Slashdot Mirror


Mutant Algae to Fuel Cars of Tomorrow?

Hugh Pickens writes "Algae has long been known as a promising source of biodiesel. It's worth noting, though, that algae also produces a small amount of hydrogen during photosynthesis. The MIT Technology Review reports that researchers have created a mutant algae that makes better use of sunlight to increase the amount of hydrogen that the algae produce. Anastasios Melis and his team at the University of California have manipulated the genes that control the amount of chlorophyll in the algae's chloroplasts. Although the process is still at least five years from being used for hydrogen generation, Melis estimates that if 50% of the algae's photosynthesis could be directed toward hydrogen production, an acre could produce 40 kilograms of hydrogen per day. At the price of $2.80 a kilogram, hydrogen could compete with gasoline, since a kilogram of hydrogen is equivalent in energy to a gallon of gasoline."

142 of 158 comments (clear)

  1. What should I do! by Centurix · · Score: 1, Funny

    Mutant Algae! Overlords! In soviet Russia! Profit! Help!

    --
    Task Mangler
    1. Re:What should I do! by MattHarris · · Score: 1

      The planet covered in mutant algae - reminds me of something, a musical i think. But that was Red.

    2. Re:What should I do! by julesh · · Score: 1

      The planet covered in mutant algae - reminds me of something, a musical i think. But that was Red.

      You may be thinking of Jeff Wayne's Musical Version of The War of the Worlds, and specifically the section of it about the red weed.

    3. Re:What should I do! by PermanentMarker · · Score: 1

      Or the movie the blob..

      --
      I know you're out there. I can feel you now. I know that you're afraid. You're afraid of us. You're afraid of change.
  2. Feasible by chuckymonkey · · Score: 4, Informative

    If they can make this work I think it's great. The current U.S. consumption of oil is about 5.2 Million bb/d, and there is about 950 Million acres of farmland as of 2002. One barrel of crude equals about 42 gallons of gasoline according to this. So we can safely say that one acre is about a barrel of crude according TFA. I think that is very doable provided that it actually works. Much better solution than ethanol if you ask me, which has proven time and again that if we want to go with corn ethanol that there isn't enough farmland in the U.S. Now granted that 40kg is optimal so if we allow say 8 million acres for this I think we may even have a surplus of energy. That is the kind of idea I like to see.

    --
    "Some books contain the machinery required to create and sustain universes."-Tycho
    1. Re:Feasible by jcr · · Score: 4, Insightful

      Ethanol is a corporate welfare scam. The government knows it, ADM and Gargil know it, the DOE knows it, and the politicians are hoping that you and I don't. Generating fuel from algae or bacteria would be so much better on so many levels than fermenting corn, I really hope it comes to fruition.

      Just imagine the effect on world politics if nobody cared who had control of the petroleum in the middle east, because it was selling for $4/bbl.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    2. Re:Feasible by thanatos_x · · Score: 1, Insightful

      It's not a matter of how much farmland we have, it's oceans (or lakes, if it's a freshwater variety). If this works, it'd be a great boon to the environment - The algae removes C02 from the air, and creates H2, which unlike ethanol or other green fuels releases no CO2 back into the environment.

      Granted, there's an issue of oxygen removal from the water and disrupting the balance of an already stressed environment, but if it was done in largely dead ocean areas, this shouldn't be too much of a problem.

      Now if we can only find a fast breeding (but non-disruptive), good tasting fish who likes to eat algae... we'd solve 3 key problems - ocean depletion, CO2 emissions, and an energy source.

      --
      I am not an expert. If I am misled in something, please correct me.
    3. Re:Feasible by chuckymonkey · · Score: 1

      It doesn't so much remove CO2 as give us a way to sequestor carbon. Also I don't think O2 would be a problem either. Let's do some chemistry here. It reales H2, which comes from where? H2O, that's right it strips the oxygen off the hydrogen leaving 2 Hydrogen and 1 Oxygen. Also, the carbon that it removes is stored as carbon in the plant's structure. This carbon comes from both the air and the food that is uses. I don't think that putting it in dead areas of the ocean would do much for the energy situation though as the H2 would be rather difficult to harvest from something as vast as an ocean. Another thing to consider with that is you're introducing an unknown to the environment, what's to keep it from taking off and destroying large parts of the ocean? So yes, farmland is the best place, you can control the growth as well as harvest the benefits and bury the carbon if you so choose.

      --
      "Some books contain the machinery required to create and sustain universes."-Tycho
    4. Re:Feasible by thanatos_x · · Score: 2, Informative

      The end result is the carbon is removed from the air. It's exactly like trees and other plants, albeit as a likely single celled organism the resulting structure it's stored in isn't usually as useful.

      Also I may be wrong, but I believe you'd still run into oxygen depletion in the ocean, though not directly from the algae. An algal bloom http://en.wikipedia.org/wiki/Algal_bloom increases the amount of bacteria present to 'eat' the algae. These bacteria use the oxygen dissolved in the water, and eventually most animals can't survive in it.

      As to the possible problem of breeding an algae which takes over things - this species seems to me like it'd be less likely to survive in the wild, and even if equally as likely, it is probable that in order to cultivate the algae in sufficient quantities, it would have to be fertilized, limiting it's excessive spread to the areas fertilized/naturally containing a large abundance of such nutrients.

      It likely would be difficult to harvest the byproduct of multiple millions of acres of algae on the ocean, but I don't see it being significantly easier farming it. Perhaps the easiest solution would be to flood an area near the ocean (or a continental shelf), but these tend to be areas valued by man and inhabited by diverse wildlife where man hasn't chased it away. Regardless you'd need large quantities of water and of land, and they tend to be somewhat exclusive of each other. The great plains aquifers are estimated to run dry as early as 2050, and these are the prime reason why farming the great plains is as productive as it is. I don't know, perhaps I'm missing an obvious solution?

      --
      I am not an expert. If I am misled in something, please correct me.
    5. Re:Feasible by DDLKermit007 · · Score: 3, Informative

      Don't count on this getting too far. Corn producers have their heels into politicians pretty good on the matter, and Hydrogen has this problem of being very hard to contain with a problem of brittling most metals used to contain it outside of titanium.

    6. Re:Feasible by SatanicPuppy · · Score: 4, Insightful

      It produces nearly enough hydrogen per acre to make "backyard" hydrogen farms feasible.

      Instead of thinking entirely in terms of big honking swaths of farmland covered in algae, think of 5 or 6 vertical tanks in every backyard, producing ~4kg of hydrogen a day. That would cover automotive energy needs for the average person, probably with some left over.

      Also, while farming this stuff right in the ocean wouldn't make much sense, floating farms would be practical, and a good use of space.

      I'm a big fan of the idea of using the kind of space that we already waste for energy production (e.g the tops of every wal-mart in america covered in solar cells). Even a land efficient method like this one could benefit from using parts of land that we already use for another, non-conflicting, purpose.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    7. Re:Feasible by chuckymonkey · · Score: 1

      Oh trust me, I don't have much faith in the system. I do realize that it's probably a pipe dream, I'm just saying that it could be possible and that this kind of thinking is definately a good thing. Storage is a problem, but I don't think that it's insurmountable.

      --
      "Some books contain the machinery required to create and sustain universes."-Tycho
    8. Re:Feasible by chuckymonkey · · Score: 2, Insightful

      I like the way you think. Putting them in the backyard definately would solve most of the storage problem, and if I'm not mistaken (not sure about this breed) couldn't you feed the algae your housewaste including graywater?

      --
      "Some books contain the machinery required to create and sustain universes."-Tycho
    9. Re:Feasible by HangingChad · · Score: 2, Interesting

      There's another bonus with oil producing algae, it can grow in brackish water and eat sewage.

      What algae lacks is a powerful lobby in Washington like the corporate farms and corn sweetener have. It would also threaten a large volume of the petroleum supply chain. Since so much of our foreign policy seems centered around protecting Saudi Arabia's cash flow (when we're not arming Israel), I can't imagine our government getting behind algae production.

      Not like energy independence should be a national strategic priority or anything.

      It would mean we'd need to put more diesel vehicles on the road but who says we have to have a single source model? With the hydrogen bonus from the algae oil, a little ethanol to keep the farm lobby happy, and oil producing algae we could certainly retire a few of those super tankers in the oil pipeline.

      With the right financial incentives and treating it like a strategic priority we could have large scale production online in five years. We could potentially be getting the majority of our transportation fuel from algae in ten years if we really committed to it. I don't mean a Bush commitment, I mean a Kennedy man-on-the-moon commitment.

      --
      That's our life, the big wheel of shit. - The Fat Man, Blue Tango Salvage
    10. Re:Feasible by gluechucker · · Score: 1

      How about stacking? I don't know much about algae, but I can't imagine it needing anything too terribly deep. Could one-foot deep water do the job? A three-story, one-acre building isn't all that big, but could hold about 30 acres of this stuff. Then, being inside it would make collection simpler.

    11. Re:Feasible by Bert64 · · Score: 1

      You still need to get the sunlight through to the algae... so for the lower layers you'd need a complex system of mirrors to direct sunlight down there.

      --
      http://spamdecoy.net - free throwaway anonymous email - avoid spam!
    12. Re:Feasible by thanatos_x · · Score: 1

      Depends exactly what chemicals you use in your sinks/laundry. Standard soaps would probably be alright in limited quantities, but i'd be very cautious about bleach or drain cleaners, etc.

      The algae might actually thrive from blackwater - Urine is the primary method for removing nitrogen from the body, and feces generally contain nutrients necessary for plants. Considering that algae thrives from nitrogen and phosphorous...

      But in the end if you can find a sanitary way to do this, I could envision a method of reducing strain on sewer systems and generating energy. Granted I wouldn't want to ever have to work on repairing a system that contained algae and sewage, all steeping under the sun, day in and out.

      I suspect this wouldn't be an option for most people's back yards - certainly not in the more temperate/polar regions, where'd you'd have to worry about keeping snow off it, preventing it from freezing, etc. It may be well suited as something for integration into waste treatment centers though.

      All in all the prospects of such a system, if well designed and planned, could probably put a newly built city well on the way to being carbon negative and having an environmental footprint a quarter or less of what a similarly sized city would be (though it probably would take up somewhat more room).

      There are multiple interesting ideas and initiatives along this idea, including a green city going up in china http://www.wired.com/wired/archive/15.05/feat_popup.html , (scroll 3/4 down to hear actual plans for the city) Although I can't find it, there was also a 6 spoke fractal design for transportation, which started as a circle crossed by 6 equidistant spokes, each of which had a circle with 6 spokes, a design which continued for 1-3 iterations. I think for a city of 1 million, point-to-point rail transportation within one of the 6 primary circles was 5 minutes, and within the city as a whole 12 minutes. It didn't scale especially well if you added iteration -1, making the city capable of holding 6 times as many people, but it was still competitive with current systems I believe.

      --
      I am not an expert. If I am misled in something, please correct me.
    13. Re:Feasible by famebait · · Score: 1

      It's not a matter of how much farmland we have, it's oceans

      It's neither.
      For there to be any point you need to capture the generated hydrogen, so the soup needs to be enclosed; you can't just throw the little buggers into the ocean.

      Sure, you could make offshore h2 plants of this kind, but it's a lot of extra running costs, and the only benefit would be free 'land' to keep it on. The first decades of viable plants like this would be on land. But not farmland. It doesn't use the soil, so why pay for it. The best places would be desert, barren mountain, and rooftops. The latter has convenient infrastructure in place, and includes new roofs where none has been required before, like over parking lots.

      --
      sudo ergo sum
    14. Re:Feasible by famebait · · Score: 1

      Instead of thinking entirely in terms of big honking swaths of farmland covered in algae,

      Will people stop saying "farmlad" all the time? Yes, conventinal biofuels require farmland, and that is aming its greatest weknesses, but this here is a green soup that bubbles out hydrogen if you give it sunlight. It doesn't need soil at all, but it does need large areas. It would make no sense to place such a facility on valuable farmland.

      --
      sudo ergo sum
    15. Re:Feasible by famebait · · Score: 1

      Will people stop saying "farmlad" all the time?

      Or "farmland", for that matter. While I appreciate that some may see the aesthetic qualities of dumping great big bio-hydrogen production plants on top of farmlads, I doubt if it would make any economic sense in the long term.

      --
      sudo ergo sum
    16. Re:Feasible by Xonstantine · · Score: 2, Informative

      Uh, we functionally already have yeast that eat waste cellulose and excrete ethanol. The problem is, the cellulose has to be emersed in water, ethanol is a waste product that eventually poisons the yeast at a fairly low concentration, and you have to distill the solution to extract the alcohol...and distillation is energy intensive.

    17. Re:Feasible by famebait · · Score: 1

      Well, the good news is you only need money for the research. Once a suitable strain of algae (or whatever we plant the capability into) is there, the horizon for profit should draw near enough for private enterprise to waltz all over corn-ethanol i the marketplace in a matter of years.

      Not in cars first of course. Single factories and other businesses burning fuels today, seeing they can save money by switching to hydrogen, leading to a rudimentary backbone distribution network gradually built, then some die hard enthusiasts and insiders arranging side-outlets for smaller uses for hackers an idealists, then small buinesses seing savings, densening the distribution network, then some asian company lauching hydrogen cars _and_ consumer "gas"(literally) stations at the same time, killing the American automobile yet again.

      --
      sudo ergo sum
    18. Re:Feasible by budgenator · · Score: 1

      How are you going to collect the hydrogen for fuel? OOPs forgot about that didn't we.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    19. Re:Feasible by budgenator · · Score: 1

      Right now algae ponds are typically shallow, and the collection isn't complicated just inefficient. The biggest advantage of the mutant algae is it's "thin", it doesn't have as much chlorophyll as normal algae so the light penetrates deeper growing more algae. It doesn't make sense to me. I'd think that less chlorophyll would mean less photosynthesis, less hydrogen etc. but the guys with 3 letters after their names figure it'll work. The only thing that makes any sense to me is that by making the algae "thinner" and the productive zone of the "pond" deeper they'll get more hydrogen producing volume per a given surface area and that'll make it easier to collect the hydrogen for fuel.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    20. Re:Feasible by Hadlock · · Score: 1

      They've engineered yeast that with proper coaxing, will output 25% alcohol. But you have to oxygenate the wort (unfermented beer/wine) before hand, and then nurse it along under very specific temperature conditions (unknown to me).... oh yeah, and use a specially bred strain of yeast not avalible to the public.
       
      I'm sure that you use less energy to distill alcohol when your solution is 25% ethanol, vs. 3-8% (maybe even 15%?), but ultimately you're using (roughly) the same amount of food, but expending far more energy to coax the yeast to do the work for you.

      --
      moox. for a new generation.
    21. Re:Feasible by Hadlock · · Score: 1

      Feces also contain competing bacteria that inefficently produce methane!. Unless your majic H2 plant is powering a UV sterilizer, that bacteria is more than likely going to compete with whatever's in the waste you send it, decreasing efficency, and leading to you having to clean it out 2-3 times a week.

      --
      moox. for a new generation.
    22. Re:Feasible by CastrTroy · · Score: 1

      We'd even have good reason to switch back to detergents with phosphates. From what I remember they took the phosphates out because it was causing increased algae production, which killed off a lot of the other life in the lake. If we're just using the water to feed the algae, we might as well put phosphates in the soap.

      --

      Anthropic principle: We see the universe the way it is because if it were different we would not be here to see it.
    23. Re:Feasible by fredklein · · Score: 1

      Um, ethanol floats on water, so you can just siphon off the top layer.

      It is also possible, IF distillation is still needed, the SUN can provide the heat.

    24. Re:Feasible by fredklein · · Score: 1

      But you have to oxygenate the wort (unfermented beer/wine) before hand

      SO, bubble some air thru it. We have been aerating water in aquariums for decades.

      and then nurse it along under very specific temperature conditions

      So... a heater hooked up to a thermostat. Maybe a way to cool it, depending.

      and use a specially bred strain of yeast not avalible to the public

      So... it's have to be made available. Like I said, "I'm waiting for some smart company" to do something like that.

    25. Re:Feasible by DavidTC · · Score: 1

      Hell, while you're at it, run water pipes through the algae, and you've got solar-heated water. I don't know why that wouldn't work.

      The problem with hydrogen collection is that it tends to escape because it's so small. So, logically, the closer you move it to where you use it, the better. You can collect it on your roof and operate a power generator that burns it into water in your attic, if you're powering your house off it. (A bit more work to get it to your car, though.) As an added bonus, now you're got freshwater being created, which you can use as drinking water...and you don't even have to pump it anywhere, it's in your attic and will pour thanks to gravity.

      But I'm still not entirely convinced that hydrogen will play an important part of anything in the future. The second we invent a battery that's better, hydrogen is going away...it's too much work to contain it.

      If we power cars with hydrogen, the equation here is:
      if photocell-electrical conversion to hydrogen<algae

      Whereas if we power them using something else, the equation is:
      if photocell<algae-energy loss in burning

      Which doesn't mean we can't use it if we aren't powering cars with hydrogen, just that it might be better to use photocells at that point.

      Of course, as scientists have been trying to figure out how to do for decades, the thing to actually do is figure out how to take solar light and use it to turn carbon dioxide into carbon, like plants do. And then burn the carbon back into CO2.

      That's what they've got working with hydrogen, but if we could get it working with carbon, we'd not only find it easier to burn, we'd stop global warming dead. The CO2 we'd get by burning is 'free' cause we just pulled it out of the air in the first place, and we could set up a bunch of those things and not burn the resulting carbon to decrease CO2.

      --
      If corporations are people, aren't stockholders guilty of slavery?
    26. Re:Feasible by Xonstantine · · Score: 1

      Um, ethanol floats on water, so you can just siphon off the top layer. You might want to get a refund on any chemistry classes you took...because you were ripped off.
    27. Re:Feasible by jcr · · Score: 1

      ethanol floats on water

      Nope, it dissolves in water. It's lighter than water, and it will evaporate at a lower temperature than water will, but you can't just skim it off the top.

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    28. Re:Feasible by smellsofbikes · · Score: 1

      Tops of wal-marts and other buildings covered in algae ponds: produce the biodiesel where the fuel needs are, so you don't have to truck stuff in from the deserts of the Southwest, which would be the second most likely place to occupy chunks of land to minimize loss of farmland.

      --
      Nostalgia's not what it used to be.
    29. Re:Feasible by joeljkp · · Score: 1

      The latest issue of National Geographic has a good article on this (it's also online).

      If you look at the Energy Balance tab, I'll gladly take cellulosic ethanol over biodiesel any day.

      And any ethanol, regardless of production method, needs a retail path to be of any use. The market for corn-based ethanol we're developing now can be shifted over to cellulosic ethanol when the technology becomes feasible.

      --
      WeRelate.org - wiki-based genealogy
  3. Give me figures. by eniac42 · · Score: 1

    Give me figures in terms of overall % efficiency - how many joules per m2 of sunlight area. How does that compare to solar cells, or other solar converters? How much water would be needed for the process? If so, would it need prime agricultural land, or could it be done in a desert region?

    Whenever I have looked closely at Hydrogen/bio production, its a fraction of the efficiency of direct electric production - and/or requires unrealistic amounts of prime land..

    --
    "A nation that forgets its past is doomed to repeat it." - Churchill
    1. Re:Give me figures. by RsG · · Score: 1

      The trade-off, when comparing these sorts of solutions to direct energy generation, is that we don't need to manufacture algae. Get a few of these mutants made, let em breed, and harness the work. It isn't really that simple, of course, but the first step involved with manufactured solar generators - building the damn things in the first place - is skipped.

      Solar cells, or a combination of mirrors and sterling engines, will probably always beat out organisms for pure efficiency. Doesn't mean we don't also want the organisms. Particularly when the object of the exercise is hydrogen production, since water electrolysis isn't very efficient either. In practical economic terms, bioproduction of hydrogen (or other fuels) may make more sense than using generated electricity.

      You're right about the water and arable land though. If we start using those to make fuel, they'll be in short supply in no time. OTOH, I've seen proposals for algae produced biofuel that worked with saline water, and could be built in a desert - that would be ideal.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    2. Re:Give me figures. by jcr · · Score: 1

      I've seen proposals for algae produced biofuel that worked with saline water, and could be built in a desert - that would be ideal.

      So, the middle east could still be a major fuel-producing region, even when it's no longer worth the cost to pump petroleum out of the ground?

      -jcr

      --
      The only title of honor that a tyrant can grant is "Enemy of the State."
    3. Re:Give me figures. by RsG · · Score: 1

      Heh, you're joking, right?

      Why go all that distance? The US at least has no shortage of sunny desert, and coastal access to two oceans. Either land or sea based biofuel production would be feasible. And after Iraq, I think an increasing number of Americans will want energy independence. Why import fungible goods you can make cheaply and locally? Particularly if the countries exporting said goods are a long way from friendly?

      I think the only countries that would actually need fuel imports, if biofuel worked out, would be those lacking in either sufficient space or sunlight.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    4. Re:Give me figures. by Zouden · · Score: 2, Insightful

      Get a few of these mutants made, let em breed, and harness the work.

      A major reason why this won't ever be as economical as biodiesel production is that this requires mutant algae, as you said. This means the culture needs to be kept isolated from the outside world to keep it pure (the mutants have reduced fitness compared to wildtype algae).
      Biodiesel, on the other hand, is produced by wildtype algae that are capable of holding their own against competing organisms.
      If I had more time, I'd dig up photos of the respective bioreactor design. Hydrogen production requires sealed, sterile, glass containers, while biodiesel production simply requires an irrigated ditch.
      --
      "A week in the lab saves an hour in the library"
    5. Re:Give me figures. by famebait · · Score: 1

      how many joules per m2 of sunlight area

      You need a unit for time as well.

      But the article did have kilograms of hydrogen per acre per day. If we accept the assertion that 1kg of H2 is roughly equivalent to 1 gallon of gas (for automotive use), you are really only some very simple arithmetic away from a fair comparison with gas.

      As for water usage, the algae live _in_ the water, not on the ground, so the water will be enclosed, probably in transparent pipes or covered pools. There would be no evaporation, and ground conditions would be largely irrelevant. So farmland would be too valuable and not competitive. Water consumed form actual conversion to hydrogen would be a barely noticable expense, and absolutely tiny compared to agriculture.

      Comparison with other direct electric is fruitless, because this _isn't_ a technology for generatring electricity, it produces storable and transportable _fuel_. It will compete with stuff like refined gas/diesel, biodiesel, hydrogen electrolysed from solar electricity, or batteries charged with solar electricity.

      Yes, producing H2 this way in order to burn it for electricity would be dumb, just like using electricity to synthesize fuel would.

      Haven't done the math, but my guess is the inefficiency of solar cells coupled with the extra cost of conversion when you're not using the electricity directly, means it can be beat quite easily the second we get our hands on some reasonably efficient hydrogen-generating critters. But not before. Breeding them may take time, but maybe soon we will understand enough about photosynthesis to manipulate the circuitry in a directed way, and produce only enough sugar to keep the cell alive and make hydrogen from the rest.

      This reasearch has been going on for years, BTW.

      --
      sudo ergo sum
    6. Re:Give me figures. by RsG · · Score: 1

      Point. Still, regardless of what other hardware is needed to make the system work, you are using self-replicating "solar cells" of a sort. You are, in effect, getting one of your components made cheaply, and replaced constantly. So what it boils down to is whether a bioreactor that produces hydrogen from algae when is more economical than a solar array that produces hydrogen from electrolysis, given the same source of sunlight. This of course is assuming the object of the exercise is hydrogen production.

      I agree on the viability of simple biodiesel though. My only real caveat with it is the potential problems associated with dedicating farmland to fuel production. We don't lack for arable land or fresh water in this part of the world, and in this day and age, but if we start farming biodiesel on a meaningful scale, we will run into problems.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    7. Re:Give me figures. by RsG · · Score: 5, Insightful

      Why do people keep saying this? It's like they don't actually understand why fossil fuels contribute to the greenhouse effect.

      Look, carbon that's locked away underground in the form of fossil fuels isn't part of the carbon cycle. It's been sequestered by geological processes for millions of years, removing it from the air. When we dig it up and burn it, we bring it back into circulation. The total amount of airborne carbon increases; the greenhouse effect gets stronger. This is, in a nutshell, anthropic global warming.

      Carbon that's already in the atmosphere can be trapped by photosynthesis. If the plant that trapped the carbon is then burned, or eaten, or even if it just dies and rots, the carbon returns to the air. This is the regular carbon cycle, with or without human intervention, and it doesn't alter the net balance of Co2. It's this process that we employ when we make biodiesel.

      Biodiesel doesn't contribute to global warming. At all. The "bio" part means the hydrocarbons were synthesized from plant matter; the carbon in those hydrocarbons came from airborne Co2. As long as you plant biofuel crops, process them, and burn them, the total amount of airborne Co2 will never increase. Every ounce of carbon added to the air is matched by an ounce of carbon removed from the air by the fuel plantation.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    8. Re:Give me figures. by eniac42 · · Score: 1

      Solar cells, or a combination of mirrors and sterling engines, will probably always beat out organisms for pure efficiency. Doesn't mean we don't also want the organisms. Particularly when the object of the exercise is hydrogen production, since water electrolysis isn't very efficient either. In practical economic terms, bioproduction of hydrogen (or other fuels) may make more sense than using generated electricity.

      I think the crux there is whether you want Hydrogen or Bio-fuel at all. Improvements in Batteries are making straight-forward electric cars more and more feasable - just use the electricity from solar/wind/tidal (and for that matter nuclear) directly, bypass the large inefficiency involved in Hydrogen or Biomass generation/storage (most of the storage methods for Hydrogen cars are very poor - less than 2% Hydrogen for overall stored weight). For example, (from another thread) I calculated you needed about 100x100 miles of Nevada desert to generate the complete daytime US gridload (approx 1 TerraWatt). This scheme in Nevada:

      http://www.reuk.co.uk/Nevada-Solar-One.htm

      Delivers 64 Mw for 350 acres = 45 watts per sqr meter.
      100 x100 miles = 26 000 000 000 m2.
      x 45 (watts) = 1.17 TerraWatt supply.


      Cost? Figures vary, but Nevada Solar quote about $0.07/Kwh, wind and others maybe a little less. I wonder how algea would compare, in terms of cost, land/water used, and so on..
      --
      "A nation that forgets its past is doomed to repeat it." - Churchill
    9. Re:Give me figures. by eniac42 · · Score: 1

      Fair comment, since parent post was daft, but the situation is a bit more complex. First you have to look at the carbon used to make the biofuels - some will be used for fertiliser, tractors, transport, etc. Also if you are using plant matter that currently is being left to rot back into to the soil, (as proposed) then you are burning carbon that would otherwise be sequestrated - and stripping the soil of natural nutrients - and so on. You also need to use water resources which are increasingly scarce, and land which can be used for food - again world food demand is on the increase.

      From what I have seen of the maths so far, biofuels only capture a few percent of Solar power net, so there is simply not enough spare arable land in the world to make enough fuel - especially as countries like India and China ramp up demand for cars. There is still plenty of sunny unused desert for Solar, or offshore sites for Wind, not to mention Tidal, Wave, etc.. Just use the power in its original Photon->Electron form, and bypass Carbon & Hydrogen altogether..

      --
      "A nation that forgets its past is doomed to repeat it." - Churchill
    10. Re:Give me figures. by norton_I · · Score: 2, Interesting

      Biodiesel production also requires (or at least prefers) carefully bred strains with high oil production. This also leads to somewhat reduced fitness. Probably not as big a deal as these hydrogen producers, but still an issue.

      What I can't seem to get anyone to explain is why we want a hydrogen economy anyway. Liquid fuel for vehicles seems like a much better plan. The only reason to go hydrogen is if you want to fuel vehicles with coal or nuclear plants, and even then, I think it is a better plan to convert they hydrogen to methane or methanol at the generation facility. Biodisel, on the other hand, seems nearly the optimal motor fuel.

      Transportation, storage, transfer, and use of hydrogen are all difficult. All of those problems are solvable, but it seems like unnecessary cost and complexity to me.

    11. Re:Give me figures. by BlueParrot · · Score: 1

      Biodiesel doesn't contribute to global warming. At all. The "bio" part means the hydrocarbons were synthesized from plant matter; the carbon in those hydrocarbons came from airborne Co2. As long as you plant biofuel crops, process them, and burn them, the total amount of airborne Co2 will never increase. Every ounce of carbon added to the air is matched by an ounce of carbon removed from the air by the fuel plantation.


      This is true if and only if you don't chop down a bunch of trees in order to make room for the bio-fuel producing crops. As it happens, deforestation causes CO2 emissions similar in magnitude to fossil fuel use. Thus rather than starting to grow bio-fuel crops, you would be much better of planting trees. This is especially true if you simultaneously retrofit fossil fuel plants with carbon capture and storage technology and start expanding the use of nuclear, solar,wind geothermal and tidal power.

      Having said that, if you could find a way to economically grow these algae in water tanks in the dessert or something, then you might have a fairly decent energy source, thou I suspect it would just be a very inefficient solar plant.

    12. Re:Give me figures. by TheLink · · Score: 1

      "This is true if and only if you don't chop down a bunch of trees in order to make room for the bio-fuel producing crops. As it happens, deforestation causes CO2 emissions similar in magnitude to fossil fuel use"

      If you chop the trees and don't burn the wood, you don't get significant CO2 emissions.

      Convert the trees to timber and paper and the carbon will be stuck in furniture or a landfill for quite a long while.

      --
    13. Re:Give me figures. by famebait · · Score: 1

      Biodiesel doesn't contribute to global warming. At all.

      That's not entirely true. Yes, the binding of carbon in fossil deposits is ultra-long-term, and in biomas it is not, but htta does no mean it does not have an impact.

      If we assume that the fuel extraction results in most of the captured carbon from the plot ending up in the fuel (or in the atmosphere during processing), that means that the only carbon bound up "by" that land at any point in time is that which is in the crops currently growing there, or any fuel generated from it and still not used. Most likely not all that much.

      In contrast, the carbon bound up by, say, a similar patch of forest binds all the carbon in all the biomass on it, decaying on it, and transported out of it (for example for lumber) but not yet burnt or decayed. Quite a lot.

      For farmland it is a similar proposition: sure, the turnover rate for food is faster than for lumber, but it still takes longer for the carbon in harvested for food to return completely to CO2 than if you just burned it straight away, and the rest of the plant is typically not burnt straight away, but decays slowly too.

      Just burning the entire amount of captured carbon more or less immediately (which is sort of the idea of biofuels) short-circuits the cycle, bypassing this reservoir of resident and decaying biomass.

      So although yes, biomass fuel is a lot better than burning oil, converting other carbon-binding biotopes into biomass-farms for fuel does indeed free up more carbon into the atmosphere.

      It is a one-time per-land-area cost, as opposed to the per-energy consumed cost of fossil fuel, so it is of course far superior to that. But it is not zero. Very far from it if we envision biofuels becoming a global energy contender.

      It is reversible, if it ever becomes economical to revert the area to heavier growth and slower decay, but it takes many decades to get a plot of farmland back to anywhere near the carbon-binding ability of, say, old-growth forest.

      SO: a lot better than fossil fules, but solar is still significantly better, and when bio-H2 comes of age it will be way superior too (probably much better, since there is less high-energy manufacturing involved).

      --
      sudo ergo sum
    14. Re:Give me figures. by jstomel · · Score: 2, Interesting

      First you have to look at the carbon used to make the biofuels - some will be used for fertiliser, tractors, transport, etc. Biodiesel production is cheap, easy, spontaneous, and produces no harmful waste. If your starting source is lipids from algae (as GP was talking about) then you need no fertilizer or tractors. And to be honest, you're transporting fuel. Transport isn't carbon input, it just decreases the net yield a bit because you use some of the fuel to transport the rest.

      Also if you are using plant matter that currently is being left to rot back into to the soil, (as proposed) then you are burning carbon that would otherwise be sequestrated - and stripping the soil of natural nutrients - and so on. Plant matter that rots back into the soil releases it's carbon into the aptmosphere through the rotting process. It actually takes very special circumstances (peat bogs and whatnot) to sequester the carbon long term. And what was proposed was not using plant matter, but algae. Algae do not live in the soil and do not strip it of nutrients.

      You also need to use water resources which are increasingly scarce, and land which can be used for food - again world food demand is on the increase. Again, none of these things really apply to biodiesal from algae. Why does everyone trot out these arguments that apply only to corn and soy and act as if they apply broadly to all biofuels?

      From what I have seen of the maths so far, biofuels only capture a few percent of Solar power net, so there is simply not enough spare arable land in the world to make enough fuel - especially as countries like India and China ramp up demand for cars. There is still plenty of sunny unused desert for Solar, or offshore sites for Wind, not to mention Tidal, Wave, etc.. Just use the power in its original Photon->Electron form, and bypass Carbon & Hydrogen altogether.. Because the infrastructure for using biofuels is already in place. It would take almost 20-40 years to replace the vehicle fleet already in place with electric cars. We need a solution that we can start to apply today. Also, all the energy sources you mention (wind, tidal, wave, etc) are ultimately driven by solar power. For the most part they are less efficient converters of solar energy into human usable forms than biofuels. Current solar panels are expensive, fragile, toxic to manufacture (they release arsenic and heavy metals into ground water), and not much more efficient than biofuels. Algae for the most part take care of their own production and upkeep and are environmentally friendly.
    15. Re:Give me figures. by famebait · · Score: 1

      Having said that, if you could find a way to economically grow these algae in water tanks in the dessert or something, then you might have a fairly decent energy source, thou I suspect it would just be a very inefficient solar plant.

      Well, what effieciency the actual organisms will reach is as yet completely unknown (as yet it's awful but the premise is that it can be improved though breeding or manipulation), but in any case:
      Probably inefficient per area compared to solar cells, for a good while. But if we're talking desert or other low-value land, it's really efficiency per investment that matters for both of them.

      The cost of solar cells is still huge, while H2 bioreactors could be done in dirt-cheap extruded plastic canal sheets like those used in greenhouses and for solar water heating. The organisms would build themselves, just feed them nutrients and sunlight (and circulate the gases they need).

      --
      sudo ergo sum
    16. Re:Give me figures. by budgenator · · Score: 1

      Yeah right like the eco-nazis are going to let you destroy the ecologically fragile deserts; hell even I don't think it's a particularly good idea to put algea farms in the desert willy-nilly and I usually get karma-raped on eco-threads in /.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    17. Re:Give me figures. by RsG · · Score: 1

      I'm not even going to comment on the phrase "eco-nazi".

      As for the actual meat of your argument, there are a great many environmental groups that already support the idea of building solar farms in sunny desert areas. They see it as a tradeoff; you cause X amount of local ecological damage, and avoid Y amount of pollution elsewhere from other power sources that would invariably be used if there existed no alternative.

      Most environmentalists, contrary to the "eco-nazi" stereotype, are willing to accept imperfect solutions. Just look at the green support for hydroelectric dams, which also cause serious local ecological damage. Yes, there are those who will accept nothing short of perfection or extinction, but they are squarely in the loony minority. Like most movements, environmentalism runs the range from casual supporters, to serious thinkers, to hardcore zealots, and it makes no sense whatsoever to assume the moderates will react the same way as the loonies.

      Since a hypothetical algae based biofuel farm isn't any different in terms of environmental impact than a solar power array, I suspect most green groups would be willing to support the idea.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
    18. Re:Give me figures. by HexaByte · · Score: 1
      "Because the infrastructure for using biofuels is already in place. It would take almost 20-40 years to replace the vehicle fleet already in place with electric cars. We need a solution that we can start to apply today."

      That depends up on the savings. If fossil fuels rise to $10/gal, and the equivalent price of electric is $3/ gal, then it would behoove the average American, who drives 15,000 miles/yr and averaged 20 mpg, to quickly convert. Once you reach the point that fossil fuels are hard to find at the pump do to limited demand, the inconvenience factor and attendant price rise of hard to find items make switching even more economical.

      I won't consider a hybrid now because the additional price, compared to the amount of fuel I use yearly, makes it a 10 year payback, and since I don't keep cars that long, has a negative monetary effect.

      Give me an electric that cost the same as a gas vehicle, and costs the same to operate, and I'll buy one for my city car. Give me the infrastructure for quick re-powers (fill-ups), and I'll also use it on long trips.

      --
      HexaByte - he's a square and a half!
    19. Re:Give me figures. by tom's+a-cold · · Score: 1

      This is especially true if you simultaneously retrofit fossil fuel plants with carbon capture and storage technology and start expanding the use of nuclear, solar,wind geothermal and tidal power.
      Or, better yet, produce the same unit of GDP with less energy input. I dislike the term "negawatts" but those are what we should be looking for first. The US, in particular, is grossly inefficient in its use of energy (why not? It's nearly free for some uses). In order to mitigate the greenhouse-gas problem, we need to be net carbon-negative. That means increasing plant biomass significantly, NOT burning it to release the sequestered CO2 back into the air, and shifting the mix of energy sources away from both fossil fuels and biofuels.

      A good start is a very high carbon tax. And no get-out clause to bail out agribusiness.

      --
      Get your teeth into a small slice: the cake of liberty
    20. Re:Give me figures. by budgenator · · Score: 1

      People will always assume one of two things if not both,
      first if enough is good, then too much is better and secondly if too much is bad than any is almost as bad.
      Because of that faulty logic and because too much CO2 in the atmosphere is bad than any CO2 in the atmosphere is almost as bad. If any CO2 in the atmosphere is bad than hydrogen that doesn't release CO2 is good. Now I agree that methane would make a pretty good fuel, just like natural gas (slightly impure methane) would but if you look hard enough you'll find a wart on anything so the eco-whackos will fight tooth and nail to kepp us from having something that's pretty damn good just because it's not perfect.
      To be honest, butanol sounds pretty good to me, much better than ethanol.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    21. Re:Give me figures. by budgenator · · Score: 1

      A hydro-electric dam is small scale compared to replacing petro-fuels with bio-fuels; I'm not saying it couldn't be done but most mega-corps with the resources to do it are way too fuedalistic in attitute to do it right.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    22. Re:Give me figures. by Jesus_666 · · Score: 1

      One tiny nitpick: Burning stuff releases CO2, not Co2. Cobalt is not usually involved with oxidation or the greenhouse effect.

      --
      USE HOT GRITS WITH STATUE OF NATALIE PORTMAN (NAKED AND PETRIFIED)
    23. Re:Give me figures. by Ken_g6 · · Score: 1

      I happen to know from Wikipedia that a gallon of gasoline contains about 40 kWh of energy. So let's get started.

      40 kg/acre/day = 40 gallon/acre/day = 40*40kWh/acre/day = 1.6MWh/acre/day

      Now, let's compare to concentrating solar power (CSP) and electrolysis.
      1 acre = 4046 m^2

      During the sunny part of the day, 6 hours, you get roughly 1 kW/m^2*6h = 6 kWh/day/m^2
      6 kWh/day/m^2 * 4046 m^2/acre = 24.276 MWh/acre/day

      CSP is up to about 40% efficient.
      24.276 MWh/acre/day * .4 = 9.71 MWh/acre/day

      Now, electrolysis is up to about 80% efficient. (50% figures are generally for electricity-H2-electricity end-to-end efficiency.) So, 9.71 MWh/acre/day*.8 = 7,770 kWh/acre/day

      Thus, CSP gets you up to almost 5 times the hydrogen per acre. For algae, that's really not bad, if they can do it.

      One more thing: at best, CSP is expected to cost 10 cents/kWh. So, let's find a cost per kg H2 = $ per gallon of gasoline.

      40 kWh/kg / 80% efficiency = 50 kWh electricity/kg*$.1/kWh = $5/kg.

      How much will the algae hydrogen cost?

      --
      (T>t && O(n)--) == sqrt(666)
    24. Re:Give me figures. by ericrost · · Score: 1

      "This is, in a nutshell, anthropic global warming."

      Not to be a completely pedantic dickhead, but "anthropic" global warming would be global warming that exists because we wouldn't be here to observe it otherwise. Global warming that plays a part in our existence. Anthropogenic global warming on the other hand, is global warming that exists because of our activities. This is, I think, what you meant to say.

  4. Not just to be used in cars..maybe by fadilnet · · Score: 1

    Just wondering - can this new algae be used to power satellites, and other space crafts?

    --
    Do I require the c-sig package to have a signature?
    1. Re:Not just to be used in cars..maybe by chuckymonkey · · Score: 1

      According to this I think it's possible provided the light is toned down a bit. I don't know how well it could be scaled due to container size and other factors such as nourishment and the availability of water. It can grow, but I'm not sure if it can be sustained.

      --
      "Some books contain the machinery required to create and sustain universes."-Tycho
    2. Re:Not just to be used in cars..maybe by burni · · Score: 1

      In theory this is possible, but Algae do only grow well under certian conditions,
      the reactor environment and all material must be sterilized before planting algae.
      In Space you must provide a nearly 100% reuse of the material,
      to sustian this artificial circle of life, and you must controll the feeding.

      here are the cons
      cg - Algae need Water
      cs - in Space the Temperature must not fall beyond 0&#176;C (freeze)

      cg - Algae need light and often they have an inner clock
      cs - Satelites travel the orbit not in a 12/12 day/night cycle

      cg - Algae need warm Water, but not too warm
      cs1 - you must heat the water when you are in the night
      cs2 - you must cool the water when you are in the day
      cs3 - you must do it very frequent

      cg - bioreactors can collapse by infection
      cs - you energy source is gone and you just cannot repair it

      cg - Algae are robust against radiation, but what about mutation
      cg - when you produce gm plants you turn things by your own and not as the DNA intended
      them to be,
      cs - these algae can mutate the way you don&#180;t want
      cs - these algae can die cause of high radition (solar bursts, gamma-, x-ray,HE-particles)
      cs - the tank must provide presure, if it got damaged by micrometereotes the presure is gone.

      cs - this means you must provide mechanical and optical protection while providing access to certian parts of the suns spectrum,

      btw. you have also to apply an UV-filter, like you do on your own.

      so I would say, not usefull for satelites, but perhaps space stations.

    3. Re:Not just to be used in cars..maybe by famebait · · Score: 1

      algae will not be used in cars, not in spacecraft.

      Spacecraft will continue to be best served with solar cells for electricity, if they are near enough the sun, nuclear otherwise.

      The best you can hope for is that the ones who come ready-loaded with chemical rapid-propulsion fules get theirs from these algae.

      There might appear craft that generate h2 from solar (for more concentrated blasts than they would have power to from electrical engines), but they still have to bring along water to make it from. I suspect the necessary systems needed would outweigh the benefits of just launching with H2 and O2 in stead of water, even for solar cell electrolysis, and especially for biological H2 generation.

      The best you can hope for is that the h2 they bring along is generated in a friendly way, but looking at the total energy consumption of a space mission, it scarcely matters.

      --
      sudo ergo sum
  5. algae filled lakes by OffTheLip · · Score: 1

    Based on the amount of algae I see in the lakes where I live this could be useful. Assuming accelerated algae growth is caused by fertilizer runoff could this counteract some of the environmental damage we (collectively speaking) cause? If nothing else the polluters would feel they are contributing to the greater planetary good along with having a kick ass lawn.

    1. Re:algae filled lakes by famebait · · Score: 1

      All that acreage and you lawn needs glass warehouses built over them. Big huge warehouses, made with lots of glass.

      No warehouses. Just transparent pipes/canas.

      And how do you make glass? Sand and lots of heat, which would probably come from oil or natural gas.

      No need to use glass. Plastic is fine.

      Or, you could use plastic bags instead of glass. But that comes from oil again,

      _coming_ from ois is not what makes fossil fules bad. As long as you don't burn the damn things on a massive scale, or pollute too much in other ways along the way, making stuff from oil is just fine.

      --
      sudo ergo sum
    2. Re:algae filled lakes by TheRaven64 · · Score: 1

      Coming from oil is bad in the sense that our current source of oil is a limited, and increasingly scarce, resource. That said, plastics are just hydrocarbons. You can make them out of any other hydrocarbon (e.g. vegetable oils) with some energy investment. Given a cheap and renewable energy source, this becomes feasible. With enough energy, you can make plastic out of air and water, it's just a matter of your dollar to joule exchange rate.

      --
      I am TheRaven on Soylent News
  6. Nice work, but... by jcr · · Score: 3, Interesting

    At $2.8 per Kg, this would be one of the cheapest ways yet to extract hydrogen, but it still leaves the problem of containing it in a vehicle, the cost of building the fuel cell or engine you'd burn it in, and so on. The fact is that gasoline has an incredible energy density by volume, and in absolute terms, it's still very, very cheap.

    Something I find rather more promising is the work described in an earlier MIT review article, where bacteria are being modified to make gasoline directly. Just like petroleum-based gasoline, except that it's carbon-neutral, and sulphur-free. We're talking gasoline from anything that E. coli can ferment.

    -jcr

    --
    The only title of honor that a tyrant can grant is "Enemy of the State."
    1. Re:Nice work, but... by thanatos_x · · Score: 1

      Hydrogen does have quite a lot of energy bang for the buck, though since it's a gas vs a liquid, the comparison by volume is kinda flawed. I'm pretty sure that as a liquid it has considerably more energy density than gasoline, but it is a bitch to keep compressed like that and it's insanely volatile.

      So many problems to solve? Yes. But chalking one off the list is a good thing, reducing the fundamental problem with hydrogen power - the fact that the variable cost was so high. If there's an abundant energy rich resource available it gives much greater incentive to find a way to use it. If we didn't have so much oil, we'd probably find a way to use coal to power vehicles (and not simply by converting it to oil.)

      The fact remains that building such facilities to produce hydrogen, as well as many other stages required to make hydrogen a practical fuel, is a chicken and the egg problem. Come to think of it, i wonder which will end first - the dominance of gasoline as a fuel, or the dominance of the x86 ISA. The same solution is required, a hybrid which can implement the old way and new way reasonably well (70+%) of a pure implementation of both.

      --
      I am not an expert. If I am misled in something, please correct me.
    2. Re:Nice work, but... by Planesdragon · · Score: 1

      The same solution is required, a hybrid which can implement the old way and new way reasonably well (70+%) of a pure implementation of both. Nope. The "solution" is a pressing need to move from one to the other. x86 will be around for a long time because there's no significant end-user benefit to ditching it. Hyrogen vs. Gasoline, on the other hand...
    3. Re:Nice work, but... by zippthorne · · Score: 1

      Hydrogen is quite a bit trickier to store than liquid fuels. You need either a pressure vessel, cryogenic storage, or a gigantic gas bag. All of which have their issues, and that's before considering diffusion (H2 is really, really small and will diffuse through just about anything given enough time) and its related problem, hydrogen embrittlement.

      It is not at all unintuitive to believe that the cars of the future will be powered by liquid hydrocarbons, with only the source of those hydrocarbons in question.

      --
      Can you be Even More Awesome?!
    4. Re:Nice work, but... by zero_offset · · Score: 1

      BMW's efforts tell you everything you need to know about why the $2.80/Kg figure is specious. Heck, simple math and a few facts tell you everything you need to know. Energy by weight (unit-mass) is irrelevant. As you note, hydrogen has to be compressed to be reasonably useful, and it turns out that achieving near-parity with gasoline's energy density by unit-volume, you have to compress hydrogen almost to a liquid state (LH2).

      LH2 needs to be cooled at around -425F and stored at something around 11,000 PSI. At that point, you have a volumetric energy density that is about 22% that of an equivalent volume of room-temperature, 1-atmosphere (about 14 PSI) gasoline. The BMW Hydrogen 7 vehicle actually stores hydrogen at soemthing like -250 F, and about 8700 PSI, and I've read that this works out to about 13% of the volumetric energy density of gasoline.

      Just to establish that cooling and compression is actually required, note that gaseous hydrogen has an energy density by volume of only 0.0003% that of gasoline.

      The trouble with working with and storing hydrogen is that it bonds with metal easily (causing hydrogen embrittlement) meaning virtually every contact point has to be stainless steel, and given it's tiny size and weight, it escapes very easily. Jack up the pressure a few thousand PSI and the problem becomes even worse. BMW's fuel storage system will lose about 50% of it's total volume in a period of about 9 days, and their tank is an expensive, exotic beast comprised of something like 40 layers of specialized insulators and sealers.

      So storage is complex, and I imagine harvesting hydrogen from a 1 acre area would be immensely complex, and you can also conclude that compression is complex -- and expensive. And it requires a huge amount of power.

      An off-the-shelf hydrogen compressor which can process this volume of gas in a matter of hours will run you about $50K. Look it up. I did a few months ago when my father decided he'd start making hydrogen in his back yard. Compressing enough hydrogen to produce the energy-equivalence of a full tank of gasoline will also cost you about 4kwh of electricity (per tank). And you need a compressor like this -- for the volume and pressure we're talking about, anything less and you'll be losing just as much as you're compressing.

      Simple math demonstrates that recouping the cost of just the compressor and electricity is virtually impossible. Assume no maintenance or failures, no costs associated with the farming of the hydrogen, and no storage or storage-loss expenses. That's about 40 years of bi-weekly 16-gallon gasoline fill-ups at $3/gallon, or the equivalent cost of about 17,000 gallons of gasoline before this setup paid for itself. And that's with a boatload of irrational assumptions skewed heavily in the favor of hydrogen. Add the costs I said to ignore, plus this $2.80/gallon production costs, assume some losses and incidental expenses over the decades, and suddenly hydrogen becomes tremendously expensive again. Even allowing for tremendous inflation of gasoline prices, you're talking nearly half a lifetime's worth of fuel just in the most basic plant and operation costs, barring storage, delivery, modifications, etc.

      The only part I disagree with is that the engine modifications would be all that tricky. It's remarkably easy to convert a gasoline engine to burn hydrogen, either very efficiently, or somewhat less efficiently, but retaining the ability to continue burning gasoline as well.

      Note that all these figures are off the top of my head from memory, but they're generally close enough to correct to adequately illustrate that the cost of just cracking the hydrogen doesn't even scratch the surface of real-world hydrogen-based fuels.

      Thanks for the link to the bacterial bio-fuels article, by the way. I hadn't seen that one. Very interesting. I also can't help but wonder about this abiotic oil business.

      --

      Slashdot quality declines as the number of hot grits posts decreases. - Provolt's Law, Apr-09-2005

  7. Is it to much to ask by onyxruby · · Score: 2, Interesting

    Is it to much to ask to get reference links with more credibility than wikipedia? I mean, come on, is it really that hard to find a credible source to reference? For pete's sake even wikipedia claims it should /not/ be sourced as a cite, only a starting point.

    1. Re:Is it to much to ask by onyxruby · · Score: 2, Insightful

      Wikipedia is attempting to index what, the Internet? Wikipedia cites only popular persistant opinions of very narrow political persuasions. Pick a contorversial topic, it doesn't matter what it is, said writing is full of bias presented as fact often bordering or outright propoganda. I have a problem when people assume that popular persistent opinions somehow equal truth, accuracy or science. I'm not the one who cited something. Besides, since when has it ever been prudent to ask readers of a story to provide their own cites? I have done technical writing in one form or another for a decade now, providing a reliable cite is par for the course. Your not one of those that thinks people have a duty to update wikipedia are you?

    2. Re:Is it to much to ask by vertinox · · Score: 1

      Is it to much to ask to get reference links with more credibility than wikipedia?

      Umm... There were two links, the second link being the actual article with interview and links to sources at laboratories doing the research. I'm assuming the first link in the summary to Wikipedia was to familiarize anyone with the concept of using algea as a source of biofuels.

      Seeing there are no online encyclopedias or organizations devoted to algea farming (as of now) Wikipedia seems to be the perfect place to explain the concept and theory behind the technique. However, if you want the actual application and source material then you should be going with the second link in the summary.

      I don't see anything wrong with linking WP to show someone what the concept was. If say during a casual conversation a friend or relative asked me what city Einstein was born in, I'd recommend Wikipedia since I don't know it off the top of my head and that is the quickest method of finding that information. But if they were doing a research paper on Einstein's childhood for school, I'd recommend going to the library or bookstore simply because they'd have access to the sources directly and the fact if you have to 100 pages of reading on paper is easier on the eyes.

      --
      "I am the king of the Romans, and am superior to rules of grammar!"
      -Sigismund, Holy Roman Emperor (1368-1437)
  8. H2 Panacea by pipingguy · · Score: 1, Interesting

    Once it's produced, how do you store it? I confess that I now (sort of) work for evil "big oil" but I do have some experience with the practicalities of storing and transporting hydrogen.

    1. Re:H2 Panacea by The_Dougster · · Score: 2, Interesting

      Once it's produced, how do you store it? I confess that I now (sort of) work for evil "big oil" but I do have some experience with the practicalities of storing and transporting hydrogen.

      Thats a pretty good question there! I'd recommend using Metastable Metallic Hydrogen personally, except there's a small issue that nobody has exactly figured out how to make the stuff yet.

      That being said, I always thought that good old Ammonia (NH4) had some nice potential for hydrogen storage. Its easily liquefied at room temperature. There are a couple issues with Ammonia though. First, it tends to be rather poisonous, such that breathing in a good lung full of the pure gas would probably be fatal. Secondly, its a bit difficult to get it to react in a controlled fashion. Thirdly, it tends to explode violently sometimes, kind of unpredictably I gather. There's no doubt that Ammonia is an energy dense substance; however, exploiting it for a consumer energy material is somewhat problematic.

      A safer alternative would be to saturate a carbon backbone with hydrogens, resulting in some kind of diesel or wax type fuel. That more or less puts us back where we started though, except now we have to expend extra energy to synthesize the stuff rather than just pumping it out of a hole. I suppose when the holes start going dry it might be an option...

      --
      Clickety Click ...
    2. Re:H2 Panacea by Courageous · · Score: 1

      Why no mention of Hydrogen Boraxate?

      It has its own problems, but explosive and/or highly poisonous aren't among them.

      C//

    3. Re:H2 Panacea by flyingfsck · · Score: 1

      Hmm, most people conveniently ignore the impracticalities of H2. It is far better to combine H2 with Carbon and turn it into a liquid, than to try and contain a gas with an incredibly small molecule size that can pass through steel.

      --
      Excuse me, but please get off my Pennisetum Clandestinum, eh!
  9. The requirements... by physicsphairy · · Score: 3, Insightful

    If "a kilogram of hydrogen is equivalent in energy to a gallon of gasoline" then, estimating about 400 million gallons of gas per day used by the US, we will need 10 million acres of algae farm. That is with the assumption that they obtain their optimal output, and no additional energy is expended for processing, transport, etc.

    By contrast, an average nuclear power plant produces 1000 megawatts of energy. Also assuming optimum efficiency, we get (10^9 joules pers second * (60 * 60 *24) seconds per day / (237.1*10^3 joules to electrolyze 1 mole of hydrogen at 298K) * 1.01 grams/mole = 368,047 kilograms of hydrogen per day.

    So... 10 nuclear plants, or 10 million acres of algae farm?

    Let's not forget that your algae farm will stop photosynthesizing when it's cloudy out.

    1. Re:The requirements... by eniac42 · · Score: 4, Interesting

      Hmm.. Or for 10 Gigawatts, you could use a solar plant about 10x10 miles in the Nevada desert. This sceme http://www.reuk.co.uk/Nevada-Solar-One.htm Delivers 64 Mw for 350 acres = 45 watts per sqr meter. 10 x10 miles = 260 000 000 m2, x 45 (watts) = 11.7 GigaWatt supply. Yup ok, day only - but you are charging car batteries, so you could work out a scheme that does that in the day. They reckon it costs around $0.07/Kwh.

      You are right on one thing though - probably better to just generate & use electricity directly than to mess about with Hydrogen, etc. Think of all the plastic/glass you would need to contain the algea and collect the gas..

      --
      "A nation that forgets its past is doomed to repeat it." - Churchill
    2. Re:The requirements... by grimJester · · Score: 2, Informative

      The US has around 940 million acres of farmland (source). A single percent of this would be enough to fuel all the cars in the country. It's not necessarily the most efficient option but certainly doable.

    3. Re:The requirements... by Darkelf · · Score: 1

      I would choose 10 million acres over even ONE nuclear plant. These organisms need to be grown where there is sunlight, not farmland. I see a great opportunity for states like Nevada, which are sun-rich and farmland poor to turn this into a viable economic activity. IMHO it sure beats worrying about radioactive leakage from an unproven and unwanted Yucca mountain facility.

      Sure, there are issues with getting enough water in Nevada for all of these organisms, but the potential is worth considering. Even if only the biofuels created from these plants are considered. They have not yet made an economically viable electric commercial plane yet, you still need fuel to fly those planes.

      Interesting article, I like the fact that this oil "crunch" (or whatever you call it) is causing some serious thought about new ways to create and store energy.

      --
      -Darkelf
    4. Re:The requirements... by Alsee · · Score: 1

      So... 10 nuclear plants, or 10 million acres of algae farm?
      Let's not forget that your algae farm will stop photosynthesizing when it's cloudy out.


      Algae farms especially stop photosynthesizing when it's nuclear-cloud-y out.

      Actually I support nuclear power as safe clean energy, but I couldn't resist making the joke anyway.

      -

      --
      - - You can't take something off the Internet! That's like trying to take pee out of a swimming pool.
  10. Nuclear + Hydrogen + Batteries by BlueParrot · · Score: 1

    It sort of pains me to see all these touted solutions to fuel and energy when we have perfectly valid (and economical ) solutions available. Use Nuclear to generate electricity and hydrogen, short to medium distance travel use batteries, long distance and aviation can use hydrogen or electricity. Heck, when you factor in service costs batteries are already starting to become competitive for cars, electric trains are well tested, and it has been demonstrated several times that powering jet engines on cryogenic hydrogen is perfectly feasible. Charging times and capacities for batteries are improving every year, and the infra structure for charging batteries ( i.e the electric grid ) is more or less there. The way I see it, it is only a question of time ( set mainly by how rapidly the oil price is going to rise ) before the majority of fossil fuel consumption is replaced with electric. Aviation is a bit tricky because using batteries will probably not be practical, but on the other hand airlines have predictable schedules, use all their fuel within a few hours, and use a much larger scale than personal cars, and this essentially removes the main problems with liquid hydrogen ( the heat flow through a large container is much easier to deal with since volume increases quicker than surface area as you scale things up ). Bio-fuels are generally a very bad idea as simply planting trees would soak up way more CO2 than the bio-fuels would save within a century. Also, if used in the form of combustion of ethanol they are not much cleaner than petroleum in terms of all non-CO2 pollutants. You still get soot particles and nitrates from the combustion ...

    1. Re:Nuclear + Hydrogen + Batteries by IhuntCIA · · Score: 1

      ... long distance and aviation can use hydrogen or electricity. Liquefied Hydrogen is very low in energy to volume ratio and it is inadequate for aviation as batteries are inadequate for their energy to mass ratio.
      I would go for the bio-diesel any time, but after the corn-ethanol fiasco, I guess that Hydrogen is the next madness for the masses ...
  11. My tech is better! by Chemisor · · Score: 2, Funny

    Let me introduce you to an advanced technology vehicle I've been researching for years. It runs on nothing but pure cellulose in form of grass and so is very environmentally friendly. I call it a "horse". It requires no fossil fuels and is surely the transportation of the future.

    1. Re:My tech is better! by dvice_null · · Score: 2, Funny

      Actually horses are not that environment friendly, they produce pollution from both ends.

  12. same question by roman_mir · · Score: 1

    same question as the last time - be careful what you release into the wild.

    1. Re:same question by taricha · · Score: 2

      In general, by genetically modifying something we make it less fit in a survival sense. Look at all the plants and animals we've domesticated for our use by hybridization. They hardly run rampant destroying their wild cousins. In fact they'd be dead without our help, because we've reduced their fitness by making them overproduce some aspect we are interested in. This algae is no different. The modification actually makes each cell absorb less light so it absorbs only what it can use allowing the sunlight to be spread over more cells. So this algae is less competitive than its wild "light-hogging" cousins.

  13. Duke Nukem's comment... by g253 · · Score: 1

    Duke Nukem's comment was "what are these cars, some bottom-feeding scum-sucking algae eaters?"

  14. If this actually turns out to be viable... by Tastecicles · · Score: 2, Interesting

    ...then the governments of the developed world will find ways to:

    a. stifle it while there's still fossil fuels to be had (ie with prohibitive taxation)

    b. stifle the technology which utilises it (by classifying it for military use)

    c. bud off private concerns (or use existing military contractors) who then go on a patent grab for said technology, making an example of anyone who tried it (yes, you, Mr. Hobbyist!)

    d. license favoured concerns to (under)develop and (under)utilise the technology until such time as the oil becomes economically nonviable.

    As a side note, I already use photovoltaics and gel storage to power my custom bike (so, sue me, Shell!). While it doesn't go 0-60 at the speed of thought, it does carry me and my laptop at a nice pace (20-40 depending on conditions). No petrol consumption at all there, and I get about two hours off of a cold charge with the panel off.

    --
    Operation Guillotine is in effect.
  15. transition by zogger · · Score: 2, Interesting

    Corn was never meant to be the perpetual energy fuel feedstock. It is being done as a transition fuel feedstock while other technologies, like this algae for instance, or cellulosic ethanol from switchgrass, etc, develop. And it is because we are set up to produce corn (and soybeans) in mass quantities with no infrastructure changes right now today, this season, it's happening. Just like the vehicle changes, we are transitioning from straight gashogs to hybrids to eventually plug in hybrids and hydrogen fuel cells and straight electric drive, but that is still way down the road. This is the tech we have now, that's all, have to start someplace.

    1. Re:transition by SunTzuWarmaster · · Score: 4, Interesting

      No one ever seems to remember sugar cane and sugar beets, so I'll point it out. They are double the yield per acre (vastly more efficient but harder to grow) as compared to American corn.

      Well that's not entirely true, Brazil didn't forget. But then again, they don't have corn lobbyists.

    2. Re:transition by budgenator · · Score: 4, Insightful

      I live in sugar beet country and I can assure you that we didn't forget, I'm also in corn country so that gets a lot of noise as well. The real answer will be more like
      1. grow the corn,
      2. grow the beets,
      3. press out the oils out of the corn for food use,
      4. reclaim the used food stuff oils aned animal fats for biodiesel,
      5 extract the sugars from the corn, feed the distiller's dried grain and roughage back to the cows (makes food and animal fat for step 4)
      6. add beet sugar to the corn sugar and make Butanol instead of inefficient Ethanol
      7. profit!

      I don't think there will ever be a one answer answer; the answer will be multi-use feed the waste of one almost economical process to the next almost economical process.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    3. Re:transition by shbazjinkens · · Score: 1

      6. add beet sugar to the corn sugar and make Butanol instead of inefficient Ethanol
      I read the wikipedia article, and noticed this at the end:

      The key research challenge that must be resolved is that butanol production inhibits microbial growth even at low concentrations. The result is that the product of the fermentation is less than 2% butanol. The overwhelming majority of the fermentation broth is water, so an energy-intensive distillation step is required for purification. This may be acceptable if the goal is to produce butanol for use as a solvent, but if butanol is to gain traction as a motor fuel, energy inputs into the process need to be minimized.
      So with that in mind, wouldn't a genetically modified yeast be more acceptable? You could harvest the piss from a bar's bathroom and get 2% ethanol.
    4. Re:transition by budgenator · · Score: 1

      Anaerobic fermentation using C. acetobutylicum recently regained marked interest for use in vehicle fuel production as a gasoline and diesel fuel replacement. This is because butanol as produced by a fibrous bed bioreactor utilizing recent biotechnology co-developed by Environmental Energy Inc. and Ohio State University produces the alcohol butanol as its primary output. The patented process using C. tyrobutyricum produces little acetone or ethanol, instead producing butyric acid and hydrogen which is then pumped into another fibrous bed bioreactor where C. acetobutylicum converts the butyric acid into butanol, thus optimizing butanol production. Essentially, the new process obviates the A.B.E. process, making butanol production competitive with other biofuels both economically and in energy production. ... Unlike yeast, which can only digest sugar into alcohol and carbon dioxide, C. acetobutylicum and many other Clostridia can digest whey, sugar, starch, lignin, cellulose fiber and other biomass directly into butanol, propionic acid, ether, and glycerin. Apart from the need for temperature control, the A.B.E. synthesis process is relatively simple. The products are formed in layers that are easy to separate. Clostridium acetobutylicum

        Note the last sentence, by separating in layers, the energy expensive distillation can be avoided even better look at the list of what it digests, this family of bacteria will eat everything from refined sugar to tree bark and cow manure! The butanol behaves very much like pump gasoline in vehicles. Hell you might even be able to digest the glycerin byproducts from biodiesel and use the butanol as a substitute for methanol to make biodiesel.
      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
    5. Re:transition by IndustrialComplex · · Score: 1

      this family of bacteria will eat everything from refined sugar to tree bark and cow manure!

      What about polymer seals?

      Looks like I've got to get back to drinking sterno.

      --
      Out of modpoints but really liked a post? 1BDkF6TtmmeZ3yqXbz9yhdYVqRYnwFoXDj
    6. Re:transition by budgenator · · Score: 1

      technically starches and cellulose are polymers so paper gaskets wouldn't be a good idea.

      --
      Apocalypse Cancelled, Sorry, No Ticket Refunds
  16. Wikipedia requires some basic understanding by Morgaine · · Score: 2, Insightful

    > Wikipedia, the concept that persistent opinions are accurate opinions

    Persistent opinions ARE accurate opinions in many fields (to the best of human knowledge), and in other fields they're not.

    The only strong "limitation" of Wikipedia's model is that it requires readers to understand which field falls into which category. If you wish to accuse Wikipedia of not being 100% useful to totally non-perceptive readers, then yes you're right, one would have to agree with you. It's only useful to totally non-perceptive readers when they happen to be reading pages of the first kind, not the second. But those who are perceptive know how much to trust both kinds of article.

    The types of fields in which persistent opinions are accurate opinions are those ruled by verifiable fact, the rule of mathematics and logic, and cooperative progress through explicit reasoning, not through debate. That includes mathematics and logic themselves, plus all the hard sciences and branches of engineering. It excludes almost everything else, even many fields that try to employ logical discourse (eg. about 95% of philosophy is excluded). And even harsher than this, it also excludes personal opinion within the included fields: for example, it excludes personal interpretations in climatology and claimed predictions for the future, while including the very scientific fact finding and analysis in that field of science.

    To those who understand the above, Wikipedia is an invaluable resource, because (apart from occasional human error and abuse, which are both rapidly corrected) the entries are all made cooperatively and all new progress builds upon past progress. Thus, the entries that persist represent the current peak of human understanding.

    This contrasts markedly with the other kind of fields, in which personal opinion, claimed experience, authoritative position, and vocal statements matter. Yes, you can't trust anything that you read in those fields on Wikipedia, but that's not Wikipedia's problem. You can't trust what you read about those field on any other forum or means of communication either.

    So, if you have a problem with trusting Wikipedia, it's either because you work in fields of the second kind (and hence you're part of the problem), or else because you fail to understand how human endeavour is split into those two very different categories and so you don't apply suitably varying degrees of trust.

    It's your problem, not ours on the science and engineering side. Wikipedia serves us well.

    --
    "The question of whether machines can think is no more interesting than [] whether submarines can swim" - Dijkstra
    1. Re:Wikipedia requires some basic understanding by nwbvt · · Score: 1

      "The types of fields in which persistent opinions are accurate opinions are those ruled by verifiable fact, the rule of mathematics and logic, and cooperative progress through explicit reasoning, not through debate. That includes mathematics and logic themselves, plus all the hard sciences and branches of engineering."

      No, beliefs in the hard sciences are not ruled by verifiable fact, at least not when you get beyond the very basics. Most of science is based on hypotheses and theories. One cannot verify that all matter is made of tiny vibrating strings, or that the moon was formed from the collision of Earth with a smaller planet, or that human activity is the primary cause of global warming. All scientists can do is develop more hypotheses, test them, and use those results to support, fine tune, or occasionally throw out their theories. So the belief that persistent opinions are accurate ones is actually very dangerous to science.

      But anyways, you miss the main problem with the wikipedia. It is not that it is often inaccurate or that it pushes the idea that popularity means accuracy. Those are disturbing consequences of it, but not the main problem. The biggest problem is that it is a tertiary source. This means that like an encyclopedia article, it makes for a very bad citation. The purpose of tertiary sources is to serve as an easy way to look things up and get a quick overview, they do not replace real research.

      In fact it is insulting to give a link to the wikipedia to explain whatever it is you are talking about (like the submitter of this story did) because the implication is that the readers are too stupid to do a wikipedia search. If all you know about something is what the wikipedia told you, you are not an authority on the subject.

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
    2. Re:Wikipedia requires some basic understanding by 10101001+10101001 · · Score: 2, Interesting

      No, beliefs in the hard sciences are not ruled by verifiable fact, at least not when you get beyond the very basics.

      Um, the hard sciences *are* the very basics because they're directly verifiable.

      One cannot verify that all matter is made of tiny vibrating strings, ...

      Which is why string theory isn't science.

      ... or that the moon was formed from the collision of Earth with a smaller planet, ...

      If by "verify", you mean, "we can't go back in time to witness it", yes.

      ... or that human activity is the primary cause of global warming.

      And if by "verify", you mean, "simplify global climate into a simple, testable experiment", yes. You can merely verify most (if not all) of the factors that make up the theory.

      All scientists can do is develop more hypotheses, test them, and use those results to support, fine tune, or occasionally throw out their theories.

      Reasonably true.

      So the belief that persistent opinions are accurate ones is actually very dangerous to science.

      That's hardly the case. The problem is when hypotheses or conjectures are taken as accurate (instead of merely well-informed guesses) or when theories, after being disproven, are still viewed as accurate (even innaccurate ones (general relativity) can be useful when one recognizes and works around those innacuracies). Or, put another way, the very dangerous to science is when people think science always has an answer, instead of taking a more nuanced view of the situation (which is often, "I don't know").

      But anyways, you miss the main problem with the wikipedia. It is not that it is often inaccurate or that it pushes the idea that popularity means accuracy.

      Correction. It pushes the idea that eventually enough people will see problems and issue changes to correct those problems. The point of accuracy is supposed to come not from popularity but through proper citation (which itself is based squarely on verifiability, to the point that verifiability is more important than accuracy).

      Those are disturbing consequences of it, but not the main problem. The biggest problem is that it is a tertiary source. This means that like an encyclopedia article, it makes for a very bad citation. The purpose of tertiary sources is to serve as an easy way to look things up and get a quick overview, they do not replace real research.

      Perhaps you hadn't considered that that's what people view Wikipedia as? Consider that, instead of linking to a source directly, one can instead alter Wikipedia to include that source (assuming, of course, that the source is appropriate (ie, that it serves better than existing sources)) and link to the article so that you not only receive the source but also *other* sources as well. Of course, it might be wise to include Wikipedia *and* an appropriate source.

      In fact it is insulting to give a link to the wikipedia to explain whatever it is you are talking about (like the submitter of this story did) because the implication is that the readers are too stupid to do a wikipedia search.

      I somewhat agree. But, one of the main points of /. (and the web, in general) is to provide an easy means of linking things. Of course, one could aruge that such easy linking is something more suited for a web browser extension. Or, one could go to google news as a stream of news articles to filter through to find your own sources and avoid /. completely. In fact, googling something can be trivially easy at times, to the point that one could argue that citing anything is to mock one's audience. Clearly that's not true. So, while Wikipedia might not be the best source (directly), t

      --
      Eurohacker European paranoia, gun rights, and h
    3. Re:Wikipedia requires some basic understanding by nwbvt · · Score: 1

      "Um, the hard sciences *are* the very basics because they're directly verifiable."

      No, they really are not. I don't know how to state it more simply than that. You have a dangerously inaccurate view of the epistemology of science and its role in our world.

      "If by "verify", you mean, "we can't go back in time to witness it", yes."

      By 'verify' I mean to prove the truth of it, you know, the definition of the world 'verify'. And you had better not whine that that is too strong of a standard, you are the one who first used the word.

      BTW, the reason scientific articles are in general more accurate than say, historical articles has nothing to do with whether or not they deal with "verifiable facts", its because of the population dynamics regarding who is editing the wikipedia. People with expertise in science and engineering are much more likely to be editing it than a historian.

      "Perhaps you hadn't considered that that's what people view Wikipedia as? "

      If so, we wouldn't be having this conversation as the submitter of the article wouldn't have cited it.

      "And if you're upset because Wikipedia told you something and it's not backed by verifiable sources, you have reason to be upset. But, you seem to be under the impression that Wikipedia doesn't strive to provide verification for things. When it fails, it is a horrible source. That doesn't mean it's always a horrible source."

      You are still missing the point. The problem isn't that the wikipedia is unreliable or doesn't always have citations, its that it is a tertiary source, which as you should have learned in the fifth grade makes it unsuitable for citations. Even the wikipedia itself has a disclaimer stating this.

      BTW, Neil Waters provides an excellent summary of these problems in a column he wrote in this month's (September) issue of the Communications of the ACM, you might want to check it out. And don't give me any crap about the ACM not putting it for free online, either go to the library or buy a copy of the magazine.

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
    4. Re:Wikipedia requires some basic understanding by nwbvt · · Score: 1

      Either you have a very low opinion of human knowledge and don't believe we will ever encounter more evidence with which we can revise our scientific understanding of the world, or you are an idiot. Actually, those are not mutually exclusive options.

      BTW, my 'fields' are in computer science and mathematics genius.

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
    5. Re:Wikipedia requires some basic understanding by Kjella · · Score: 1

      The types of fields in which persistent opinions are accurate opinions are those ruled by verifiable fact, the rule of mathematics and logic, and cooperative progress through explicit reasoning, not through debate. That includes mathematics and logic themselves, plus all the hard sciences and branches of engineering. It excludes almost everything else, even many fields that try to employ logical discourse (eg. about 95% of philosophy is excluded). And even harsher than this, it also excludes personal opinion within the included fields: for example, it excludes personal interpretations in climatology and claimed predictions for the future, while including the very scientific fact finding and analysis in that field of science.

      You know, I hear the idea that the earth was flat was rather persistant before Copernicus. I think that if you put a paleontologist and a creationist in the same room, the paleontologist would claim he's dealing in hard science yet the creationist got the most persistant opinion (2000 years and going). To exclude "claimed predictions of the future" in a field, is to exclude inductive reasoning which is the basis for all science except abstract math. Everything is built on an interpretation making predictions that are accurate. If you only recognize Wikipedia as a legitimate source for what there's no dispute about, well there are a few articles left but then you're even looking at science through the rear-view mirror. And just because science is old and undisputed doesn't mean it's accurate, like for example a lot of the "classic" physics was rewritten to take general relativity into account. Unless Wikipedia is open to reinterpretations like that, you'll basicly lose everything that relates to progress of science and just be a 20+ year old science book. That is certainly not very useful.

      --
      Live today, because you never know what tomorrow brings
    6. Re:Wikipedia requires some basic understanding by 10101001+10101001 · · Score: 1

      Um, the hard sciences *are* the very basics because they're directly verifiable.

      No, they really are not. I don't know how to state it more simply than that. You have a dangerously inaccurate view of the epistemology of science and its role in our world.

      Uu're right. Hard sciences includes theories, not merely the basic quantitative empirical research/data that would suffice for "directly verifiable". Clearly I need a better dictionary.

      If by "verify", you mean, "we can't go back in time to witness it", yes.

      By 'verify' I mean to prove the truth of it, you know, the definition of the world 'verify'. And you had better not whine that that is too strong of a standard, you are the one who first used the word.

      My point was that, at some level, the only thing that's "provable" is that which is directly in front of you. Everything else follows into conhecture. To which I agree, you can't verify the hypothesis about the Moon forming from a Mars-sized object colliding with the Earth. Btw, I'm not the one who first used the world "verify". I just wanted to clarify in how your definition, which is admittedly reasonable considering the discussion, precludes validation of the things you mentioned.

      BTW, the reason scientific articles are in general more accurate than say, historical articles has nothing to do with whether or not they deal with "verifiable facts", its because of the population dynamics regarding who is editing the wikipedia. People with expertise in science and engineering are much more likely to be editing it than a historian.

      That's certainly possible. On the other hand, there's lots of things on Wikipedia that don't include citations of verification on anything (like the "hard sciences" article). It just happens that as much as the Wikipedia foundation is supposedly for verification, a lot of articles (I wouldn't guess the ratio of science/engineering to historic) don't include any citations. How, btw, do you know what's generally more accurate, or do you assume that "more edits" equals "more fixes" as well? Out of curiosity, do you mean more accurate as in a lower standard deviation in change, as the term accurate is general understood in science?

      Perhaps you hadn't considered that that's what people view Wikipedia as?

      If so, we wouldn't be having this conversation as the submitter of the article wouldn't have cited it.

      I'm not sure I quite get that. Encyclopedias/Wikipedia are there to provide a very cursory reference source, as a jumping off point to find more information. But, encyclopedias are unsuitable as a citable source, so you shouldn't ever reference them because to do so would qualify them as an authority of even the smallest nature. Or are you willing to understand that /. entries that include references to Wikipedia articles provide them as a tertiarty source beside the real "meat" of the entry and should only be used as a jumping off point? Ie, why is it alright for anyone to every reference the use of an encyclopedia? It seems they shouldn't exist (or if they did, that no one should tell anyone about them because they're unworthy of being referenced as any type of authority).

      And if you're upset because Wikipedia told you something and it's not backed by verifiable sources, you have reason to be upset. But, you seem to be under the impression that Wikipedia doesn't strive to provide verification for things. When it fails, it is a horrible source. That doesn't mean it's always a horrible source.

      You are still missing the point. The problem isn't that the wikipedia is unreliable or doesn't always have citations, its that it is a tertiary source, which as you should have learned in the fifth grade makes i

      --
      Eurohacker European paranoia, gun rights, and h
    7. Re:Wikipedia requires some basic understanding by nwbvt · · Score: 1

      "That's certainly possible. On the other hand, there's lots of things on Wikipedia that don't include citations of verification on anything (like the "hard sciences" article). It just happens that as much as the Wikipedia foundation is supposedly for verification, a lot of articles (I wouldn't guess the ratio of science/engineering to historic) don't include any citations."

      The frequency (or lack thereof) of citations within the Wikipedia is not the problem I am complaining about. It certainly is a problem if/when it occurs, but really has nothing to do with people using the Wikipedia as if it were a primary or secondary source.

      "How, btw, do you know what's generally more accurate, or do you assume that "more edits" equals "more fixes" as well? Out of curiosity, do you mean more accurate as in a lower standard deviation in change, as the term accurate is general understood in science?"

      I'm not basing that statement on any sort of quantifiable data, but rather on the empirical observations of many users (myself included).

      "I'm not sure I quite get that. Encyclopedias/Wikipedia are there to provide a very cursory reference source, as a jumping off point to find more information. But, encyclopedias are unsuitable as a citable source, so you shouldn't ever reference them because to do so would qualify them as an authority of even the smallest nature. Or are you willing to understand that /. entries that include references to Wikipedia articles provide them as a tertiarty source beside the real "meat" of the entry and should only be used as a jumping off point? Ie, why is it alright for anyone to every reference the use of an encyclopedia? It seems they shouldn't exist (or if they did, that no one should tell anyone about them because they're unworthy of being referenced as any type of authority)."

      Um, no. I never said they cannot be used, or even referenced in casual contexts (like when you are talking to a friend about something you learned about the behavior of cockroaches from the Wikipedia). However, when writing a paper, book, article, or other such work (and yes, I would place articles for slashdot in that category), sources should be limited to primary and secondary sources. Not only does using tertiary sources undercut your authority on the subject by exposing your knowledge on it to be shallow at best, it really is quite pointless. Any reader could easily look up the subject in the Wikipedia on their own; your link did nothing for them.

      "I mean, if your teacher every said "look in the encyclopedia", that's a citation."

      No its not. You really do need a better dictionary.

      citation -noun, "the act of citing or quoting a reference to an authority or a precedent."
      cite -verb, "to mention in support, proof, or confirmation; refer to as an example: He cited many instances of abuse of power."

      "Good thing you didn't try to cite it."

      I don't get it, was that an attempt at sarcasm? Do you want a full MLA citation? Or would you prefer APA?

      --
      Mathematics is made of 50 percent formulas, 50 percent proofs, and 50 percent imagination.
  17. True but needs a little refining by Flying+pig · · Score: 2, Insightful
    This is absolutely true provided that oil is not needed to fuel the processing. Currently, for instance, ethanol production in the US requires a very significant input of oil. Therefore, while demand for energy is increasing, satisfying some of that demand with ethanol will only at best reduce the slope of the release curve.

    This ceases to be true when biofuels become totally self sufficient. This means that fertiliser plants, the plants that manufacture everything used in the biofuel production cycle, storage etc., are all being entirely fuelled by their own product.

    For this reason, for many years to come, biodiesel has to be the preferred route. This is because the huge installed base of plant can mostly run on it; you can do process heating with biodiesel as well as run generators, trucks and ships. You can, as it were, bootstrap the biodiesel economy, whereas you cannot bootstrap the ethanol or hydrogen economies. Steel plants and machine shops cannot run on either.

    Hydrogen is attractive to the vehicle industry not because it is efficient but because it requires replacement of the entire vehicle fleet and would provide a boost to the industry. Biodiesel allows the existing fleet to be replaced much more slowly, with the same emissions benefits.

    One of the simplest ways to reduce anthropogenic global warming is just to use less energy. One of the best ways to do that is to make consumer durables last longer, and make them out of readily recyclable materials. But that threatens the entire basis of the US-Chinese industrial complex, whereas hydrogen offers it greatly increased opportunities to expand.

    --
    Pining for the fjords
  18. Can you get enough sun light and CO2? by cyfer2000 · · Score: 2

    Can you get enough sun light and CO2 in your backyard?

    Assuming you have 10 square meters yard, the sun shine's energy input is 1000W per square meter, you get 10 hours of sun shine per day, then you have 100,000Wh energy input. Assume 10% photosynthesis energy convert efficiency (this assumption is too high, 1%-5% is better but for the ease of calculation, I will use 10%), you will get 10,000Wh energy into hydrogen, that's 36MJ.

    One kilogram of hydrogen has 143MJ of energy. Then to produce 1kg of hydrogen, you will need 40 sqare meters of yard, to produce 4 kg of hydrogen, you will need 160 square meters of yard, that's 1700 sqare feet. Remember we are assuming 1000W sun light input and 10% conversion here, both are too high.

    I don't think we need to calculate the CO2 input now.

    --
    There is a spark in every single flame bait point.
    1. Re:Can you get enough sun light and CO2? by famebait · · Score: 1

      I don't think we need to calculate the CO2 input now

      I know this was your point, and I agree, but just a few minor comments:

      Translate "yard" to "rooftop or other available area", and suddenly 40m2 isn't that much of a deal.
      in addition, as with solar cells, the best efficiency is obtained when angling the surface at a right angle to the incoming light (or an unmoving angle that optimizes that angle for the best-yield hours of the day).
      Unless you are near the equator, the footprint on the ground can be significantly lower than the effective area.

      --
      sudo ergo sum
    2. Re:Can you get enough sun light and CO2? by SatanicPuppy · · Score: 1

      Yea, that's pretty much what I was thinking. Hell, using clear plastic piping, and a small pump, you could circulate masses of the stuff (gently, I'd imagine) through an array of tubes (much like the internet) that could be set up on any kind of flat surface...Much the same as a big solar water heater. Put a T bend every now and then to pull the hydrogen out, and you're good to go.

      Smarter people than me will work out the ideal deployments, but it's silly to think in terms of 2 dimensional space when we live in a 3 dimensional world.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
    3. Re:Can you get enough sun light and CO2? by SatanicPuppy · · Score: 1

      The first time I ever saw a solar water heater it was about the most ghetto thing imaginable...Everything bought from some seedy garden supply store, and put together crudely. Attached to a big old non-functional water heater wrapped in about a dozen layers of insulation.

      Whenever you walked past it, you were expected to give it a nudge in the direction of the sun.

      That damn thing produced a full tank of hot water, even on a day with only partial sun. It's a powerful and efficient technology.

      --
      ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
  19. Good story in National Geographic this month by cgrayson · · Score: 1
    Titled Green Dreams, it discusses biofuels from all different sources: corn in the US, sugarcane in South America, and the possible future miracle of algae.

    While each acre of corn produces around 300 gallons (1,135 liters) of ethanol a year and an acre of soybeans around 60 gallons (227 liters) of biodiesel, each acre of algae theoretically can churn out more than 5,000 gallons (19,000 liters) of biofuel each year.
  20. Omits depth of shit considerations by Flying+pig · · Score: 2, Insightful
    The downside of the horse is that it is unsuited to high density urban environments. Not without reason is the horseman a symbol of the aristocracy. If New York or London had the same horse population as they currently have cars, nothing would move because of the height of the horse dung (and no technical solution to removing it without powered transport.) Even in 18th century England, there was a profitable occupation in large cities of "crossing-sweeper", i.e. somebody who cleaned the dung off a section across roads and charged pedestrians for the right to cross.

    That's without considering that the entire planet would be given over to growing grass. Unlike cars, horses consume a lot of fuel even when going nowhere. You have to be quite well off to be an Amish.

    --
    Pining for the fjords
    1. Re:Omits depth of shit considerations by Chemisor · · Score: 1

      > nothing would move because of the height of the horse dung (and no technical
      > solution to removing it without powered transport.)

      Just as cars can be powered by horses, so can the vehicles of the dung sweepers. Horseshit is a valuable fertilizer for the agricultural industry. I am sure someone can make a profit collecting it and selling it. It won't be much, but hey, the shit is free, so there has to be some money there.

      > If New York or London had the same horse population as they currently have cars

      That is the next problem to tackle; we don't really need Manhattan. In the days of the internet, it is absolutely unnecessary to aggregate thousands of people into a high-rise building just so that they could come there in the morning and go home in the afternoon.

      > That's without considering that the entire planet would be given over to growing grass.

      We already do. And then we waste gasoline on mowing it.

    2. Re:Omits depth of shit considerations by ChrisMaple · · Score: 1

      On a hot, sunny, windy day, horse droppings dry quickly and become airborne. The result is an ugly, stinky mess spreading disease and filth everywhere. It has been pointed out previously that cities are more energy-efficient than rural and suburban areas, so if cities have to be depleted to accomodate horses, the country's net energy use might rise.

      --
      Contribute to civilization: ari.aynrand.org/donate
  21. Great idea but theres a problem ..... by shmack · · Score: 1

    I think its a great idea that people are trying to find new ways to power their cars, and heck if using hydrogen would work and it would be cheap, I'm all up for it. Seriously who right now is not angry with the amount of money we spend on gas. With $2.80 for the equivalent of a gallon, i think a lot of people would actually be happy The problem though would come with moving from gasoline powered cars to hydrogen. I believe that the oil industry would try as hard as possible to prevent it from happening, and how many car companies out there would actually take the risk of try a new technology which could quite possible not last. I think its a great idea, but it's still going to be a very long time before any new form of power replaces oil.

  22. wouldn't this help pig farms? by jollyreaper · · Score: 1

    They're supposed to be one of the worst manure polluters around. Right now, the pig shit is just waste matter. If they could use this as feedstock for the algae ponds, suddenly it has a monetary value. This could be a good thing, environmentally speaking.

    --
    Kwisatz Haderach
    Sell the spice to CHOAM
    This Mahdi took Shaddam's Throne
  23. Isn't Slashdot wonderful? by ScrewMaster · · Score: 1

    Where else can you wake up on a Saturday morning and read an article about mutant algae fuels.

    --
    The higher the technology, the sharper that two-edged sword.
  24. Why Hydrogen at all? by CCTalbert · · Score: 1

    I'm sorry, I just don't buy into the whole "Hydrogen is Cool/The Answer/Better" story. It's simply not very convenient, if nothing else; high pressure is energy intensive and has some safety issues, cryo is energy intensive and opens up a whole other can of worms. IF you can get bio-diesel out of algae (or anything for that matter) I think it's a much better use of the little critters.

    Bio-diesel is carbon neutral, so it's as green as we can ask for; easy to transport and store (even uses the existing infrastructure) , relatively safe to handle, and requires virtually no new technology to implement. It's dense, to, which I think is worth noting- pressure tanks or cryo need more space, and that can be at a premium in a small vehicle. It doesn't have to obsolete *every* vehicle on the road. If I spill some in my driveway (or even my living room for that matter) it's just No Big Deal. If someone rear-ends you at a stoplight, ruptures your tank, and your bio-diesel runs out on the ground, again it's pretty much NBD. (Happens every day. Sometimes it ends badly, but even with gasoline it's rather rare to have a fire.)

    The technology of fuel cells is cool, I'll give you that, but what good does it actually do me or the environment? I can't keep a can of hydrogen in my garage and fill my garden tractor with it!

    Now, what I'd really like is a nice mid-size car, a diesel hybrid. Like maybe a Jetta, with a little help in the trunk from some of those spiffy new cells that A123 Systems makes. Just my preference. And I'd like a little smart-car sized electric for my local trips.

    I think our easiest and most useful gains can be from hybrid (or pure electric) vehicles with the batteries that are finally becoming available now. Lead acid just wasn't there, NiCad wasn't quite there either; Ni-MH pretty much there for most use, and now these Lithium Ion cells seem to be there. Depending on where you set the bar for energy density, safety, etc., I think most would agree if it hasn't been passed we're *really* close.

    And if nothing else, if our President is touting a Hydrogen economy, you know it's gotta be a farce! :)

    1. Re:Why Hydrogen at all? by famebait · · Score: 1

      I'm sorry,
      It's OK.
      I just don't buy into the whole "Hydrogen is Cool/The Answer/Better" story. It's simply not very convenient, if nothing else; high pressure is energy intensive and has some safety issues, cryo is energy intensive and opens up a whole other can of worms.

      Ah, you havn't been following. Suffice to say none of these are among the generally suggested ways of keeping hydrogen in a car. Go do your homework.

      IF you can get bio-diesel out of algae (or anything for that matter) I think it's a much better use of the little critters.

      Now that actually has some merit.

      --
      sudo ergo sum
    2. Re:Why Hydrogen at all? by IhuntCIA · · Score: 1

      good point.
      More details about Hydrogen vs Bio-disel here http://www.unh.edu/p2/biodiesel/article_alge.html

    3. Re:Why Hydrogen at all? by Rob+Simpson · · Score: 1

      Agreed. The only benefit of hydrogen that I can see is that, if you had a limitless supply of electricity, you could make a limitless supply of fuel cleanly from water. But electrolysis takes far too much energy to be practical in real life. That said, fuel cells using methanol or whatever would be great for a laptop battery. And probably less likely to explode. :)

  25. Some math shows that this could really work. by tjstork · · Score: 1

    Given 35kg of hydrogen per acre, and that

    http://www.technologyreview.com/BizTech-R&D/wtr_16523,295,p1.html?a=f

    says that a fuel cell car needs about 5kg per fill up of 350 miles, we're looking at roughly 1750 car miles per acre per day, or, about 640,000 miles per acre year, assuming that you can grow algae year round.

    Assuming that the USA has 240 million drivers , driving on average, 11,000 miles per year (wikipedia), then, we're talking about a demand for about a little over 4 million acres of algae. So, this could actually work, and work a lot better than ethanol.

    Even a 10% hydrogen conversion efficiency would require only 20 million acres of land, and that's considerably less than the several hundred million acres (more than the area of the USA, to grow enough corn to make ethanol with for fuel).

    --
    This is my sig.
  26. solar Walmart roof... to solar parking lots by Gary+W.+Longsine · · Score: 1

    Maybe it would be better to come up with a solar system that could be deployed in parking lots. I've thought about the Walmart roof scenario, too, but it seems like roofs are a problematic place for solar installations. Most roofs are somewhat fragile, and are not really designed to sustain much human activity, aside from repairing the roof. Flat roofs are particularly problematic in this sense. Furthermore, most roofs are not really designed to support much more weight than they already do (limited air conditioning equipment and expected maximum snow load). Roofs are also different in important structural ways, so even if these problems could be overcome for one building design, it wouldn't be reusable to other types of building roofs. So if you started with Walmart, you might not be able to easily equip all the Best Buy stores without a redesign.

    Parking lots, on the other hand, are almost ideal places to install solar systems. You can bury stuff, suspend stuff in the air, re-arrange stuff. Even if it was a Walmart-only project, the parking lots are also larger than the roof.

    In the It would be interesting to see an engineering class study this idea of rooftop or parking lot solar installations, in a coordinated approach like that used by Gerard O'Neill when his physics classes pondered space habitats and solar power satellites. There would be all manner of interesting possible side effects to study in such a project.

    For example, there might be benefits unrelated to the power production. Suburban office buildings (which are generally surrounded by enormous parking lots) might generate enough power to meet their needs, which is an unlikely outcome for solar power rooftop installations. The installations would shade the cars, too, during the day when they tend to be in parking lots rather than in garages. This would extend the life of fragile car interior parts which degrade with UV exposure, possibly extending the life of the car. Proper design of these installations and large scale deployment might help reduce the heat island effect, although there are other ways to do this, such as pervious concrete and allocating more space for trees and shade in city designs, solar installations in parking lots could be easily retrofitted without restructuring the already-deployed land use allocation.

    --
    If you mod me down, I shall become more powerful than you could possibly imagine.
  27. I don't know... by SatanicPuppy · · Score: 1

    "Farm lads gone wild"
    "Naked Farm lad algae wrestling"
    "You're not the usual algae delivery boy"

    The economic possibilities of farm lads are nothing to sneeze at.

    --
    ad logicam Claiming a proposition is false because it was presented as the conclusion of a fallacious argument.
  28. I'm tired of the conspiracy theories! by HexaByte · · Score: 1
    "The problem though would come with moving from gasoline powered cars to hydrogen. I believe that the oil industry would try as hard as possible to prevent it from happening,..."

    There's too many comments like that on Slashdot every time a disruptive technology is discussed. True, big companies have a large investment in the status quo, but it's stockholders that have invested and want a return on the dollar. Also, who's best to convert existing facilities into the new distribution centers for the new fuels? In my neck of the woods, there are damn few corners without a gas station on them already.

    Where does the money come from to develop new technologies? Investors! They don't care who they invest with, so long as they believe they will get an equitable return on their investment. People want to make money, and if takes investing in HydroAlgeeCo Fuels (TM) or Exxon Mobil, they'll do it.

    Just look at the Web as an example. Lots of guys come up w/ better ideas, and if the big guys can offer "good enough" for free (think IE vs. Netscape), people will take it. If not, someone either makes a bundle producing a better mousetrap or gets their technology bought up and incorporated into someone else's product (think FoxPro).

    I know a lot of you think that investors in SCO were out to suppress Linux, but for the most part (MS and Sun deals excluded) it was about buying low and selling high. Same goes with big oil. If they see Hydro or Bio getting competitive, they'll get into the game. Heck, I'm suprised the Exxon Mobil hasn't tendered an offer for ADM yet!

    --
    HexaByte - he's a square and a half!
  29. Burn the H2 for heat, biodiesel for the car. by WoTG · · Score: 1

    It's not clear from the summary, but I assume that this algae can still be used for biodiesel. Harvesting both might make the economics work out that much sooner.

    That said, I don't know anything about algae for energy. I just know that I hate seeing the stuff when I'm on a lake (that isn't supposed to have algae).

  30. Chlamydomonas by primenerd · · Score: 3, Interesting

    I work on Chlamydomonas (single celled eukaryotic algae) biochemistry.
    These little fellas are tough. Give them a few basic nutrients (phosphates, trace minerals) sunlight and air and they will grow like weeds. They can be autotrophic (using light) or heterotrophic if you give them a carbon source (like those found in sewage and agricultural waste). People have also had great success growing these by bubbling the exhaust from incinerators through liquid cultures (exhaust is rich in CO2 and NOx which Chlamy can use). Chlamy has been extensively studied (the genome of C. reinhardtii has been sequenced) and there is a huge library of mutants already available. I saw a presentation at an algae conference last year by people working on this. Holy grail is getting hydrogen while they are growing, then extract oil.
    Best of all, they are completely harmless (trust me, if they were in any way dangerous I would be dead by now).
    Algal biodiesel and butanol from agricultural waste are our best hope. Ethanol from food crops is basically a big give-away to agribusiness companies. While hydrogen is promising, biologically derived liquid hydrocarbons can take advantage of the extensive infrastructure that has been built for petroleum fuels.

    --
    AUGAUUUGCGCACAUAUCUCAGCGAAUGAAAGGGAUUAA
  31. Price of fuel $2.80 non-competitive by ravenshrike · · Score: 1

    No it wouldn't, simply because the moment we switch to hydrogen as a primary fuel source the taxes(currently $.32 of every dollar in my state) will be leveed on the hydrogen. Thus making it just as expensive.

  32. Really helping the environment? by das_magpie · · Score: 1

    This article fails to outline some of the effects this might have on the environment, if any at all. Can this algae spread out of control and produce tons of hydrogen a day worldwide? From my understanding of algae I have seen once its on the move its not easy to cancel.

    1. Re:Really helping the environment? by Mspangler · · Score: 1

      "Can this algae spread out of control and produce tons of hydrogen a day worldwide?"

      Now there's a Sci-fi story.

      Mutant algae escapes to the wild, grows out of control. Oxygen level in Earth's atmosphere rises to 30%, causing huge out of control fires everywhere*. In the mean time, ocean levels start to drop as the hydrogen is being lost to space. Chaos everywhere.

      * a standard problem in a college class in pyrometallurgy was to calculate the equilibrium temperature of a furnace at 21, 25, and 30 % oxygen in the combustion air. It makes a huge difference, mostly because you have less nitrogen carrying off the heat.

    2. Re:Really helping the environment? by das_magpie · · Score: 1

      Yup a bit like if you went back to the early 20th century and told people that human society would turn into an incredibly material one controlled and influenced by huge monopoly's ran my single minded greedy morons that would encourage the burning of fossil fuels so mothers can drive overs sized four wheels drives to the supermarket and rape the earth of every natural resource on such a massive scale the morons with no one stopping them and fueled by ignorance and the love of money are threating life on earth as we know it.

      That to me sounds like a good idea for a horror movie to me!

      Off topic but I had to do it :)

  33. Reducing number of vehicles & rebuilding citie by tashammer · · Score: 1

    On the surface the use of algae-derived fuels sounds good, as does the use of sugar beet, corn etc. The trouble is that lots of things considered on their own in isolation from the "real world" sound good. But these are all "small is beautiful" types of fuels NOT the massive fuel supplies we currently use and increasingly use. Energy sources need to be based upon Fuels of Mass Transportation (FMT) rather than Fuels of Individual TRansportation (FIT). If the fuel demand is needs driven then how about we reduce the demand by reducing the needs? How? By designing cities and towns and villages that have good public transport systems, effective and efficient light/cooling/heating systems; that are designed with the individual person and family in mind but are planned from the outside in. (Remember that the way we build cities these days is the same as it was 3000 years ago, by accretion). Ideas and attitudes about mass production may need to change from assembly line to other forms, e.g. Volvo worker producing a whole car rather than just putting on the wheel nuts 8hrs a day. The same with Mercedes and their new Smart car. Check out Japan's methods where lots of production is done as cottage industry. We also need to forever keep in mind that massive volumes of fuel need massive areas of land - ours or theirs? Are more jungles denuded just so someone can drive a heavy fuel guzzler 4x4 around the 'burbs? How come Seaguways (?) haven't taken off yet? Could it be that folks don't fancy competing with a massive semi-trailer (you might call them prime movers) on the freeway? Maybe we need to use stem cells to raise critters whose waste can be dumped straight into the fuel tank?

  34. Geological? by rgaginol · · Score: 1

    Fossil fuels are the leftover oils from decaying plant and animal matter which hasn't been returned to the regular carbon cycle. To my knowledge, there is no geological process which can create even a single molecule of oil. There's a reason why Carbon chemistry is called the chemistry of life. So... when life first started on earth, there were no oil reserves or coal deposits, they all came from millions and millions of plants and animals dying and getting trapped under the earth. Kind of makes you feel small and insignificant to think how much effort created these fuels under the ground. I'm not saying it's a good thing to be changing the earth so much by putting all these carbon reserves back in the atmosphere, especially in such a small time frame, but it's worth remembering where the carbon originally came from.

    1. Re:Geological? by RsG · · Score: 1

      "Sequestered by geological processes" does not mean "generated geologically". I think you misunderstood my point - the carbon present in fossil fuels has been sequestered as a result of geological processes burying plant and animal matter for a long enough time to allow fossil fuels to form. The "geological process" involved isn't the same as the biological process that bound the carbon up in the first place.

      --
      Erotic is when you use a feather. Exotic is when you use the whole chicken.
  35. However effective it might be... by petrus4 · · Score: 1

    ...it will be killed by big oil before we're ever allowed to see it.

    The only time the petroleum industry is going to allow hydrogen as a viable fuel source to exist is if a) oil becomes sufficiently rare that it causes societal collapse, and b) said industry can entirely control hydrogen production and continue to make the same kinds of usurious profits from it that they have customarily made from oil.

  36. x86 will be around for a long time? by Joseph_Daniel_Zukige · · Score: 1

    No reason to ditch it?

    Then why did AMD go to sixteen registers in the 64 bit CPUs?

  37. fuel for home instead? by Joseph_Daniel_Zukige · · Score: 1

    replacement for natural gas, for heating, and maybe for fueling generators?

  38. I just want a plug-in electric... by csoto · · Score: 1

    or plug-in electric hybrid. If I could get one that I can transport the kids, wife and me, I'd buy it and put a solar cell on top of my house. Problem solved.

    --
    There exists no way of exchanging information without making judgments. --Bene Gesserit Axiom
  39. Ice-nine by Gary+W.+Longsine · · Score: 1

    Creating algae that crack water at a high rate seems like a bad idea. When they inevitably escape the "perfectly safe" industrial algae farm facility and become established in the general environment, the hydrogen and oxygen will be released into the atmosphere. Hydrogen tends to escape planetary bodies over time. Not exactly ice-nine but if you think human caused global warming is an issue, human caused global drying would be pretty annoying, too. On the bright side, it would probably take longer.

    --
    If you mod me down, I shall become more powerful than you could possibly imagine.
    1. Re:Ice-nine by famebait · · Score: 1

      I feel quite confident that they would lose the competition against more energy-efficient natural organisms. You know, the ones who use their captured energy to make sugar for their own ends, rather than throwing out high-grade fuel for free.

      Probably more of a challenge to shield our crippled 'noble' algae from savage warriors from the outside. I can just picture how Monsanto saves the day in the middle of the mysterious algae-blight of 2024. Maybe better to base it on something exotic in the first place. Take some dead-sea bacteria and implant the H2 thing in them, then you can use salt in stead of roundup.

      --
      sudo ergo sum