Slashdot Mirror
Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
Can we start the patent countdown clock?
The simple truth is that interstellar distances will not fit into the human imagination
- Douglas Adams
Now where's my +1 Talent in every base?
if God wouldn't have used LISP to encode the darn sequence in the first place
I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
Why do one chromosone have more genes than others?
"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
-- Academician Prokhor Zakharov,
"Address to the Faculty"
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
Scientists: All your base pair are belong to us!
Your single nucleotide polymorphisms are unique! Just like everyone else's.
ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
The grass is always greener on the other side of the light cone.
I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practical medical impact in daily life. Screen cancer samples for chromosomal abnormalities and mutations has led to the development of rational therapy for specific cancer types. Where everything is leading is rational therapy overall. Individualized medicine and preventative medicine are the goals. I do agree with you that there are dangers associated with such knowledge. The question is whether we can use it to benefit the everyday man or woman to improve the quality of life for everyone.
From the fine article:
"The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
There are other variations which make us unique.
Alternate alleles*
Indels (insertions/deletions)
Variable numbers of repeats.*
The genetic code uses 4 letters, but I'll use English for explaination.
A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
"The cat and the dog" vs "the cat and the big dog".
In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".
Quattuor res in hoc mundo sanctae sunt: libri, liberi, libertas et liberalitas.
So we can start compiling from source code now! We better get this covered under the GPL quickly.
Why do one chromosone have more genes than others
Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!
The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
pi * 1000 genes. Got to love those fun coincidences.
This is good news but not too useful until we can model protein shaping.
The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:
- all cancer - modelling protein shapes means instant cancer cures
- bird flu - again modelling proteins means instant antibodies to diseases
- the most toxic substance ever invented - it will also open up designer drugs
gtcatgcgatacgtaggcaaatcg2tgacggcagt
hmmm i guess its not as funny unless its binary
Just to add on to this
20/20 vision means that when you stand away from something at 20ft, what you see is what the normal person would see at 20ft.
20/40 is, well, if you stand 20ft away, you see what a normal person would see at 40ft
Same goes for 20/10.
How do they differentiate junk dna from genes?
I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?
What makes a gene a gene?
Half answer:
The beginning is very likely a non-coding region, since stuff near the ends can get damaged more readily. The chromosome itself probably does not exactly start with GAT, it probably has a few thousand bases worth of telomere, and this just happens the be the chunk that starts once they get past all that.
Everybody has different genes, but the difference between two indviduals over the total range is measured in decimal-points of a percent. Big chunks of it are exactly the same from person to person.
A dozen actual people please. It doesn't count if your just mixing chromosones from different people to claim you have a complete DNA decoded; there is no gaurantee that mix of dna would be viable. There ought to be a panel of scientists to select 12 people to have their DNA read that are willing to be studied for the rest of their lives. Six men and six women. At least some of which would be siblings. Only then can you actually decode DNA. You'll get 90% of the answers there.
You always go with a base line. Then you read other people and compare and contrast them. Then add in other species. And voila, the genetic black box of subroutines that evolution found most useful that are 99.99999% of the answer. After that your left with mutations and figuring out what, and how, the code sequences do what they do and finally programming new sequences to test theory.
In other words 30 years from now it will finally get interesting.
Comment removed based on user account deletion
It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.
So, if you really want to know, the answer is...
because.
The basic idea is this. Our cells need a program that tells them what to do. That's the genome. There are a total of 46 chromosomes consisting of two sets of 23 independent chromosomes (1 - 22 and X or Y). DNA makes up the chromsomes. It's just a chemical structure that stores information; the four chemicals that make up DNA are Adenine (A), Thymidine (T), Cytosine (C) and Guanine (G). Every DNA molecule is actually two pieces of DNA that pair together as A binding to T and C binding to G. Sequencing is a chemical reaction that will tell you what the sequences of these four nitrogenous bases are. For example you may end up getting a read of AGTATTACGTATGCATAGGTCCGATG from a sequencing reaction (usu you'll get about 500 - 700 bases in one reaction). This tells you the sequence of ONE of the TWO strands of the DNA molecule. BUT since they pair in a predictable way, you know the sequence of the opposite strand (A-T and C-G). Our genomes are composed of approximately 3.2 billion total As, Cs, Ts and Gs. The goal of the genome project was just to tell us what the sequence of those bases are. That's it. Finding genes and things of that nature are really things that come about from having the primary sequence to reference. If you want to find a mutation you have to know what the sequence is SUPPOSED to be and WHERE IT IS before you can say it is different. That's your quick answer: the genome project sought to determine (1) what the sequence of bases in human chromosomes where and (2) the physical position of these sequences within the chromosomes. They did some other interesting things to prepare for it along the way, but that is a separate matter.
Many genes make proteins, but not all. Genes are expressed into RNA. Ribosomal RNA genes don't make protein; instead they make RNA contribution to the ribosome.
I think what you're referring to is Serpentor, The Emperor, who was made *by* Cobra Commander from the DNA of the world's most evil people.
http://en.wikipedia.org/wiki/Serpentor
At that rate, it must be a group made entirely of male scientists.
All I have to do is open my mouth once & any female can sequence my genes instantly.
Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".
Wanna fight ? Bend over, stick your head up your ass, and fight for air.
Completing the sequence and actually putting it together are two entirely different affairs. Small sequences called ESTs (Expressed Sequence Tags) were obtained during this effort. The big task after that was to put everything together AND in order. Think of it as a massive puzzle. Even the genome has different "builds" depending on the level of completeness of this work.
A CC-licensed illustrated horror novel
When we say that "the gene for xxxx is located at yyyy
This means that we *do* know where the particular controlling sequence is located?
Viral gene therapy is a process that can locate the target gene somehow and replace the sequence there with a new sequence?
Does the sequence have to be broken, segmented, and re-built for viral gene therapy? Or is there a "merge" type of operation that "overlays" the new information?
I have read a great deal that in a hand-waving manner, describes viral gene therapy as the next great thing either directly, or by implication. Is that so? Anything else like that, in terms of technology, that is currently looking promising?
I've fallen off your lawn, and I can't get up.
Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.
You do realize that breeding like to like is genetic manipulation? That what you are essentially doing is reinforcing genes that express the desirous trait and eliminating genes that don't? Physical ability may have been bred in to certain people, as you suggest, and it may recede over time, but it's still a genetic trait.
Just because you're paranoid doesn't mean there isn't an invisible demon about to eat your face
Did anyone else find the number 3,141 interesting? Is that a coincidence, or is there a good reason?
I'd give smarts for insight any day.
Sometimes, I'd give intelligence for booze. Life'd be a lot easier and less painful.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.
Automated DNA sequencing software
Viral Gene Therapy
I don't know as much about this topic, so be forgiving. The idea with viral mediated gene therapy is that someone is missing a gene entirely or the copy they have is basically defunct. One way to fix it is to target the broken sequence and paste what you want into it. Like a word search and replace. Viruses that integrate into our genes are good at that. The problem is targeting. Most viruses that we can get to integrate do so RANDOMLY. Not a problem, you'll still be pasting a functional sequence into the DNA so they can at least make some of the protein. But what if you land it at a place far away from the uncharacterized control elements that say when to turn on and when turn off? Maybe the small amount of basal transcription will produce enough protein to correct the defect, maybe not. What if it lands in an area that is always very highly expressed? Overexpression of the gene product can be bad too. Then a third problem to look out for is what if this thing randomly integrates and hits the middle of a good gene, killing it. Then you've got a whole other problem entirely. For the sequence to go into the vector what you have to do is really going to be dependent on the sequence. If the gene is very small, maybe you want to put in exons, introns and everything else. Otherwise, if it is too big, maybe you take the introns out and put just the exons in (remember that the exons are cut out of RNA anyway and the exons are spliced together). Some are so big that even just the exons can't all go in. Dystrophin for example is mutated in Duchenne and Becker's Muscular Dystrophy. It would be great for gene therapy but it is *huge* and I mean huge compared to most genes. Maybe there you can only put part of the sequence in, so you try to guess what parts of the protein are the most functionally important. Gene therapy is something that has the potential to be very valuable. It just really hasn't had any success over a pretty big period of time that people have worked on it. One good example is Severe Combined Immune Deficiency (SCID). These are the people that have to live in a bubble because their immune system doesn't work. But if you reconstitute the mutated genes, they would be fine. There were some trials in France of Gene Therapy to fix the problem and in several people they did. Those individuals went from living in sterile conditions to basically a normal life. Then the side effects came in. Where the gene landed in a few of them basically gave some of the patients leukemia!!! So they
One point is that there's very little variation between individuals in terms of coding sequence - in this chromosome from the article there's only just over 1 base where there are known single base changes per gene. The most common type of variation is in the number of times repeated streaches of DNA are repeated, this generally (though not always) has no effect on an individual. The numbers of such repeats in the draft sequence are not meaningful in the published sequence.
Databases of variation in the human genome are maintained. The paper accompanying the release of the finished sequence does discuss variation - and notes that in some areas of chromosome people have different numbers of copies of a large region which includes genes.
Nature has made the Full text of the article announcing the completion of the chromosome one finished sequence available online. While this is good, it's still not the open publishing which ought be demanded by those spending public money on scientific endevours such as this.
UK Laptops