Slashdot Mirror
Human Genome Sequencing Completed
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here
liqbase
Why do one chromosone have more genes than others?
"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
-- Academician Prokhor Zakharov,
"Address to the Faculty"
The surprise isn't how often we make bad choices; the surprise is how seldom they defeat us.
I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practical medical impact in daily life. Screen cancer samples for chromosomal abnormalities and mutations has led to the development of rational therapy for specific cancer types. Where everything is leading is rational therapy overall. Individualized medicine and preventative medicine are the goals. I do agree with you that there are dangers associated with such knowledge. The question is whether we can use it to benefit the everyday man or woman to improve the quality of life for everyone.
Why do one chromosone have more genes than others
Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!
The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
They two traits were related somehow, even though you wouldn't think it.
Which is more of a typical example of Science challenging our preconceptions than actual "oddity".
To make an analogy, if you came across a switchboard with 100 light bulbs and 100 switches, you'd probably assume each switch turned on a light. Then you'd be confused to discover that some switches turned on two lights, some lights needed several switches to be on, and some switches did nothing at all.
Of course, if you looked under the hood and saw how the thing was wired, you'd then find that there wasn't actually anything strange going on, just that your assumption of how the thing worked was oversimplified.
I think this oversimplification is one of the reasons some people have trouble understanding evolution. It's a bit hard to understand how things like heireditary genetic diseases could exist if you assume that it's a completely independent property (and indeed, most of them probably wouldn't exist if it was).
Another fun example of non-obvious traits in humans is that a single SNP (prevalent in East Asians) causes you to sweat less, but also causes you to have dry and crumbly earwax instead of the gooey, sticky stuff most people have.
You're just wrong about this. 20/10 means you can resolve something 20 feet away twice as well as the average person; similarly, 20/40 means you can resolve something 20 feet away half as well as the average person. But 20/10 does not mean your eye is misshapen or your sense of perspective is off. It simply means you have better distance vision than average. Now, you may also be "farsighted" -- i.e., have trouble resolving things close up -- but the two are basically independent of each other.
;)
20/20 isn't "perfect," BTW. Human vision is very good compared to that of most animals, but it's laughably bad compared to that of, e.g., birds of prey. I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime.
The correlation between ignorance of statistics and using "correlation is not causation" as an argument is close to 1.
Actually there are a few "numbers" that are "magic" in nature. Depending on the species.
10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
A spider would probably tell you 8 is more important, from legs to their web's segments.
But since this genome has meaning for us, I'd wager that our "magic" applies.
We used to have a Bill of Rights. Now, with the rights gone, all we have left is the bill.
There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug