Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
Why do one chromosone have more genes than others?
"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
-- Academician Prokhor Zakharov,
"Address to the Faculty"
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practical medical impact in daily life. Screen cancer samples for chromosomal abnormalities and mutations has led to the development of rational therapy for specific cancer types. Where everything is leading is rational therapy overall. Individualized medicine and preventative medicine are the goals. I do agree with you that there are dangers associated with such knowledge. The question is whether we can use it to benefit the everyday man or woman to improve the quality of life for everyone.
Why do one chromosone have more genes than others
Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!
The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
They two traits were related somehow, even though you wouldn't think it.
Which is more of a typical example of Science challenging our preconceptions than actual "oddity".
To make an analogy, if you came across a switchboard with 100 light bulbs and 100 switches, you'd probably assume each switch turned on a light. Then you'd be confused to discover that some switches turned on two lights, some lights needed several switches to be on, and some switches did nothing at all.
Of course, if you looked under the hood and saw how the thing was wired, you'd then find that there wasn't actually anything strange going on, just that your assumption of how the thing worked was oversimplified.
I think this oversimplification is one of the reasons some people have trouble understanding evolution. It's a bit hard to understand how things like heireditary genetic diseases could exist if you assume that it's a completely independent property (and indeed, most of them probably wouldn't exist if it was).
Another fun example of non-obvious traits in humans is that a single SNP (prevalent in East Asians) causes you to sweat less, but also causes you to have dry and crumbly earwax instead of the gooey, sticky stuff most people have.
You're just wrong about this. 20/10 means you can resolve something 20 feet away twice as well as the average person; similarly, 20/40 means you can resolve something 20 feet away half as well as the average person. But 20/10 does not mean your eye is misshapen or your sense of perspective is off. It simply means you have better distance vision than average. Now, you may also be "farsighted" -- i.e., have trouble resolving things close up -- but the two are basically independent of each other.
;)
20/20 isn't "perfect," BTW. Human vision is very good compared to that of most animals, but it's laughably bad compared to that of, e.g., birds of prey. I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime.
The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
Did anyone else find the number 3,141 interesting? Is that a coincidence, or is there a good reason?
Actually there are a few "numbers" that are "magic" in nature. Depending on the species.
10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
A spider would probably tell you 8 is more important, from legs to their web's segments.
But since this genome has meaning for us, I'd wager that our "magic" applies.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
Viral Gene Therapy
I don't know as much about this topic, so be forgiving. The idea with viral mediated gene therapy is that someone is missing a gene entirely or the copy they have is basically defunct. One way to fix it is to target the broken sequence and paste what you want into it. Like a word search and replace. Viruses that integrate into our genes are good at that. The problem is targeting. Most viruses that we can get to integrate do so RANDOMLY. Not a problem, you'll still be pasting a functional sequence into the DNA so they can at least make some of the protein. But what if you land it at a place far away from the uncharacterized control elements that say when to turn on and when turn off? Maybe the small amount of basal transcription will produce enough protein to correct the defect, maybe not. What if it lands in an area that is always very highly expressed? Overexpression of the gene product can be bad too. Then a third problem to look out for is what if this thing randomly integrates and hits the middle of a good gene, killing it. Then you've got a whole other problem entirely. For the sequence to go into the vector what you have to do is really going to be dependent on the sequence. If the gene is very small, maybe you want to put in exons, introns and everything else. Otherwise, if it is too big, maybe you take the introns out and put just the exons in (remember that the exons are cut out of RNA anyway and the exons are spliced together). Some are so big that even just the exons can't all go in. Dystrophin for example is mutated in Duchenne and Becker's Muscular Dystrophy. It would be great for gene therapy but it is *huge* and I mean huge compared to most genes. Maybe there you can only put part of the sequence in, so you try to guess what parts of the protein are the most functionally important. Gene therapy is something that has the potential to be very valuable. It just really hasn't had any success over a pretty big period of time that people have worked on it. One good example is Severe Combined Immune Deficiency (SCID). These are the people that have to live in a bubble because their immune system doesn't work. But if you reconstitute the mutated genes, they would be fine. There were some trials in France of Gene Therapy to fix the problem and in several people they did. Those individuals went from living in sterile conditions to basically a normal life. Then the side effects came in. Where the gene landed in a few of them basically gave some of the patients leukemia!!! So they