Mutant Algae to Fuel Cars of Tomorrow?
Hugh Pickens writes "Algae has long been known as a promising source of biodiesel. It's worth noting, though, that algae also produces a small amount of hydrogen during photosynthesis. The MIT Technology Review reports that researchers have created a mutant algae that makes better use of sunlight to increase the amount of hydrogen that the algae produce. Anastasios Melis and his team at the University of California have manipulated the genes that control the amount of chlorophyll in the algae's chloroplasts. Although the process is still at least five years from being used for hydrogen generation, Melis estimates that if 50% of the algae's photosynthesis could be directed toward hydrogen production, an acre could produce 40 kilograms of hydrogen per day. At the price of $2.80 a kilogram, hydrogen could compete with gasoline, since a kilogram of hydrogen is equivalent in energy to a gallon of gasoline."
Mutant Algae! Overlords! In soviet Russia! Profit! Help!
Task Mangler
If they can make this work I think it's great. The current U.S. consumption of oil is about 5.2 Million bb/d, and there is about 950 Million acres of farmland as of 2002. One barrel of crude equals about 42 gallons of gasoline according to this. So we can safely say that one acre is about a barrel of crude according TFA. I think that is very doable provided that it actually works. Much better solution than ethanol if you ask me, which has proven time and again that if we want to go with corn ethanol that there isn't enough farmland in the U.S. Now granted that 40kg is optimal so if we allow say 8 million acres for this I think we may even have a surplus of energy. That is the kind of idea I like to see.
"Some books contain the machinery required to create and sustain universes."-Tycho
Give me figures in terms of overall % efficiency - how many joules per m2 of sunlight area. How does that compare to solar cells, or other solar converters? How much water would be needed for the process? If so, would it need prime agricultural land, or could it be done in a desert region?
Whenever I have looked closely at Hydrogen/bio production, its a fraction of the efficiency of direct electric production - and/or requires unrealistic amounts of prime land..
"A nation that forgets its past is doomed to repeat it." - Churchill
Just wondering - can this new algae be used to power satellites, and other space crafts?
Do I require the c-sig package to have a signature?
Based on the amount of algae I see in the lakes where I live this could be useful. Assuming accelerated algae growth is caused by fertilizer runoff could this counteract some of the environmental damage we (collectively speaking) cause? If nothing else the polluters would feel they are contributing to the greater planetary good along with having a kick ass lawn.
At $2.8 per Kg, this would be one of the cheapest ways yet to extract hydrogen, but it still leaves the problem of containing it in a vehicle, the cost of building the fuel cell or engine you'd burn it in, and so on. The fact is that gasoline has an incredible energy density by volume, and in absolute terms, it's still very, very cheap.
Something I find rather more promising is the work described in an earlier MIT review article, where bacteria are being modified to make gasoline directly. Just like petroleum-based gasoline, except that it's carbon-neutral, and sulphur-free. We're talking gasoline from anything that E. coli can ferment.
-jcr
The only title of honor that a tyrant can grant is "Enemy of the State."
Is it to much to ask to get reference links with more credibility than wikipedia? I mean, come on, is it really that hard to find a credible source to reference? For pete's sake even wikipedia claims it should /not/ be sourced as a cite, only a starting point.
Once it's produced, how do you store it? I confess that I now (sort of) work for evil "big oil" but I do have some experience with the practicalities of storing and transporting hydrogen.
If "a kilogram of hydrogen is equivalent in energy to a gallon of gasoline" then, estimating about 400 million gallons of gas per day used by the US, we will need 10 million acres of algae farm. That is with the assumption that they obtain their optimal output, and no additional energy is expended for processing, transport, etc.
By contrast, an average nuclear power plant produces 1000 megawatts of energy. Also assuming optimum efficiency, we get (10^9 joules pers second * (60 * 60 *24) seconds per day / (237.1*10^3 joules to electrolyze 1 mole of hydrogen at 298K) * 1.01 grams/mole = 368,047 kilograms of hydrogen per day.
So... 10 nuclear plants, or 10 million acres of algae farm?
Let's not forget that your algae farm will stop photosynthesizing when it's cloudy out.
When things get complex, multiply by the complex conjugate.
It sort of pains me to see all these touted solutions to fuel and energy when we have perfectly valid (and economical ) solutions available. Use Nuclear to generate electricity and hydrogen, short to medium distance travel use batteries, long distance and aviation can use hydrogen or electricity. Heck, when you factor in service costs batteries are already starting to become competitive for cars, electric trains are well tested, and it has been demonstrated several times that powering jet engines on cryogenic hydrogen is perfectly feasible. Charging times and capacities for batteries are improving every year, and the infra structure for charging batteries ( i.e the electric grid ) is more or less there. The way I see it, it is only a question of time ( set mainly by how rapidly the oil price is going to rise ) before the majority of fossil fuel consumption is replaced with electric. Aviation is a bit tricky because using batteries will probably not be practical, but on the other hand airlines have predictable schedules, use all their fuel within a few hours, and use a much larger scale than personal cars, and this essentially removes the main problems with liquid hydrogen ( the heat flow through a large container is much easier to deal with since volume increases quicker than surface area as you scale things up ). Bio-fuels are generally a very bad idea as simply planting trees would soak up way more CO2 than the bio-fuels would save within a century. Also, if used in the form of combustion of ethanol they are not much cleaner than petroleum in terms of all non-CO2 pollutants. You still get soot particles and nitrates from the combustion ...
Let me introduce you to an advanced technology vehicle I've been researching for years. It runs on nothing but pure cellulose in form of grass and so is very environmentally friendly. I call it a "horse". It requires no fossil fuels and is surely the transportation of the future.
same question as the last time - be careful what you release into the wild.
You can't handle the truth.
Duke Nukem's comment was "what are these cars, some bottom-feeding scum-sucking algae eaters?"
...then the governments of the developed world will find ways to:
a. stifle it while there's still fossil fuels to be had (ie with prohibitive taxation)
b. stifle the technology which utilises it (by classifying it for military use)
c. bud off private concerns (or use existing military contractors) who then go on a patent grab for said technology, making an example of anyone who tried it (yes, you, Mr. Hobbyist!)
d. license favoured concerns to (under)develop and (under)utilise the technology until such time as the oil becomes economically nonviable.
As a side note, I already use photovoltaics and gel storage to power my custom bike (so, sue me, Shell!). While it doesn't go 0-60 at the speed of thought, it does carry me and my laptop at a nice pace (20-40 depending on conditions). No petrol consumption at all there, and I get about two hours off of a cold charge with the panel off.
Operation Guillotine is in effect.
Corn was never meant to be the perpetual energy fuel feedstock. It is being done as a transition fuel feedstock while other technologies, like this algae for instance, or cellulosic ethanol from switchgrass, etc, develop. And it is because we are set up to produce corn (and soybeans) in mass quantities with no infrastructure changes right now today, this season, it's happening. Just like the vehicle changes, we are transitioning from straight gashogs to hybrids to eventually plug in hybrids and hydrogen fuel cells and straight electric drive, but that is still way down the road. This is the tech we have now, that's all, have to start someplace.
> Wikipedia, the concept that persistent opinions are accurate opinions
Persistent opinions ARE accurate opinions in many fields (to the best of human knowledge), and in other fields they're not.
The only strong "limitation" of Wikipedia's model is that it requires readers to understand which field falls into which category. If you wish to accuse Wikipedia of not being 100% useful to totally non-perceptive readers, then yes you're right, one would have to agree with you. It's only useful to totally non-perceptive readers when they happen to be reading pages of the first kind, not the second. But those who are perceptive know how much to trust both kinds of article.
The types of fields in which persistent opinions are accurate opinions are those ruled by verifiable fact, the rule of mathematics and logic, and cooperative progress through explicit reasoning, not through debate. That includes mathematics and logic themselves, plus all the hard sciences and branches of engineering. It excludes almost everything else, even many fields that try to employ logical discourse (eg. about 95% of philosophy is excluded). And even harsher than this, it also excludes personal opinion within the included fields: for example, it excludes personal interpretations in climatology and claimed predictions for the future, while including the very scientific fact finding and analysis in that field of science.
To those who understand the above, Wikipedia is an invaluable resource, because (apart from occasional human error and abuse, which are both rapidly corrected) the entries are all made cooperatively and all new progress builds upon past progress. Thus, the entries that persist represent the current peak of human understanding.
This contrasts markedly with the other kind of fields, in which personal opinion, claimed experience, authoritative position, and vocal statements matter. Yes, you can't trust anything that you read in those fields on Wikipedia, but that's not Wikipedia's problem. You can't trust what you read about those field on any other forum or means of communication either.
So, if you have a problem with trusting Wikipedia, it's either because you work in fields of the second kind (and hence you're part of the problem), or else because you fail to understand how human endeavour is split into those two very different categories and so you don't apply suitably varying degrees of trust.
It's your problem, not ours on the science and engineering side. Wikipedia serves us well.
"The question of whether machines can think is no more interesting than [] whether submarines can swim" - Dijkstra
This ceases to be true when biofuels become totally self sufficient. This means that fertiliser plants, the plants that manufacture everything used in the biofuel production cycle, storage etc., are all being entirely fuelled by their own product.
For this reason, for many years to come, biodiesel has to be the preferred route. This is because the huge installed base of plant can mostly run on it; you can do process heating with biodiesel as well as run generators, trucks and ships. You can, as it were, bootstrap the biodiesel economy, whereas you cannot bootstrap the ethanol or hydrogen economies. Steel plants and machine shops cannot run on either.
Hydrogen is attractive to the vehicle industry not because it is efficient but because it requires replacement of the entire vehicle fleet and would provide a boost to the industry. Biodiesel allows the existing fleet to be replaced much more slowly, with the same emissions benefits.
One of the simplest ways to reduce anthropogenic global warming is just to use less energy. One of the best ways to do that is to make consumer durables last longer, and make them out of readily recyclable materials. But that threatens the entire basis of the US-Chinese industrial complex, whereas hydrogen offers it greatly increased opportunities to expand.
Pining for the fjords
Can you get enough sun light and CO2 in your backyard?
Assuming you have 10 square meters yard, the sun shine's energy input is 1000W per square meter, you get 10 hours of sun shine per day, then you have 100,000Wh energy input. Assume 10% photosynthesis energy convert efficiency (this assumption is too high, 1%-5% is better but for the ease of calculation, I will use 10%), you will get 10,000Wh energy into hydrogen, that's 36MJ.
One kilogram of hydrogen has 143MJ of energy. Then to produce 1kg of hydrogen, you will need 40 sqare meters of yard, to produce 4 kg of hydrogen, you will need 160 square meters of yard, that's 1700 sqare feet. Remember we are assuming 1000W sun light input and 10% conversion here, both are too high.
I don't think we need to calculate the CO2 input now.
There is a spark in every single flame bait point.
Cool funny t-shirts for geeks, gamers and everyone else
That's without considering that the entire planet would be given over to growing grass. Unlike cars, horses consume a lot of fuel even when going nowhere. You have to be quite well off to be an Amish.
Pining for the fjords
I think its a great idea that people are trying to find new ways to power their cars, and heck if using hydrogen would work and it would be cheap, I'm all up for it. Seriously who right now is not angry with the amount of money we spend on gas. With $2.80 for the equivalent of a gallon, i think a lot of people would actually be happy The problem though would come with moving from gasoline powered cars to hydrogen. I believe that the oil industry would try as hard as possible to prevent it from happening, and how many car companies out there would actually take the risk of try a new technology which could quite possible not last. I think its a great idea, but it's still going to be a very long time before any new form of power replaces oil.
They're supposed to be one of the worst manure polluters around. Right now, the pig shit is just waste matter. If they could use this as feedstock for the algae ponds, suddenly it has a monetary value. This could be a good thing, environmentally speaking.
Kwisatz Haderach
Sell the spice to CHOAM
This Mahdi took Shaddam's Throne
Where else can you wake up on a Saturday morning and read an article about mutant algae fuels.
The higher the technology, the sharper that two-edged sword.
I'm sorry, I just don't buy into the whole "Hydrogen is Cool/The Answer/Better" story. It's simply not very convenient, if nothing else; high pressure is energy intensive and has some safety issues, cryo is energy intensive and opens up a whole other can of worms. IF you can get bio-diesel out of algae (or anything for that matter) I think it's a much better use of the little critters.
:)
Bio-diesel is carbon neutral, so it's as green as we can ask for; easy to transport and store (even uses the existing infrastructure) , relatively safe to handle, and requires virtually no new technology to implement. It's dense, to, which I think is worth noting- pressure tanks or cryo need more space, and that can be at a premium in a small vehicle. It doesn't have to obsolete *every* vehicle on the road. If I spill some in my driveway (or even my living room for that matter) it's just No Big Deal. If someone rear-ends you at a stoplight, ruptures your tank, and your bio-diesel runs out on the ground, again it's pretty much NBD. (Happens every day. Sometimes it ends badly, but even with gasoline it's rather rare to have a fire.)
The technology of fuel cells is cool, I'll give you that, but what good does it actually do me or the environment? I can't keep a can of hydrogen in my garage and fill my garden tractor with it!
Now, what I'd really like is a nice mid-size car, a diesel hybrid. Like maybe a Jetta, with a little help in the trunk from some of those spiffy new cells that A123 Systems makes. Just my preference. And I'd like a little smart-car sized electric for my local trips.
I think our easiest and most useful gains can be from hybrid (or pure electric) vehicles with the batteries that are finally becoming available now. Lead acid just wasn't there, NiCad wasn't quite there either; Ni-MH pretty much there for most use, and now these Lithium Ion cells seem to be there. Depending on where you set the bar for energy density, safety, etc., I think most would agree if it hasn't been passed we're *really* close.
And if nothing else, if our President is touting a Hydrogen economy, you know it's gotta be a farce!
Given 35kg of hydrogen per acre, and that
http://www.technologyreview.com/BizTech-R&D/wtr_16523,295,p1.html?a=f
says that a fuel cell car needs about 5kg per fill up of 350 miles, we're looking at roughly 1750 car miles per acre per day, or, about 640,000 miles per acre year, assuming that you can grow algae year round.
Assuming that the USA has 240 million drivers , driving on average, 11,000 miles per year (wikipedia), then, we're talking about a demand for about a little over 4 million acres of algae. So, this could actually work, and work a lot better than ethanol.
Even a 10% hydrogen conversion efficiency would require only 20 million acres of land, and that's considerably less than the several hundred million acres (more than the area of the USA, to grow enough corn to make ethanol with for fuel).
This is my sig.
Maybe it would be better to come up with a solar system that could be deployed in parking lots. I've thought about the Walmart roof scenario, too, but it seems like roofs are a problematic place for solar installations. Most roofs are somewhat fragile, and are not really designed to sustain much human activity, aside from repairing the roof. Flat roofs are particularly problematic in this sense. Furthermore, most roofs are not really designed to support much more weight than they already do (limited air conditioning equipment and expected maximum snow load). Roofs are also different in important structural ways, so even if these problems could be overcome for one building design, it wouldn't be reusable to other types of building roofs. So if you started with Walmart, you might not be able to easily equip all the Best Buy stores without a redesign.
Parking lots, on the other hand, are almost ideal places to install solar systems. You can bury stuff, suspend stuff in the air, re-arrange stuff. Even if it was a Walmart-only project, the parking lots are also larger than the roof.
In the It would be interesting to see an engineering class study this idea of rooftop or parking lot solar installations, in a coordinated approach like that used by Gerard O'Neill when his physics classes pondered space habitats and solar power satellites. There would be all manner of interesting possible side effects to study in such a project.
For example, there might be benefits unrelated to the power production. Suburban office buildings (which are generally surrounded by enormous parking lots) might generate enough power to meet their needs, which is an unlikely outcome for solar power rooftop installations. The installations would shade the cars, too, during the day when they tend to be in parking lots rather than in garages. This would extend the life of fragile car interior parts which degrade with UV exposure, possibly extending the life of the car. Proper design of these installations and large scale deployment might help reduce the heat island effect, although there are other ways to do this, such as pervious concrete and allocating more space for trees and shade in city designs, solar installations in parking lots could be easily retrofitted without restructuring the already-deployed land use allocation.
If you mod me down, I shall become more powerful than you could possibly imagine.
"Farm lads gone wild"
"Naked Farm lad algae wrestling"
"You're not the usual algae delivery boy"
The economic possibilities of farm lads are nothing to sneeze at.
ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
There's too many comments like that on Slashdot every time a disruptive technology is discussed. True, big companies have a large investment in the status quo, but it's stockholders that have invested and want a return on the dollar. Also, who's best to convert existing facilities into the new distribution centers for the new fuels? In my neck of the woods, there are damn few corners without a gas station on them already.
Where does the money come from to develop new technologies? Investors! They don't care who they invest with, so long as they believe they will get an equitable return on their investment. People want to make money, and if takes investing in HydroAlgeeCo Fuels (TM) or Exxon Mobil, they'll do it.
Just look at the Web as an example. Lots of guys come up w/ better ideas, and if the big guys can offer "good enough" for free (think IE vs. Netscape), people will take it. If not, someone either makes a bundle producing a better mousetrap or gets their technology bought up and incorporated into someone else's product (think FoxPro).
I know a lot of you think that investors in SCO were out to suppress Linux, but for the most part (MS and Sun deals excluded) it was about buying low and selling high. Same goes with big oil. If they see Hydro or Bio getting competitive, they'll get into the game. Heck, I'm suprised the Exxon Mobil hasn't tendered an offer for ADM yet!
HexaByte - he's a square and a half!
It's not clear from the summary, but I assume that this algae can still be used for biodiesel. Harvesting both might make the economics work out that much sooner.
That said, I don't know anything about algae for energy. I just know that I hate seeing the stuff when I'm on a lake (that isn't supposed to have algae).
I work on Chlamydomonas (single celled eukaryotic algae) biochemistry.
These little fellas are tough. Give them a few basic nutrients (phosphates, trace minerals) sunlight and air and they will grow like weeds. They can be autotrophic (using light) or heterotrophic if you give them a carbon source (like those found in sewage and agricultural waste). People have also had great success growing these by bubbling the exhaust from incinerators through liquid cultures (exhaust is rich in CO2 and NOx which Chlamy can use). Chlamy has been extensively studied (the genome of C. reinhardtii has been sequenced) and there is a huge library of mutants already available. I saw a presentation at an algae conference last year by people working on this. Holy grail is getting hydrogen while they are growing, then extract oil.
Best of all, they are completely harmless (trust me, if they were in any way dangerous I would be dead by now).
Algal biodiesel and butanol from agricultural waste are our best hope. Ethanol from food crops is basically a big give-away to agribusiness companies. While hydrogen is promising, biologically derived liquid hydrocarbons can take advantage of the extensive infrastructure that has been built for petroleum fuels.
AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
No it wouldn't, simply because the moment we switch to hydrogen as a primary fuel source the taxes(currently $.32 of every dollar in my state) will be leveed on the hydrogen. Thus making it just as expensive.
This article fails to outline some of the effects this might have on the environment, if any at all. Can this algae spread out of control and produce tons of hydrogen a day worldwide? From my understanding of algae I have seen once its on the move its not easy to cancel.
On the surface the use of algae-derived fuels sounds good, as does the use of sugar beet, corn etc. The trouble is that lots of things considered on their own in isolation from the "real world" sound good. But these are all "small is beautiful" types of fuels NOT the massive fuel supplies we currently use and increasingly use. Energy sources need to be based upon Fuels of Mass Transportation (FMT) rather than Fuels of Individual TRansportation (FIT). If the fuel demand is needs driven then how about we reduce the demand by reducing the needs? How? By designing cities and towns and villages that have good public transport systems, effective and efficient light/cooling/heating systems; that are designed with the individual person and family in mind but are planned from the outside in. (Remember that the way we build cities these days is the same as it was 3000 years ago, by accretion). Ideas and attitudes about mass production may need to change from assembly line to other forms, e.g. Volvo worker producing a whole car rather than just putting on the wheel nuts 8hrs a day. The same with Mercedes and their new Smart car. Check out Japan's methods where lots of production is done as cottage industry. We also need to forever keep in mind that massive volumes of fuel need massive areas of land - ours or theirs? Are more jungles denuded just so someone can drive a heavy fuel guzzler 4x4 around the 'burbs? How come Seaguways (?) haven't taken off yet? Could it be that folks don't fancy competing with a massive semi-trailer (you might call them prime movers) on the freeway? Maybe we need to use stem cells to raise critters whose waste can be dumped straight into the fuel tank?
Fossil fuels are the leftover oils from decaying plant and animal matter which hasn't been returned to the regular carbon cycle. To my knowledge, there is no geological process which can create even a single molecule of oil. There's a reason why Carbon chemistry is called the chemistry of life. So... when life first started on earth, there were no oil reserves or coal deposits, they all came from millions and millions of plants and animals dying and getting trapped under the earth. Kind of makes you feel small and insignificant to think how much effort created these fuels under the ground. I'm not saying it's a good thing to be changing the earth so much by putting all these carbon reserves back in the atmosphere, especially in such a small time frame, but it's worth remembering where the carbon originally came from.
...it will be killed by big oil before we're ever allowed to see it.
The only time the petroleum industry is going to allow hydrogen as a viable fuel source to exist is if a) oil becomes sufficiently rare that it causes societal collapse, and b) said industry can entirely control hydrogen production and continue to make the same kinds of usurious profits from it that they have customarily made from oil.
No reason to ditch it?
Then why did AMD go to sixteen registers in the 64 bit CPUs?
replacement for natural gas, for heating, and maybe for fueling generators?
or plug-in electric hybrid. If I could get one that I can transport the kids, wife and me, I'd buy it and put a solar cell on top of my house. Problem solved.
There exists no way of exchanging information without making judgments. --Bene Gesserit Axiom
Creating algae that crack water at a high rate seems like a bad idea. When they inevitably escape the "perfectly safe" industrial algae farm facility and become established in the general environment, the hydrogen and oxygen will be released into the atmosphere. Hydrogen tends to escape planetary bodies over time. Not exactly ice-nine but if you think human caused global warming is an issue, human caused global drying would be pretty annoying, too. On the bright side, it would probably take longer.
If you mod me down, I shall become more powerful than you could possibly imagine.