study result lists on
I might know what I'm talkin' about, but then again, this is Slashdot...
You seem to lack a feel for statistics. With surprisingly small samples, you can get pretty solid numbers.
The standard deviation for IQ is usually defined to be 15 or 16. (rarely, it may be 20)
The standard deviation of IQ is 15 or 16 in most scales. A difference of 1.25 standard deviations is not small.
However, without knowing the frequency of the gene in the tested population, it's impossible to know if the difference is statistically significant. If the group was 50% male and 50% had the gene, it almost certainly represents a real difference; if only 5% had the gene, that's only 7-8 guys, and the "difference" is pretty likely to be random chance.
It's also worth noting that the difference could be in developmental speed rather than in level---i.e., the guys with the gene could just take longer to develop, but be just as smart by age 25, or could be associated with some other factor that is merely correlated with intelligence (such as, say, alcoholism which can lead to poverty which can lead to a less intellectually-nurturing home life).
Basically, this article gives us a sound bite with almost no useful information---shoddy reporting.
Do you know what the bad ones who get "weeded out" under such a system do when they can't find a job? They steal your car and sell cocaine in order to get by.
Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do. Sure, they don't have the IQ to design bridges or perhaps even to work a cash register. Nevertheless, society as a whole is better off if there are opportunities available to those who cannot compete in the job market based on their (lack of) intelligence.
You can often employ several such people doing various tasks for the cost of one more police officer. It's better to keep them out of a life of crime than it is to "let nature take its course".
Cyric Zndovzny at your service.
Who would have though the letters between "" would be filtered out when selecting html formatted?
Anybody who can read and understand the notice "Use the Preview Button!", written immediately below the comment textarea, could have predicted it.
Yes some people definitely have, genetically, an intellectual advantage over others... but as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.
Let's say you're a genius, some child prodigy who's super at calculus or something.
Can you charm women and get laid?
Can you get along with strangers and keep a stable job?
Are you smart enough to stay out of trouble? Avoid fights, etc.
Are you smart enough to choose good friends?
Are you disciplined enough to manage our finances?
Are you street smart enough to protect your wealth from crooks?
Do you get regular exercise and stay in shape?
These are all things that are very important for a good quality of life, and you don't necessarily get 'em just because you are smrt.
Hey, give it some slack. It gives geeks something to brag about.
Would you kindly mod me +1 insightful?
So instead of trying to become a physicist, you could have tried become a plumber instead...
...and probably have made more money.
"All men are created equal, except for those guys."
Women have always told me that my brain is in my Jeans.
Why do you keep your brain shoved up your asshole?
Cyric Zndovzny at your service.
Did they control for the fact that in some communities, race (and hence frequency of certain alleles) is correlated to socioeconominc status (i.e. private education), which could help on an IQ test?
Does anyone have any information regarding who funded this research?
Cyric Zndovzny at your service.
Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.
Sure, the tests will never be perfect. That doesn't make them useless or irrelevant.
Unless you're an idiot-savant, splitting hairs about different types of intelligence isn't all that useful. Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.
BTW, 20 points could qualify as "extremely major differences".
here comes Gattaca
--Mike Perry, Seattle
Maybe you are missing the sense of humor gene too?
It's easier to fight for one's principles than to live up to them.
It's partially true. God gave man two heads, unfortunately he only gave us enough blood to use one at a time!
If your thinking with the little head, the big one is in standby.
Professional Politicians are not the solution, they ARE the problem.
Yeah, I guess when the whole story is full of crass and sophomoric humor, asking for even a remedial level of intelligent discussion is out of the question.
Speed dating males must be able to present genetic documentation on request, along with their bank balance.
It's just Lunch is now It's Just Lunch with Smart Guys.
"He's really cute, and really sweet! And just look at those genes!"
It's good to be old and off the market sometimes....
My wife is like Unix. Lots of commands. Lots of arguments.
Why would this be interesting, if it was true? Any trait is determined by some combination of (1) genetics, (2) prenatal environment, and (3) environment after birth. Studies of twins have already shown that genetics accounts for a very large percentage of the variance in IQ scores. On the other hand, there is no consensus about what IQ scores measure, except that they measure...the property possessed by people who do well on IQ scores. So we already knew there are genes that are important in determining it, but we don't know what "it" really is. What does this particular study (if correct) tell us that we didn't already know?
Find free books.
Seeing how "IQ" is a score related to how well a person does on a *specific* test created by humans, are they really saying that this gene relates to intelligence in general? I find it hard to believe that a gene would code for something as specific as an IQ test, or, for that matter, a Slashdot poll.
It is very interesting that this gene only seems to be expressed in males. I wonder what the result would be if they tested the effect of this gene in gay people? Would they score more like straight males (- 20 points) or females (no difference)?
If the gene doesn't affect gays, it might provide some explanation for why an apparently genetic trait that limits reproductive success (homosexuality) nevertheless seems to be present in a significant percentage of the population.
Mod me troll for this if you want, but it's a serious question.
Most probably the reason that that " females also can carry the variation, [and] it does not appear to affect their IQ" is that females carry two mostly different X chromosomes and therefor have a backup for any defective gene, while men have only one X chromosome plus some dumb little Y chromosome that encodes our dicks and little else.
If they knew what they were talking about they'd ask whether a women with TWO of this gene had a lower IQ just like a man with one.
Probably they do, but also, no doubt, they couldn't find a large enough population of women with two of this gene to know.
Assuming the results cited are correct, it would be interesting if the "IQ depressing" gene conveys some benefit that makes up for the loss of intelligence. A gene that depresses intelligence, without any trade-off, would be quickly eliminated by natural selection, so there would be no reason for it to be common in a population. It would be interesting to find out what the beneficial effects associated with the gene are.
It's a little technical, but here's a rundown for the biochemically inclined: M6P/IGF2R introduction.
Turns out it's a cancer suppressor, too- a growth suppressor all around. It was suppressed it in early (animal) clones, and so the fetuses/feti grew too big in the womb and aborted. At least, according to the guy who wrote that rundown.
It causes LOS, "Large Offspring Syndrome" when deactivated, because of stuff detailed in that article there. Unfortunately we can't say whether this form of the protein mentioned in the article is more or less active, because the article doesn't specify. Does anyone know?
Also, they should do a correlation between the same set of subjects, and see if it also shows correlation of body size. To check the use of IGF2R as a growth suppressor.
Somebody let me in on the gag. Is this some sort of virtual Masonic handshake or just the stupidity gene at work?
Who cares? Can't contribute to the topic at hand?
...find the gene that causes people to blame every lil' thing on genes?
I love humanity, it is people I hate
Let's not forget what we are testing for here. We're not saying that this gene makes people dumb. We're saying that boys with this gene score more poorly than boys without this gene. We're using a purely operational definition of intelligence (IQ score), and not making a value judgement.
This is interesting science, despite those who are spending their energy railing against IQ tests. IQ tests are terrible indicators of how "bright" someone is, but they are fairly consistent tests, in which people tend to get the same results over time, so they are measuring something with accuracy. And whatever that is, is hurt by this gene.
Is it attention? Does this gene make your balls itch, thus distracting you from standardized tests (also explaining why it only affects boys)? Perhaps, does it affect mathematico-spatial ability specifically, which boys tend to do better on than girls (very likely for social reasons), and thus the generally poor performance of girls in this part of the test accounts for the gender variation (a floor effect)?
Who knows. But a strong correlation between a gene and a standardized test score (especially a well established one like most IQ tests) in a not insignifigant sample (300 kids) is nothing to sneeze at - 20 points in a sample that large tends to indicate it's a real effect. Don't let the articles journalistic simplifications ("Gene makes boys dumb") throw you from seeing what that is.
What's there not to understand? At 20 years old the difference was 20 points. If that's not what he meant, I'm completely backwards in English.
I thought that IQ tests had a margin of error of about 20 points. Can anyone confirm or deny this?
Please read all instructions before beginning this test.
For this test you'll need:
If you did not bring the proper pencils or paper, please see the administrator. If you lack the proper genes, please turn this test over and place your head down upon the table. Your test will be administered later; when we have time for you. If you cannot read this sentence, stare blankly out into space until somebody comes by to escort you away.
He's not talking about the number of subjects compared to the apparent IQ delta. He's talking about the number of subjects compared to the number of candidate genes to effect such a change. The study could very well have selected for noise.
and those that didn't being marked at 20 approximately 20 points.
Clearly somethings missing.
This explains that Simpsons episode when Lisa was depressed because she thinks she will turn out to be a loser, but then it turned out only the male Simpsons were like Homer and all the females were doctors and scientists.
Liberals call everyone Nazis yet they are the closest thing to it.
between genes and other non-scientific measurements. We can't define intelligence, but we know how to measure it!
Maybe there's a gene that controls the length of your hand's lifeline! Then we can figure out how long you will live!
Why the hell would it suck? My observations have shown that smart people don't want to be immersed in stupidity, and stupid people want to ignore their stupidity by being with their kind. A simple genetic test to separate the two would be wonderful.
And even supposing it is replicated, that does not change the fact that it is also just a correlation.
-Ted
-=-=- Quantum physics - the dreams stuff are made of.
Over-use of alcohol. Those with the "bad" gene are prone to drinking too much, and killing off their brain cells with intoxicants. They also prefer NFL, George Bush, Slashdot, and C#. Emacs is their favourite text editor.
In women this gene has no affect, because the duplicate on the other X chromisone cancels the effect so none of them prefer any of the above things that are the result of a lower IQ.
-/Karma burning made up stuff.
Saskboy's blog is good. 9 out of 10 dentists agree.
People are treating this like there's a "smart gene". That's not at all the case. All they've done is identify a genetic defect which tends to lower the IQ of people who have this defect. They don't know the mechanism, and they still have a wide range, so it's probably one of many factors that is meaningless in isolation. Testing a particular living person for it wouldn't tell you anything useful about their intelligence.
P ages/I/Imprinting.html
So, what about potential people who do not yet have an intelligence that can be tested? Well, it turns out that IGF2R is a very, very special gene for other reasons. There are certain genes that are "imprinted" in sexual reproduction. You might wonder why, with all the mutations and screwups that nature seems to allow, we don't see female mammals occasionally giving birth to their own clones, from meiosis that doesn't go as planned. Well, inheriting two of the same chromosome is almost always fatal because of these imprinted genes. With imprinted genes, genes are expressed if and only if they come from one particular parent. IGF2 is expressed exclusively from the father. IGF2R is expressed exclusively from the mother. The upshot of this is that while you could use this to discriminate among egg donors, using it to discriminate among sperm donors would be useless. As the mechanism that causes the correllation is still unknown, and ova are in much shorter supply than sperm, people are unlikely to be terribly selective about it in ova. Given all the other things we can test for, it's unlikely people would make a sperm decision based on how smart the grandsons of their designer daughters would be. If we're assuming babies with pre-selected genetic makeup, the next generation could do the same, rendering the decision moot.
Read more: http://users.rcn.com/jkimball.ma.ultranet/Biology
There's no failure quite as dissatisfying as a complete and total solution to the wrong problem.
If your thinking with the little head, the big one is in standby.
You must be using your little head atm.
Marge, get me your address book, 4 beers, and my conversation hat.
...we've found something IQ tests actually correlate with.
All this time we've just been testing for a gene and we didn't know it, go figure.
My own take is that human variation within any population is way above what the genes can account for. If there was such a thing as 'good' or 'bad' genes, they might make it easier or more difficult to acquire certain skills, but no guarantees. The reason is that our human behavior is fundamentally related to our mental-model-building capacities, and there are only very weak linkages between our mental models and anything else, including the real world.
Freedom = (Meaningful - Coerced) Choice != (Speech | Beer^2), and sad sock puppets' bad mods avail them naught.
I know this has been mentioned a few times already, but I was just wondering, in the present internet culture, is it a good summary or a bad summary when you still have to RTFA to find out what the summary is talking about?
No, it's not the gene. We all know that males have a crayon stuck up their nostrils that make them 60 IQ points dumber! Hmmmmm...donuts...aaaggghhhhh...
I'll entertain my skepticism this time. Where can I find the published study? Why males and not females?
I think your comments are both uncalled for and highly immature. boobies. You should really consider growing up. sexual intercourse. People don't find this kind of humor funny, in the lease. vagina. I think you need the help of a professional. love-the-booty.
Sounds like someone got a low score....
You sound like the ugly woman who says that true beauty is "on the inside."
While I agree the genetics does have an impact on intellegence, the reason that simblings with vastly different IQs exist is because contrary to PC belief, very few parents actually treat all of their children the same. First children tend to be more restricted in what they are allowed to do, and last children tend to be more pampered and thus have to do less. Obviously this is not absolute, and you can make your own determination as to what these environmental effects have on children, but it is common.
The answer to the age old question of environment or genetics is an obvious "Yes".
Please do not say that IQ and IQ testing are meaningless, to justify your own low score.
It wouldn't "suck" as much as someone named Henry Goddard creating the IQ-standard and then saying we needed to stick all of the "feebleminded" people in their own segregated colonies... And he's the benchmark..
Wrong. You clearly don't know much more about genetics than the journalists do.
Males only have the Y chromosome in the 23rd pair (e.g. it's the 46th chromosome). This gene's location appears to be on the 6th chromosome, which would mean that both males and females will have an X.
Are scientists prepared to state that Nazi views of genetics and IQ were right, despite that their methods were quackery?
I think IQ tests are meaningless. I made a high score but I don't believe I am significantly smarter than everyone else. There is a characteristic trait between high IQ and socioeonomic status.
My parents are doctors and lawyers (mom and dad) and make well into the six figures. My parents took the effort to raise me up in a quality environment, put me through good private schools, and purchase test coaching sessions so that I would make a good SAT score to get into Cal Tech (I wanted to go to a state university with all my friends but my parents insisted on a "better" university).
Testing is nothing but a measure of how dedicated you are to your school work and how much you practiced for tests. Pure and simple.
Your bitter and sarcastic tone would suggest that you may be the one who scored low and want to pass on your failures to other people who dare question "scientific" dogma.
Actually, it sounds like someone who doesn't have a narrow unidimensional view of the distribution of patterned human behavior and events.
Unless the people carrying out the study took this into account, their results would not show differences in intelligence at all, but rather differences in the specific skill(s) that that IQ test emphasised.
This, very likely, would explain why they observed a group benefit - you would see a benefit to those groups whose culture emphasised those skills that the gene enhanced - individuals overall would have a random chance of doing so, so would not appear to show any benefit.
If we go with this theory, then my guess is that the skill(s) that benefit are culturally deemed masculine and that those females tested who ignored gender stereotypes would show an identical distribution of benefit as per the males.
This is the problem with studying things by statistical analysis. It is only valid if you have no unaccounted-for variables, and that is usually not the case. Such studies are often simplistic, don't dwell too much on the mechanisms, and don't conduct genuinely random tests (for whatever reason) on a statistically-significant sample of the population.
In a case like this, where you are dealing with multiple unknowns (the impact of regionalization of the test, cultural biases, gender biases, etc), you would have to be extraordinarily careful in the study - and would STILL need to perform an n-way analysis of variance to prove that none of the other unknowns were statistically significant. (And, because n-way AoV requires that much larger a sample to work, you'd need to scale up the study accordingly.)
Oh, to complicate things further, the brain's and the body's gender are determined by different mechanisms at different times, so you'd have to conduct further tests to see WHAT gender was significant. Since intelligence is in the brain and not the body, one would assume that the gender differentiation of the brain was more important than that of the body, so a trivial "male/female" analysis doesn't cut it.
If you REALLY want to get in-depth, you also need to look at the gender-determining chromosomes. You've the XX of the typical female, and the XY or YX of the typical male, but other combinations also exist - XYY and XYYY "supermales" and XXY "superfemales" are rare, but they are there. If we are to assume a link between biological gender and this discovered gene, then "supermales" and "superfemales" should show different results than regular males or females. If it is not a pure genetic relationship, then no such skewing will occur.
It's a small world and it smells funny; I'd buy another if it wasn't for the money; Take back what I paid (SoM)
Wow, there's a Homer gene. You mean we don't have to look for stray crayons anymore?!?!?
Jirtle says about twenty-five percent of Caucasians have the variant of the gene. The study used 300 children, all Caucasian. So if the study used equal numbers of girls and boys, and if selection for testing was independent of the presence of the variant, then I estimate a sample of
(37.5 +/- 5.3) boys with the variant gene, and
(112.5 +/- 5.3) boys without the variant,
where the errors are statistical and totally anticorrelated.
And same for the girls, of course.
The articles say he presented results at a November conference in Durham, NC. That would seem to match this conference. This abstract refers to the result briefly.
"God gave us a penis and a brain, but only enough blood to run one at a time."
~Robin Williams
Now I wonder if *I* have this gene :-)
Don't waste your vote! Vote for whoever you want, unless you live in a swing state it won't matter anyways
There's no effect with women because they already know eveything.
The individual variations in IQ that this gene caused when manipulated has an almost-perfect correspondence with derivations in penis size.
Upon further research, it will undoubtedly be concluded that this gene replaces the bearer's corpora cavernosa with a corpus callosum -- that is, the subject will actually have a brain in his dick instead of just trying to think with it.
Testosterone..
http://slashdot.su/
I've done two things that very few legislators in this country have... I've read the constitution, and I understand it.
Not that you haven't, but...
Take the third step: Believe in it, and you will have made yourself entirely unelectable.
Sad but true.
From the article The researchers studied about 300 children with an average age of 10.
Heck these kids weren't just stupid they were pretty much vegetables with that IQ. Of course I could give the writer the benefit of doubt and assume that the 10 was a typo of 100 but I prefer thinking that these were a group of kids who could barely figure out how to breath (at least on average).
... how is it that given the Standard IQ Tests that Pennsylvania public skoolz distributed during the 80s, my SISTER and I both scored THE SAME* ??
:P
It might be A gene, but I seriously doubt it's THE gene.
* Plus or minus the usual five point margin of error but we're talking an "average" score around a third again above the norm.
According to my SO intelligence is found only in that bit of chromosome that women have that men don't. I suppose you don't need to be all that bright to hit dinosaurs over the head with a club and make babies. We are proving the latter on a daily basis.
I used to have a better sig but it broke.
Jensen responded and Gould never responded in turn:
http://www.debunker.com/texts/jensen.html
No, the above comment is not informative. A sample of 300 for that kind of testing is huge. Many pharmaceutical studies for instance are done on less than 100 patients. And 20 IQ points is a huge differential, too. Again, drugs have been deemed efficacious with much less of a margin.
What's odd, though, is that 2 of the variant-guys had 160 IQs. While 2 of 40 is pretty noisy data, the chance of finding even one is about 1-in-30,000, making the odds of finding 2 in a group of 40 about 1 in a million (assuming random kids, of course). While it's rampant speculation on my part, I'm curious if that's a statistical anomaly or whether the variant group has a low mean but an unusual number of extremely high values.
It also means (again, assuming 40 variant boys) that those two kids personally accounted for almost 10% of the summed IQ in the group, meaning that if they are just a statistical anomaly, the group mean would be about 4 points lower than measured, increasing the difference between them and non-variant boys by 25%.
Hmm - with the standard distribution of intelligence in the population (same link), 25% of people have an IQ 10% or more below the population mean. If that's true for this group, they alone would account for 50% of 25% of 25% or 3% of the overall population with an IQ below ~74, but the given frequency for an IQ below 74 is only about 5% for the entire population, and about 2/5 are female (link), leaving only about 0% of the total population, or suggesting that non-variant males have IQ below 74 only a miniscule fraction of the time. Since 20-25% of mental retardation is due to some kind of damage (i.e., should be roughly equally distributed), that seems implausible. So it kinda seems likely that either (a) the difference between means isn't as large as this study suggests, or (b) the IQs of this group don't follow the normal distribution that overall IQs (and, with tweaks, most other human traits) follow.
Based on that, in my largely ignorant opinion, I suspect that any actual difference between the means is less than is suggested by this study. FWLTW.
rs_number|alleles|position (on chromosome 6)
rs8191692 C/T 160360652
rs2975115 C/G 160360684
rs2975116 C/G 160360687
rs8191704 A/G 160382749
rs11759563 C/T 160416104
rs8191746 C/T 160416109
rs8191753 A/G 160418673
rs8191754 C/G 160418735
rs8191758 A/G 160421034
rs8191763 C/T 160424152
rs1570070 A/G 160424389
rs13198308 C/T 160432052
rs8191776 A/C 160434644
rs6413489 A/G 160434696
rs894817 A/G 160434700
rs8191797 A/G 160437232
rs1050004 A/G 160437257
rs8191798 A/G 160437267
rs998075 C/T -160438689
rs6413491 A/G 160438720
rs8191808 C/G 160439921
rs8191809 A/G 160439953
rs8191810 A/G 160439956
rs8191819 A/G 160441967
rs8191820 C/T 160441987
rs8191840 C/T 160452138
rs8191842 C/T 160453003
rs8191843 A/G 160453053
rs8191844 C/G 160453340
rs2274850 C/G 160450541
rs2230043 A/C 160454948
rs8191859 A/G 160455901
rs8191860 A/G 160455961
rs2230048 A/T 160459759
rs8191869 A/G 160459815
rs8191881 C/T 160463358
rs8191886 A/G 160464245
rs2230044 A/G 160464245
rs629849 A/G 160464820
rs11552587 C/T -160465339
rs1050005 C/G 160465360
rs8191904 A/G 160471039
rs8191905 A/G 160471123
rs8191906 C/T 160471223
rs8191908 A/G 160471609
rs2230049 C/T 160471684
rs614754 C/G -160475610
rs1805075 A/G 160475618
rs8191933 C/T 160487883
rs3190229 C/T 160487892
rs1803989 C/T 160487892
rs8191955 C/T 160496427
rs8191956 C/T 160496750
rs8191957 C/T 160496859
rs8191958 A/G 160496868
rs8191959 A/G 160497049
rs8191960 -/ACAC 160497143
rs8191961 A/G 160497202
rs3832385 -/TTTG -160497316
rs8191962 -/ACAA 160497322
rs8191963 C/T 160497586
rs1050015 A/C 160497591
rs8191964 C/T 160497662
rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
rs8191966 A/G 160497672
rs14531 G/T 160497919
(Sorry about the formatting; the lameness filter forced me to make it look like that.)
Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.
The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:
Tissue-Specific Inactivation of Muri
Also, it is less important to test for the average. Much more can be achieved at higher intelligence levels. Finding out about the highest 10% IQ could be the economically important thing.
-- Imperial units must die --
"Roof!" called a creaking voice.
The liftman was a small simian creature, dressed in the black tunic of an Epsilon-Minus Semi-Moron.
"Roof!"
He flung open the gates. The warm glory of afternoon sunlight made him start and blink his eyes. "Oh, roof!" he repeated in a voice of rapture. He was as though suddenly and joyfully awakened from a dark annihilating stupor. "Roof!"
He smiled up with a kind of doggily expectant adoration into the faces of his passengers. Talking and laughing together, they stepped out into the light. The liftman looked after them.
"Roof?" he said once more, questioningly.
Then a bell rang, and from the ceiling of the lift a loud speaker began, very softly and yet very imperiously, to issue its commands. (Aldous Huxley: Brave New World)
All men are created equal, but those guys are more equal than the rest.
or
That gene good. No gene better!
I fail to see how it is absurd, IQ tests pretty accurately measure one type of intelligence. That's not reductive and in fact can be useful to some. High IQ people are often strong problem solvers, so it may help to know your IQ if you are curious about what type of job you might be good at (assuming you like all jobs equally). Similarly, if you can leg press 1,000 lbs., it doesn't mean that your whole body is strong, but that doesn't mean its not an accurate measure of your leg strength. And like IQ, that test says nothing about how successful in life you will be, but it is also far from useless.
I agree with h4rm0ny with a couple of things to add. At our point in civilization, the greatest societal good seems to be the greatest good for the greatest number, also known as utilitarianism. But I think the true criteria for "advanced" society is the degree to which it provides for all people. A society is only successful when the needs of everyone are met. Consider that 50,000 people are born every day and 40,000 people die from starvation on a global level. Is civilization "succeeding" because more people born then are dying because of a lack of food? I would say that as advanced as we humans claim to be that our claim to greatness is lacking if as many as 40,000 die from famine each day. Consider that native american tribes and the hunter-gatherer tribes before them had no "class" of people who were homeless, and only starved in the case that there was no food for anyone. Capitalism, does not seem to be the best system in place for meeting societies needs. Also consider a civilization of Indians (that is, in India) who existed 1,500 years ago and did not require police, advanced government, or a military to enforce rules. They lived in cities, farmed, and lived in peace until their lack of military means led to their being forced into slavery by their invadors, the Caucasions from the Caucaus mountains. This ancient civilization was just ahead of its time, it was not stupid, for those of you who will contend that it is. If society today resembled theirs, we would not behave because of the rule of law, we would do good unto our neighbors because we would understand it is in our best interests and the societal good to do so. Post-Newtonian logic argues that there seems to be an inter-relatedness or oneness to the world. That is, what we do to another, we do to ourselves. If we behave in a self-interested manner we see the obvious evil that arises because of it. This was the main point that both Buddha and Jesus shared: that selfishness and not loving another as you love yourself (in Jesus' case) was the cause of societal woes. Humanities main problems stem from its short-sighted approach to its needs in that we feel that once we have met the needs of our individual person, we are satisfied. If a new paradigm were established and societal good and its success were determined on the basis of the degree to which every person in said society is provided for, you would see a very different culture and economy than you see today. Instead of a GREATLY disproportionate distribution of goods that is say, 90% of the wealth being in the hands of the top 5%, you would see wealth be at LEAST more EQUALLY shared among all sectors of society, knowing that societal good is measured in its ability for all to be satisfied. Also, Rousseau's social theory in part bases itself on a theory that if we were all waiting to be born, and did not know whether we would be born rich or poor, we would, assuming that the rich would be, by far the minority, would rather have a roughly equal society where all are basically provided for. This would seem more logically than playing the "lottery" and merely hoping to be one of the few fabulously rich people in the world yet to be created. But as for the original point about intelligence, it seems that a society obsessed with production would value innovation and technology which would make intelligence important. However, I know plenty of intelligent people who have somehow missed the point of life and who also think things which are ridiculous becase they fail the wisdom check to make informed observations and form accurate opinions about the facts of life. And again, the featured article in this story says there is a great deal of variance among those who had the genes just as a group. That means that some who have the altered gene and have an IQ which is 20 pts less than it would be may, in some cases, be smarter than people who don't have the altered gene and therefor and 20 pts more than they otherwise would. If you think intelligence is key to living the good life,
Why play the gender card? We all judge on a case-by-case basis, don't we? Although, I've noticed that most of my male friends are eihter brilliant or dumb, whereas my female friends lie across a broad spectrum. No pun intended.
Cool! I want ten of those genes. How much did you say they cost? Do you sell them in the mall ?
There is plenty of ways that the gene can do that...
One is to reduce the effect of gene that make males think sex more and earlier in their life.
There is even small chance of just increasing activity in early age.
There are plenty of indirect and direct things that affect IQ tests, and a gene that just correlates with those result might just be one of those indirect things that just can be overcome.
Emacs is good operating system, but it has one flaw: Its text editor could be better.
Ahhh.... in the words of Homer:
"I am so smart. I am so smart. S-M-R-T! I mean S-M-A-R-T!"
Karma: NaN
IQ does not change significantly after age 7 or so. I wouldn't get my hopes up about things "leveling out". Your reasoning sounds here more like wishful thinking. Otherwise, good post.
This could explain a lot, though. It is known that males have a larger variability in IQ than females. A single gene (or small set of genes) that swings IQ by 20 points only in males would be consistent with this observation.
Never feel stoopud over the Dinner conversation. Solve Sudoku puzz in seconds.
Most best source on the Net.
100 Tablets £100
200 Tablets £125
300 Tablets £150
[% slash_sig_val.text %]
Chicks are for popping babies. No need for any more IQ than what's needed for that. The less IQ the better since if you had any brains, popping babies would be the last thing on your list of things you wanted to do. Find any guy and ask him if he'd want to pop a kid. You have got to be stupid to say "why yes, I would like to carry and pop a seven pound kid out of my body through a teeny-tiny hole".
Start with Googling for a definition of allele, to understand the concept.
If some gene-dependent trait is "positive" or not depends upon the environment. (See e.g. malaria resistance and red blood cells.)
In general, there are two things influencing wether a trait is on for males/females.
Karma: Excellent (My Karma? I wish...:-( )
I wonder if there was a strong correlation between the 10 year-olds that had the gene and membership on slashdot..
*nyuk nyuk*
Come on, you know that's funny...
"Testing is nothing but a measure of how dedicated you are to your school work and how much you practiced for tests. Pure and simple."
Even if that were true (it's not, since IQ tests are highly consistent), how does it make IQ tests meaningless? Sure, IQ tests, and SAT scores, are far from perfect, but they are also far from useless.
....Intelligence has far less practical use than you might think.
Some claim that genes don't have as much influence as we assume. See e.g. The Biology of Belief by Bruce Lipton, a cell biologist.
I think what they mean is that they have found a gene which 'indicates' a difference in IQ in males - not 'affects'. There is a BIG difference between correlation and causation. My fiance wishes me to add, "GET IT RIGHT."
A gene that makes men stupid but has no effect on women? Isn't that a Simpsons plot?
Under current law, it costs an employer a minimum of about $500/week (depending upon the state) to employ a person for 40 hours at minimum wage.
40 hours a week, $3 per hour makes $120 per week. I honestly can't see how your cognitive system can reconcile this with the $500/week minimum cost. Do you really believe that, in the US, wages taxes add up to more than 300%?
It would be nice to be sure of anything the way some people are of everything.
Hi,
IQ is irrevelent to intelligence or capable to do something "smart" etc.
My tests has shown that this gene isn't found in beer.
How do you arrive at that figure? $5.15/hr @40hrs= $206. The employers tab for social security taxes is 6.25% of that, so add $13. Do employers pay a matching portion of the medicare tax, too? If so, add another $2-3. Now we're at $222. Where does the other $275 come from? It can't be health care costs, since we're only talking about what the law requires. Unemployment insurance? Required payments into a workman's comp fund? Maybe you can elaborate?
bet its really really similar to the X gene...I know most geeks loose a lot of intelligence when there are too many of those nearby
we moved from los angeles to miami. cubans are flooding over the CA border now and migrating through the southern states to get to miami. they discovered its much MUCH easier to jump the border there than float across to miami. add 1 more country to the list of illegal immigrants. heh, and they think they can keep suitcase nukes out.
http://www.livejournal.com/users/cixel
It speaks volumes about human intelligence that, 100 years later, the most common reference to intelligence metrics is the Stanford-Benet score. What did Stanford-Benet do to warrant such worship?
/. forums ... and my Stanford-Benet test score went off the scale. Does that make me a super genius? No. It means while still a child I was able to answer a question at the superior adult level. That sounds like an outlier to me, not a trend. The item analysis of the Stanford-Benet is just not that accurate.)
Little, apparently. IQ has been marketed admirably well over the decades, but that is not the fault of psychologists. IQ score appeals directly to the ego of certain individuals and, therefore, reference to it is remarkably effective as a marketing ploy. (Sorry people.) It pays Madison Avenue to play up IQ as much as possible. Many slashdotters go ga-ga over it.
(For the record, this is the first that I have commented on IQ in the
It goes without saying that this test needs to be repeated with a larger group. If there's a way to prevent a large population with distinctly sub-normal IQ's from gumming up the works on the job, in schools, the criminal justice system... we'd be far better off. Maybe all we need is a test like the one for the cystic fibrosis trait, to find people who shouldn't have children with each other.
Time is Nature's way of keeping everything from happening at once... the bitch.
Another good gene to have carried by the female: Male Pattern Baldness. On a male it looks distinguished.
Females have known for years that the Y chromosome affects IQ.
Yes, IQ tests generally match up our expectations and no, imperfections does not nullify the implications of their results. Yes, it is very likly that this gene does affect the IQ test results to some degree.
However, IQ tests are affected by other factors as well. All tests are affected to some degree by unforseen variables, but the IQ test is one in which those variables can have a very strong affect on the results. That is why I do not think that IQ tests should be used as evidence for saying certain genes affect intelligence short of cases in extreme difference (which I do not see 20 points as covering.)
I'll be the first to admit, my original post completly missed the point I was trying to get across. I should have made it more clear that I saw the lack of cultural/gender standard as an example of problematic factors in IQ tests rather than as an invalidation of this study's results.
Demented But Determined.
The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested. If they don't relate to ones actual ability to be a productive member of society, it's hard to argue that they're meaningful.
Got a reference handy? I may be reading this incorrectly, but Psychology Today published an article that appears to disagree with you.
"Weapons should be hardy rather than decorative" - Miyamoto Musashi
I think that goes for OS's too
The science community has gotten out of control. They have started to make wild claims before they have ANY understanding of what they are talking about. This is a pathetic attempt to raise money.
;)
The reality is that gene may be a characteristic of what makes REALLY someone smart or not. Or it may have nothing to do with it at all. They have no idea, they just decided to make a wild claim based on a semi-conclusive survey that would barely hold wait in a political campaign never mind a scientific study.
Let me give you an example;
I found the secret to genius. No muscle mass. Have you noticed the smartest people around don't have a great deal of muscle mass? I surveyed 10,000 people and on average my results are conclusive. Muscle rots the brain.
Obviously that is not true. My study could have shown those results, but muscle certainly doesn't rot the brain. Anyways, I think it's clear that these guys don't contain the gene
...if crime were an economic issue.
It isn't. You're wrong. You'll figure this out someday. Nothing's going to convince you lefties today, but someday you'll admit I was right.
But I can make an educated guess that when you talk about efficiency, you're referring to productivity and GDP etc. Is that our whole aim as a species? To manufacture more and more goods? Because you need someone to sell them to and people buy to improve their lives. The greatest possible satisfaction for the largest possible number is the real goal of society in my book - and working in a frenzy to get by isn't it.
Economic growth does not necessarily mean making more stuff (using more resources etc). It often means doing the same stuff better and cheaper, using less resources and less time. In the end it could mean work less for me, spending more time with my family and still have all the stuff we have now, not more, not less.
How did scientists decide that intelligence was unipolar and quantifiable, and why did the standard keep changing over time? Gould's answer is clear and simple: power maintains itself. European men of the 19th century, even before Darwin, saw themselves as the pinnacle of creation and sought to prove this assertion through hard measurement.
Amazing how everything in the field of IQ tends to relate to major changing social events - sudden immigration booms and civil rights movements amongst Blacks too.
I think they misspelled "JEAN"... but then that wouldn't be anything new; I've known since high school that there were jeans out there that instantly made me 30 I.Q. points dumber.
Anyone got a sample of President Bush's DNA to submit for testing?
"Naked Chicks"
All Troll + "offtopic" mods are meta moderated as "Unfair", because you abused the system.
You are confusing intelligence, wisdom, and charisma. Go back and read the Player's Handbook.
This variation, he and his colleagues found, correlates with a lower IQ.
Even though they only tested Caucasians, might there not be some other causing factor?
Is there another common factor(s) shared between these individuals?
Why does it only affect males? I think the "norms" for the IQ test could be gender biased.
Interesting for debate, but nowhere near the threshold of declaring that this gene directly affect IQ. Scores were averaged for groups. You could have this gene and still have a higher than average IQ.
I only look human.
My mother is a halfling and my dad is an ogre, so that makes me an Ogreling
Do you suppose we could test the "most brilliant man" Harriett Miers ever met?
At a conference I'm just about to fly back from, one of the talks detailed how one metabolic mutation was carried by 10% of Caucasians, this fell to 4% in Chinese populations, and only 1% in Japanese.
Plenty of those genes. Just look at lactose intolerance. Those of western Eurasian descent can generally drink milk after weaning. The rest generally cannot. *wry grin* Unofrtunately, I'm one of the few of Eurasian descent who can't, although it's something that's developed as I get older and I produce enough lactase for about half a glass a milk at a meal, enough that I don't have to worry about checking for the presence of lactose in the ingredients of a meal.
This sig has absolutely no significance and serves only to take up screen space and waste the time of the reader.
Having a high IQ is like having alot of money: Everybody wants it, nobody knows what to do with it, and it doesn't coorelate with anything substancial like success or happiness.
For every Dr. Hibbert there's a Comic Book Guy.
"I am smart...much smarter then you...Hibbert"
I have a theory that men carrying this gene tend to reproduce more per generation than men without the gene, because IQ is correlated to income, and people with higher income have larger families.
:)
But it's just a theory. I'd like science to go and run some numbers to test it for me. Anyone looking for a grant?
"I have never let my schooling interfere with my education." - Mark Twain
Plenty of those genes. Just look at lactose intolerance. Those of western Eurasian descent can generally drink milk after weaning. The rest generally cannot. *wry grin* Unofrtunately, I'm one of the few of Eurasian descent who can't, although it's something that's developed as I get older and I produce enough lactase for about half a glass a milk at a meal, enough that I don't have to worry about checking for the presence of lactose in the ingredients of a meal.
*grumble* Messed up closing the EM tag, forgot a virgule.
This sig has absolutely no significance and serves only to take up screen space and waste the time of the reader.
This might confirm my theory of the dumbing down of the American male in relation to watching sports. You have to have a low IQ (not have this gene) in order to get any plesure out of sweaty men trying to put a little ball in a hoop, or a bunch of sweaty mean in protective gear falling on top of each other to stop another sweaty man from scoring.
I swear, ESPN will be THE downfall of American socity.
Your idea was the underlying premise behind one of C.M. Kornbluth's most famous short stories -- "The Marching Morons".
http://en.wikipedia.org/wiki/Cyril_M._Kornbluth "a satirical look at an overpopulated future, with a population consisting of a few geniuses and a huge number of stupid people, in which the few geniuses are working desperately to keep things running from behind the scenes."
"other kinds of smarts -- notably, common sense and street smarts -- are really more important."
Ah, the classic response from someone who is sensitive about their 100 WISC score, and is looking for an alternative way to measure their worth.
It all the same thing man, it's just that people apply intelligence differently.
How pathetic are you that you follow me from topic to topic and waste all your mod points at once modding me down?
Seriously, the grandparent was just pointing out where he found out his information, not making any connections at all. I think it is a good thing that someone on slashdot actually pointed out where they got their info for once. You don't see that much at all around here and it gets interpreted as a "thems damn wetbacks took our jerbs!" discussion.
When Argumentum ad Hominem falls short, try Argumentum ad Matrem
the gene only lowers intelligence. there are dozens of genetic abnormalities that cause impaired intellegence. this is nothing that new. when they find a gene that causes above average intellegence, now that would be a great thing
...against the premise that men and women are "wired" exactly the same. I wonder if this could explain some of the additional variation in male IQ compared to that of females? That is, if you believe Larry Summers.
People with different skills and talents will experience different challenges and benefits. News at 11!
Sure I'm paranoid, but am I paranoid enough?
What would be really interesting would be to compare IQ of:
A. Females vs Guys w/ IQ gene
B. Females vs Guys w/o IQ gene
Then we would know whether 1) the females already have the advantage from some other gene, and so aren't affected by having another instance of that effector, or 2) guys really are the only ones with an IQ gene (that we know about).
The gene that makes men smart is mutualy exclusive with the gene that makes men fall in love. Ergo, love makes you stupid.
The question, in natural selection is, can a gene reproduce? Even if a lower IQ really correllated to a lower level of intelligence (which there seems to be a lot of debate about - I'm no expert in the field, but I've read that it is more an indicator of your education and culture than your actual intelligence), it still doesn't seem to have any effect on reproduction - dumb guys have children all the time.
So, I contest your assertion that "A gene that depresses intelligence, without any trade-off, would be quickly eliminated by natural selection". Truth is, for a gene to be eliminated by natural selection, it has to have a highly negative impact on the host. Slightly negative impacts will not be detrimental enough to prevent propagation.
I am not convinced that IQ measurements are meaningful enough that a 20 point swing means all that much anyhow. There is a lot of controversy about what IQ really measures.
Currently hooked on AMP
Poverty does far more harm to children than lack of societally-approved DNA.
If you think about it, the rich are exposed to less evolutionary pressure than the poor. The "de-evolution" that the right wing worries about so much is far more likely to happen among the children of privilege than among the poor population, who are still subject to many types of sexual selection (poor people are uglier than those with expensive dental care) and predation (murder rates are higher in poor population) that have been completely prevented among the rich.
Still, the rich will always appear to be smart, due to remedial surgeries and education (braces and prep school anyone?) while the majority of the poor will appear to be less genetically fit (due to poor nutrition, less access to expensive medical care, greater exposure to pollution, in-utero drug exposure, etc., etc., etc.).
Hell, I don't even need to RTFM - I could have told them certain jeans reduce IQ in males. Those low rise hip-huggers are the biggest culprit, although the kind with strategic rips that allow little flashes of blue panties also have a noticable negative impact on male cognitive ability.
I'm just surprised the resultant decline in IQ was only 20 points.
The man who does not read good books has no advantage over the man who cannot read them. - Mark Twain
IQ tests were originally developed to detect children with learning disabilities, and they're still good for that, though in a more detailed form. I took the Wechsler Adult Intelligence Scale test in college to determine if I had a learning disability, and I found it to be fairly comprehensive for what it does. It doesn't reduce a person's thinking ability to a single number either, which is nice.
But I do agree in general. Using IQs as a general measure of a person's ability to think is pretty useless.
[insert witty quote here]
that makes people use Linux. We need to remove that from humans. Die Linsux Die!
Linux sucks. It is an underground OS that is completely unstandardized. Linux geeks, get the fuck over yourselves.
It might have alot to do with the fact that Gould is dead.
Thought of the same joke. Looks like the next thing these folks should investigate is the gene that determines whether someone has a sense of humor. I see from some of the other replies that its expression seems to not be especially prevalent on /. today.
Cheers,
Dave
They that can give up essential liberty to obtain a little temporary safety deserve neither safety nor liberty.
Ben
M6P/IGF2R has been considered to be an "IQ" related gene for a while, for example this claims: By comparing children with an IQ of 160 or higher to those with an average IQ of 100, it was shown that the M6P/IGF2R is strongly associated with general cognitive ability ("g").
> IQ is a quantification of variance within a population. It does not sum.
It does when you're finding its mean value. By definition, mean = sum/count.
I'm pretty sure that he said "wireless devices produce electromagnetic radiation ("signal"), for that reason they consume much power. This technique could enable another speed step of CPU's if it can be quickly adopted to industrial production process. if their claim about improvement of 10^4 - 10^5 is true, it will surely remove this kind of bottleneck for at least another decade!"
That's the problem.
That's the most retarded comment ever.
Tell me more about your childhood traumas of being bullied by jocks, why don't you?
Have you ever considered that perhaps the beauty of sport is actually above your comprehension level, not below it?
That said ESPN is a pretty crappy channel.
Paragraphs are your friend, you demented hippie. Can you say "<P>"?
And secondly, being able to spell "Binet".
Confucius say, "Find worm in apple - bad. Find half a worm - worse."
> to execute the unproductive members.
Not necessarily. The fear created by such a policy could potentially lower the productivity of society by increasing the number of stress-related diseases, not to mention the damaging effects of societal unrest.
Humans simply do not function as purely rational production machines, and any approach which does not take our humanity into account is likely to fail.
This would be (and is) interesting because it is a specific result relating molecular mechanisms in the brain to observable and measurable mental characteristics. Do you really believe that the generalization that "any mental trait is determined by genetics and environment" is all we need to know about the genetics of brain function?
Your dismissal of this result is like arguing that there is no point in studying any particular aspect of astronomy because we already know everything that's out there: matter and energy.
He died two decades after Jensen's rebuttal. Nice try though.
Gould's most important work was promoting Stephen Gould and little else.
we are sawing at the wrong end of the brach with minimum wage.
You are correct that it's not that paying works at least this much is a burden to employers. But the minimum wage doesn't really drive the economy upward either.
A maximum wage would...
Yeah, when we have people that amass great wealth it does trickle down somewhat, but a single person and their dependents can only spend so much. If we could spread it around to more people it would circulate faster. And the rapidly spinning blades of consumption would lift the economy like one of those bell-textron whirly birds that LBJ used to sell to the military during his watch.
Maybe this gene just controls how led by their personal bits a guy is? They said this gene doesn't seem to affect women....
Maybe this study isn't looking at all the aspects of intelligence. Current thinking (scroll down a little to see the chart) is that we have 6 or more dimensions of intelligence (Abstract, Social, Practical, Emotional, Aesthetic, Kinesthetic). Your classic geek is only intelligent along the first dimension and your classic IQ test only measures the first dimension.
I don't know what you responded to, and don't care, but I've got a Vogon poem for you too, that I just thought thorough with care...
Hither wither pillow I see... roasting rump on edge of thee...
Propped above the moon to be, bading to rent a dick from me.
Mirror, mirror, on the wall; what doth thou Giver send to...uhm...ya'll?
Is the crack a chip of trite, a gazing horror purged of fright.
Hale inside the talmudic lair, of spiffy chocolate extraordinaire.
great gaotse.cx, would thou return your company from Christmas Island full of breast?
Sniffing your crustaceous island of the new, shimmering, sagging, dropping poo.
Rise of your Christmas tomb, to uncease from serving hopeful unrest.
this is wonderful.
"IQ correlates highly with school performance but the correlations decrease the closer one gets to real-world outcomes, like with job performance, and still lower with income. It explains less than one sixth of the income variance [9]. Even for school grades, other factors explain most the variance."
Jensen did not publish his rebuttal until Gould died. Can we say smear campaign? I think so.
God damnit, is that horrible website the only one to have BNW online? Oy gevalt.
the ability to change a car tyre the ability to fuel the car the ability to drive that car the ability to put up with females... .....sorry rofl
If your neighbours roof is flying past your window, you know it's cyclone season.
...there's an inverse relationship to this gene and how often these guys get laid? It pays to be stupid.
-"...bad old ideas look confusingly fresh when they are packaged as technology" - Jaron Lanier (Digital Maoism on Edge.o
Gould used quite a bit of bad science in his article. This article might help:
http://www.wjh.harvard.edu/~cfc/Chabris1998a.html
exponentiation ezine
but what I note is most of them do not talk about long-term effects. I agree that extra schooling temporarily affects IQ. Even in the most relevant case you cited, it was 1.8 points/year of school, and I doubt that much of this effect remained 10 years later.
Do you have any numbers concerning the sibling effect over time? Saying that IQs become more equal is one thing. Are we talking about 2-3 points or 20? I bet is is much closer to the former.
That's a great idea, if you want to get some more footage for "America's Worst Parenting Skills".
The best genes in the universe won't make up for parents who don't want you.
Have you been touched by his noodly appendage?
Anonymous Coward wrote: Jensen did not publish his rebuttal until Gould died. Can we say smear campaign? I think so.
Jensen's review of Gould's "The Mismeasure of Man" was published in Contemporary Education Review in Summer 1982.
http://www.debunker.com/texts/jensen.html
Gould died in 2002.
http://en.wikipedia.org/wiki/Stephen_Jay_Gould
Gould had 20 years to respond to Jensen and never did.
Umm... Yeah, you're just wrong on this one. That's all I've got to say.
Have you been touched by his noodly appendage?
Do we really need the fancy labels (Abstract, Social, Practical, Emotional, Aesthetic, and Kinesthetic Intelligence)? One can call these things "6 dimensions of intelligence" if one wants to, but why is such labeling better than taking the position that there are other traits/virtues that are worth having but that are not "intelligence"?
Abstract Intelligence (AKA intelligence/smarts): Conceptual reasoning, manipulating verbal, mathematical & symbolic information.
Social Intelligence (AKA people skills/charisma): Interacting successfully with others in various contexts.
Practical Intelligence (AKA common sense): "Common sense" capabilities; the ability to solve problems & get things done.
Emotional Intelligence (AKA self-awareness/self-control): Self-insight & the ability to regulate or manage one's reactions to experience.
Aesthetic Intelligence (AKA artistic insight): Appreciation of form, design and relationships.
Kinesthetic Intelligence (AKA athleticism): Whole-body competence, e.g. singing, dancing, flying an airplane.
To put it another way, what insight does calling these traits "intelligence" give us?
"We reject as false the choice between our safety and our ideals." --The American President (20.1.2009)
Wikipedia is wrong. Gould died in 1991.
The fact that there have been numerous inaccurate articles cited by people (and quickly covered up and erased, such as the recent one accusing a person of being behind the JFK assasination) removes any shred of credibility from the article.
Seems like more neo-Nazi racist propaganda from eugenics movement who want to kill all people except the "superior" people.
It's a mystery what research this article is referring to.
2 1
1
We'll have to watch for a paper.
The only related paper I could find from Jirtle is
http://ajp.amjpathol.org/cgi/content/full/162/1/3
which just describes a method for making mice with IGF2R
knocked out only in certain tissues (total knockout is
fatal).
A big name in behavioral genetics is Plomin. A nice
overview of the heritability of g, along with preliminary
results of a DNA-pooling study pointing to IGF2R is
http://bjp.rcpsych.org/cgi/content/full/178/40/s4
The first paper I could find pointing to IGF2R goes back
to 1998
http://tinyurl.com/8yavr?__ChorneyEtAl1998
-Carl
http://www.google.com/search?q=stephen+j+gould
But don't ladies also have "personal bits" ? The last time I looked/felt ....... I'm very sorry. I just had to. Maybe I'm getting laid too often, or not often enough ? There is a lack of balance here. I really am sorry that I got into this. I'll not do it again. Apologies to one and all - and also all and sundry. However, I don't care what Laurel and Hardy think about it .....
How many beans make five, anyhow ?
Jesus man, did you even read the ancestors of your post before you took that tack?