Slashdot Mirror


Encyclopedia of Life Launches First 30,000 Pages

An anonymous reader writes to let us know that the Encyclopedia of Life opened up to the public today with its first 30,000 pages in place — and, according to the AP, promptly crumbled even before being Slashdotted. (The site seems fine now.) We discussed this project last year when it was announced. The Telegraph has an overview of the launch, and reports that only 25 "exemplar" pages on the site are fully fleshed out to the extent scientists hope eventually to attain for all species; the other few tens of thousands are expanded placeholders. The project hopes to begin taking input from citizen-scientists late this year.

87 comments

  1. 30000 pages... by joaommp · · Score: 3, Interesting

    now that's going to take a long time to fill...

    I can see it now, like in wikipedia... about 1/10 of the articles are stubs... they mark it as stubs and no one ever remembers to fill them. I would fill them, problem is, I only found the stubs because I was actually searching for that information... not because I had it.

    1. Re:30000 pages... by cheater512 · · Score: 1

      There are convenient automatically generated pages of lists of stubs.
      Find a stub and look at the categories its in.

    2. Re:30000 pages... by Brian+Gordon · · Score: 1

      I love how they cite wikipedia as a source, even though it's an encyclopedia. Didn't they go to elementary school? Also the oblig. eye-roll at the term "electronic article" ~~~~

    3. Re:30000 pages... by joaommp · · Score: 1

      I'm not citing wikipedia as a source. I was performing a comparison.

    4. Re:30000 pages... by Anonymous Coward · · Score: 0

      A metaphor requires a source?

    5. Re:30000 pages... by Impy+the+Impiuos+Imp · · Score: 1

      Well, the "citizen scientists" have already created pages for Superman, Wolverine, and Magneto.

      --
      (-1: Post disagrees with my already-settled worldview) is not a valid mod option.
    6. Re:30000 pages... by Quixadhal · · Score: 1

      Yeah, I predict it will start filling faster when Spore is released in September.

  2. Dupe? by Wolfbone · · Score: 2, Insightful

    Not the story - the project. What I mean is: how is this new project related to this one: http://tolweb.org/ if at all?

    1. Re:Dupe? by banana+fiend · · Score: 5, Informative

      They are separate projects, with TOL being less well funded basically, and smaller in scope. I believe that TOL have shared their data with EOL.

      --
      Johns: Well, how does it look now? Riddick: Looks clear.
    2. Re:Dupe? by QuantumG · · Score: 1

      tolweb seems to have lots of high level categories but no actual species.

      --
      How we know is more important than what we know.
    3. Re:Dupe? by ajcham · · Score: 1

      And what about Wikispecies?

    4. Re:Dupe? by esocid · · Score: 1

      From this page here at ToL, you can see that there is a collaboration between efforts as to not overlap in data. It also states that the goals of each are slightly different in that EOL focuses more on specific species, whereas the ToL is more about phylogenetic classifications and evolutionary branches.
      I've been looking into the National Science Foundation's AToL program recently because of an offer for grad school which is due to a grant from that specific program and I'm curious what, if any, connection there is between the two.

      --
      Absolute power corrupts absolutely. indymedia
    5. Re:Dupe? by esocid · · Score: 4, Informative

      Let's try that again with the link this time.
      From this page here at ToL, you can see that there is a collaboration between efforts as to not overlap in data. It also states that the goals of each are slightly different in that EOL focuses more on specific species, whereas the ToL is more about phylogenetic classifications and evolutionary branches. I've been looking into the National Science Foundation's AToL program recently because of an offer for grad school which is due to a grant from that specific program and I'm curious what, if any, connection there is between the two.

      --
      Absolute power corrupts absolutely. indymedia
    6. Re:Dupe? by BembsRule · · Score: 1

      The goals and much of the structure of the Tree of Life Web Project (http://tolweb.org) were exactly the same as the EOL. It isn't intended to be smaller in scope, and it also contains a large number of species pages. The core content of both projects is contributed by the community of experts on each group of organism; it is thus hierarchically-coordinated (to match the shape of the Tree). There are many other similarities. In fact, as the EOL was first being proposed, the community of systematic biologists was concerned about the obvious duplication. The major differences are age (the ToL started in 1995) and resources (the EOL has vastly more funds and buy-in by many corporations/foundations outside of academia). And with the millions of dollars the EOL now has, they are planning additional content the ToL could have only dreamed of.

      Because they share the same basic goals, I'm enthusiastic about the EOL, and the community of biologists who are behind the ToL (including me) have agreed to redefine the scope of the ToL to primarily focus on information about groups of species, rather than individual species; the ToL will display species pages, but the primary effort to create the content for species will be via the EOL. The EOL, in turn, has agreed to focus on species, and will harvest information from the ToL and other sites about groups of species. So the bottom line is: the two projects were effectively identical in goals, but have been redefined to be complementary.

        (I'm coordinator/editor/founder of the Tree of Life Web Project.)

    7. Re:Dupe? by Wolfbone · · Score: 1

      Thank you :)

    8. Re:Dupe? by rozz · · Score: 1

      pretty lame that one of the most informative posts didnt get any modpoints.

      and an opinion from an IT guy with no special biology skills - at this stage, tol is A LOT better than eol... polished layout, beautiful media materials and *very* well structured... in fact, i would have a hard time finding any flaws.
      on the other hand, in spite of the great funding that u mentioned eol is just an ugly pile of stuff, thrown together in the worst possible way ... not so much stuff either ... and on top of that, the technical side is a disaster - the portal seems to be badly missconfigured and it's awfully slow ... kind of hard to find *any* positive aspect.
        "surprisingly", money can buy u neither wisdom nor good taste.

      anyway ... congrats and many thx for your effort ... and good luck!

      --
      "There is nothing more frightful than ignorance in action." Johann Wolfgang von Goethe
    9. Re:Dupe? by BembsRule · · Score: 1

      Thanks very much, rozz, for your kind words about the ToL.

      My hope is that EOL will get their act together, and I am helping out as I can. Whether their bureaucracy will allow them to do great things is not yet clear. I worry sometimes that they would be more successful with $1M than $25M+. Sometimes lots of money has a tendency to create more infrastructure than structure. (The ToL's total budget for the entire first 5 years was $16,000. During that time my brother and I were the programmers, and we had a single graduate student assistant, and that was it. At most we have had two full-time employees, which is what we have now. Most of the work, after all, is done by the biologists out there.)

    10. Re:Dupe? by rozz · · Score: 1

      I worry sometimes that they would be more successful with $1M than $25M+. Sometimes lots of money has a tendency to create more infrastructure than structure.

      at lest from my experience, starting with that kind of money is *always* bad.
      in the end, most of those projects manage to get their act together but an awful lot of money gets wasted in bureaucracy... all the luck for you and them, you really need it.

      (The ToL's total budget for the entire first 5 years was $16,000. During that time my brother and I were the programmers, and we had a single graduate student assistant, and that was it. At most we have had two full-time employees, which is what we have now. Most of the work, after all, is done by the biologists out there.) wow! ... my very quick estimation for your budget was 50-100K/year .. you ppl did a truly amazing work for that kind of money .. at the very least, i gotta double my congrats and thanks ;)
      --
      "There is nothing more frightful than ignorance in action." Johann Wolfgang von Goethe
  3. 180? by Max+Romantschuk · · Score: 1

    Am I the only one not seeing anything else except for the demo-stuff there from way back? Where are these fabled articles? Link, anyone?

    --
    .: Max Romantschuk :: http://max.romantschuk.fi/
    1. Re:180? by llirik · · Score: 5, Informative

      Try http://eol.org/ not http://www.eol.org/. Yeah, how dumb is that? Could be a bug in their firefox support though.

    2. Re:180? by Max+Romantschuk · · Score: 1

      Ah, thanks. Seems Slashdotted or something here, though... Go figure. ;)

      --
      .: Max Romantschuk :: http://max.romantschuk.fi/
    3. Re:180? by onlau · · Score: 1
      Well when I try http://eol.org/ I get...

      The proxy server could not handle the request GET /.
    4. Re:180? by exploder · · Score: 1

      I was trying to load this thing all day yesterday, but it was too busy. And today it's on Slashdot...dammit!

      --
      Yo dawg, I heard you like the Ackermann function, so OH GOD OH GOD OH GOD
  4. ONLY 30000? by polar+red · · Score: 3, Interesting

    Only 30000?
    There are Tens of millions of different species on earth - Flowering plants ALONE are numbering 250000!
    there is another similar project called tree of life

    --
    Yes, I'm left. You have a problem with that?
    1. Re:ONLY 30000? by rucs_hack · · Score: 2, Interesting

      Well, I can cover several tens of millions of those species in one sentence:

      GGCAGGGGTCTATGGTGGCAGGAAGCTTGGCGTGCTAGAGGGTTGTGGTTGGGC

      Specifically, a Core Promoter as shared by almost all Eukaryotes.

      Where each species differs by one or two characters. I guess you could work it out in terms of Hamming Distance..

    2. Re:ONLY 30000? by Anonymous Coward · · Score: 0

      An anonymous reader writes to let us know that the Encyclopedia of Life opened up to the public today with its first 30,000 pages in place
  5. an unfortunate domainname by wereHamster · · Score: 4, Funny

    eol.org, all I can see in it is 'end of life'

    1. Re:an unfortunate domainname by traveller.ct · · Score: 5, Funny

      For a moment I actually read that as "end of line".org. Maybe I should go get a life?

      --
      For the lack of a better sig.
  6. Welcome to the future of information by Anonymous Coward · · Score: 0
    A splash page image whose entry link lacks ALT text for disabled users.

    These scientists couldn't find a web developer then, eh? Or should I take it to mean then that these scientists are trying to create uneducated disabled workers who won't be able to tell a $5 dollar note from a $20?

    Good plan.

  7. The Telegraph has an overview of the launch.... by Anonymous Coward · · Score: 0

    .... which should now be updated to be an overview of it's on-line demise due to slashdot!!!

  8. Download and license by oever · · Score: 5, Interesting

    So where can we download this data and what is the license?

    The data from tolweb.org are downloadable under a Creative Commons license.

    --
    DNA is the ultimate spaghetti code.
  9. Re:Wikipedia, anyone? by Rakshasa+Taisab · · Score: 4, Funny

    Wouldn't it be better if citizen-scientists concentrated in improving and expanding wikipedia articles on animals? Because the elephant population has, in fact, _NOT_ tripled the past few years.
    --
    - These characters were randomly selected.
  10. Re:Wikipedia, anyone? by Schiphol · · Score: 1

    Actually, the Wikipedia entry for "elephant" is a good example of the great work already done. Anyway.

  11. Re:Wikipedia, anyone? by owlnation · · Score: 2, Insightful

    Because the elephant population has, in fact, _NOT_ tripled the past few years.
    Exactly, and in all seriousness there is so much sleaze, agenda-ism, corruption and mismanagement in Wikipedia (already well documented, and proven here), that it is far better to start a new project that has a chance of not making the same mistakes. One that has a chance of maintaining a good reputation and high standards, something Wikipedia has completely failed to do.

    This project sounds like a great idea -- and if nothing else it is ALWAYS good to have competition.
  12. Scary!! by muffen · · Score: 1

    The "Encyclopedia of Life" went off-line even before it was slashdotted, this must be one of the signs for the end of the world!

  13. Great effort by Psychotria · · Score: 4, Insightful

    My love of the "natural" sciences is not something I hide. My respect for E.O.Wilson is also something I do not hide. Wilson frequently mentions his wish for this project to become true, and I can understand his reasons for doing so. Wilson, I admit, is not without critics (but who of us are?). I only mention Wilson because this is a project he has often spoken of. Despite varying opinions on him, he DOES believe in biological information (and, yes, probably data) for the masses. Not to mention that he has a writing style to die for...

    Anyway, back on topic. This project is grand in its scope and bold in its objectives. Whether it fails or succeeds is beside the point really... the project is a challenge to all of science and is quite like open-source software. The more shoulders (of giants) we can sit on, the better the end result will be.

    Great project. Worthwhile project. I take my hat off to all involved. Thank-you.

  14. Re:Elitest Wikipedia? by wonnage · · Score: 4, Informative

    Way to beat on that straw-man... Besides, if you bothered to read the article: "There are also tens of thousands of additional species pages not authenticated by scientists but still containing a wealth of information. Later this year the public will be able to contribute text, videos, images, and other information about a species and the best of it will be incorporated into the authenticated pages." By the way, it's spelled "elitist".

  15. Badly designed... by red+star+hardkore · · Score: 5, Informative

    It's slow, only has demonstration pages and is extremely badly designed.

    As somebody has already mentioned, images don't have alt tags, but also there are tables used for layout (with many empty rows/cols for no apparent reason) and there are image maps. The site uses an XHTML doctype, but isn't valid XHTML. There are missing slashes for closing single tags. The divs for the popups are contained outside the body tags, that's NOT ALLOWED!

    That's all I see, what about anybody else?

    1. Re:Badly designed... by sjaguar · · Score: 2, Informative

      Yeah, since everything is an image, it is a PITA to copy (quote) text. And, with a 30 second+ load time, it is unusable.

      --
      If at first you don't succeed, call it version 1.0.
    2. Re:Badly designed... by Anonymous Coward · · Score: 1, Insightful

      what do you expect from academia? biologists?

      I mean, there are computer scientists who can't program....

    3. Re:Badly designed... by Psychotria · · Score: 4, Insightful

      You're correct of course. But look beyond the HTML/XHTML... This project isn't about that, it's about sharing of biological information and data.

      That's all I see, what about anybody else?

      Well, actually, I see much more. I see a project that seeks to gather every single scrap of data or information about every single taxon on Earth; a database of LIFE, of everything that we know about organisms that share this planet with us. At this point I can gloss over the malformed pages etc etc... that will sort itself out in time. The important thing is that the information and data is available.

    4. Re:Badly designed... by Stooshie · · Score: 2, Informative

      If you look at the site they are currently looking for programmers to work with them.

      --
      America, Home of the Brave. ... .and the Squaw.
    5. Re:Badly designed... by ortholattice · · Score: 1

      Also, it would be nice if the page width adjusted to the browser width instead of forcing you to use full screen on a 1280x1024 monitor. Since I don't normally browse in full-screen mode, for me it's endless horizontal scrolling. I can't imagine using this on a regular basis. Maybe they should just copy Wikipedia's template - which has been fine-tuned over time for user experience - instead of trying to re-invent the wheel.

    6. Re:Badly designed... by Anonymous Coward · · Score: 1, Funny

      I see...
      NERD RAAAAAGE!

    7. Re:Badly designed... by juhaz · · Score: 3, Insightful

      You're correct of course. But look beyond the HTML/XHTML... This project isn't about that, it's about sharing of biological information and data. If someone criticized building a skyscraper on mud would you dismiss them as irrelevant and tell it isn't about that, it's about building the tallest building in the world?

      You can't "look beyond" the foundations of something. The data is useless if it's so bad it can't be easily worked on, and the information might as well not exist if it's hidden in the bad data.
    8. Re:Badly designed... by red+star+hardkore · · Score: 1

      You wouldn't say that if you were blind and needed a screen reader to use the web.

    9. Re:Badly designed... by Psychotria · · Score: 1

      The data is useless if it's so bad it can't be easily worked on, and the information might as well not exist if it's hidden in the bad data.

      The data is there. You can interpret and present that data (as information) any way you like. The fact that the data is being presented (as information) with silly HTML/XHTML or whatever is irrelevant. The data is not bad. The information might be... (I personally don't think it is, but I'm just going along with what you said). The data is solid, how that data is presented (i.e. information) is possibly a problem. But, hey, you have the data... muck around with it all you like and present it in a better way. That'd be fair. Or, better still, contribute to the project and fix their "foundations" (as you put it... and where I disagree--I would say the foundations are strong, but the building shaky).

    10. Re:Badly designed... by Anonymous Coward · · Score: 0

      inline images.
      Use css image replacement and the hit count drops significantly.

    11. Re:Badly designed... by Anonymous Coward · · Score: 0

      Not to mention those annoying tags that pop up over every button and input field. These pages are currently unusable. 'Tis a pity since this is potentially a very interesting and useul project.

    12. Re:Badly designed... by skyshard · · Score: 1

      http://www.eol.org/ points to their old demo site, it seems (which is why everything is just images, with popups explaining features)

      http://eol.org/ is the correct site, which seems much better. still not valid though

    13. Re:Badly designed... by ThreeGigs · · Score: 1

      I see a whole bunch of potentially useful, detailed and potentially accurate information that won't show up in a Google or Yahoo! search because it's images. I also eventually see that when it is somehow indexed, and if it's #1 on the list and Wikipedia is #2, I see people choosing Wikipedia because it's *more useable*.

      I'm guessing that because of university connect speeds, the time it takes to load a 1 meg page isn't significant. Meanwhile, none of the kids with OLPCs will be using the site.

      Poor execution looks to be hobbling yet another great idea.

    14. Re:Badly designed... by red+star+hardkore · · Score: 1

      http://eol.org/ wouldn't load for me earlier, now it just gives me a 403.

    15. Re:Badly designed... by skyshard · · Score: 1

      meh, i swear it was working earlier.. no idea what's up with it now. maybe it's getting fixed?

    16. Re:Badly designed... by lazy_nihilist · · Score: 1

      Why do that when you can print in big bold letters, 42.

    17. Re:Badly designed... by Anonymous Coward · · Score: 0

      It's called "demonstration pages". It's perfectly fine to use images when you don't want to launch the site. It shows what we can expect, without letting people browse.

      I am 99% certain that they will use normal web pages when they launch

  16. Re:Elitest Wikipedia? by Anonymous Coward · · Score: 0

    How is that not elitist like the GP said? You need to get approval from "the group" before you can contribute.. It's still elitist and I fail to see the strawman.. Elitipedia.

  17. Re:Wikipedia, anyone? by it0 · · Score: 1

    It was on the news recently that they were shooting elephants because their population has grown from 8000 to 20.000 and they have become a nuisance.

    Animal rights activists that shooting them is stupid as that supposedly makes them breed faster?

  18. Re:Elitest Wikipedia? by tepples · · Score: 1

    How is that not elitist like the GP said? You need to get approval from "the group" before you can contribute.. It's still elitist and I fail to see the strawman.. Elitipedia. Sometimes there is room for a Citizendium or a Veropedia compared to Wikipedia, or this project compared to Wikispecies.
  19. eol.org by dwater · · Score: 1

    eol == end of life

    It seems they have the end of their project in sight :)

    --
    Max.
    1. Re:eol.org by Amiralul · · Score: 1

      Pardon me, but eol == end of line

  20. oh, flash-tastic! by dwater · · Score: 5, Insightful

    More flash crap.

    "Oh good, the page has finished loading. Bollocks, there's still some flash left to load."

    Will we ever be free of this crap?
    It's made a sort of 'two-stage' internet - load the html, then load the flash baggage.

    --
    Max.
    1. Re:oh, flash-tastic! by BotnetZombie · · Score: 1

      Firefox/Flashblock to the rescue? Anyway, I agree that it's crap to have to view that flash stuff to see the main content.

    2. Re:oh, flash-tastic! by dwater · · Score: 1

      > Firefox/Flashblock to the rescue? Anyway, I agree that it's crap to have to view that flash stuff to see the main content.

      Well, precisely. Flashblock doesn't help you when there's nothing to see otherwise...

      --
      Max.
    3. Re:oh, flash-tastic! by Rakshasa+Taisab · · Score: 1

      I can't find any flash... Are you sure you're on the right eol.org page?

      --
      - These characters were randomly selected.
    4. Re:oh, flash-tastic! by dwater · · Score: 1

      http://www.eol.org/home.html

      Actually, it's not so much.

      --
      Max.
  21. Re:Wikipedia, anyone? by Anonymous Coward · · Score: 2, Insightful

    sleaze, agenda-ism, corruption and mismanagement in Wikipedia (already well documented, and proven here), that it is far better to start a new project that has a chance of not making the same mistakes. Those are the hallmarks of people. So where are you planning on finding the aliens or AIs to run your new fairy tale project, because that would be only way to start one that will not make them? (not just _chance_, mind you, it's inevitable)
  22. Comment removed by account_deleted · · Score: 1

    Comment removed based on user account deletion

  23. I know of only one... by AnotherUsername · · Score: 1

    Wilson, I admit, is not without critics (but who of us are?). Matt Damon
    --
    I don't like Linux. This doesn't make me a troll.
    1. Re:I know of only one... by owlnation · · Score: 1

      Matt Damon
      Nope, try asking Jimmy Kimmel... or any Yankees fan!
  24. Wikipedia as a source? by Anonymous Coward · · Score: 0

    I took a look at the Rice demonstration page and Wikipedia is listed as one of two sources. Are they serious? Note: they also have some "expert references" !?!

  25. citizen-scientists? by sm62704 · · Score: 2, Interesting

    WTF is a "citizen-scientist"? Isn't this encyclopedia on the internet? Then what country are these citizen-scientists citizens of? Aren't all scientists citizens of some country or another?

    Do you mean amateur scientists? Some people refuse to call a spade a spade, referring to it as a "pointy shovel", but you're calling it a "bonk-digger".

    --
    mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest
    1. Re:citizen-scientists? by Schiphol · · Score: 1

      I think she means scientists acting as good citizens -embodying the moral duties of a good citizen of the world, that is, in a admittedly metaphorical, but pretty clear sense of the word. Moral duties including, it is to be supposed, contributing to the spread of knowledge and the enlightment of your fellow citizens.

    2. Re:citizen-scientists? by sm62704 · · Score: 1

      Moral duties including, it is to be supposed, contributing to the spread of knowledge and the enlightment of your fellow citizens.

      Seems to me that any scientist who wasn't like that would be a very poor scientist.

      --
      mcgrew's razor: Never attribute to stupidity that which can be explained by greedy self-interest
  26. shroomz by sgt+scrub · · Score: 1

    From the AP "The most popular of the species for Web searches is the poisonous death cap mushroom, which may say something about people's homicidal intentions, joked Ausubel."

    I think Mr. Ausubel underestimates the popularity of shroomz.

    --
    Having to work for a living is the root of all evil.
  27. EOL by Spookticus · · Score: 1

    The encyclopedia of life acronym EOL is also a term used by a retailers to refer to their products that have been sitting on the shelf to long as end of life :P. Just thought it was an odd coincidence.

  28. Still not woking.. by MXPS · · Score: 0

    503'ed

  29. Re:Elitest Wikipedia? by LingNoi · · Score: 0, Flamebait

    Yet you fail to answer my question!

    How is the value of this type of data collection by authentication any better then Wikipedia? If the guy authenticating the material is of the "flat earth theory" then it's WORSE then Wikipedia because people will just assume it's correct knowledge since it has been "authenticated".

    If you're going to response at least:
    1) Read what I said
    2) Answer my question instead of making me look like a fucking troll

  30. EOL=Control 0x0A by Sigfried · · Score: 1

    There's your problem right there. An EOL (End Of Line) control character in the middle of the data stream interrupted the listing of the species after they had only gotten through the first 30,000 animals. Good thing their website wasn't named EOT.org or they would have been logged out of the Internet completely...

  31. Need To Be Able To Sort By... by Anonymous Coward · · Score: 0

    Need to be able to sort by most recently extinct. We're heading into a phase of human existance where extinction of other species as a result of human overpopulation and its secondary effects (global warming, habitat depletion) is going to be a bigger and bigger deal. An encyclopaedia of 1.8 million species needs to include when the critter is believed to have become extinct.

  32. Criticisms of EoL by PCM2 · · Score: 1

    Roderic Page, who is involved in the Encyclopedia of Life "in an advisory capacity," has posted some fairly damning criticisms of the project in its current form. I have not spent much time poking around the site myself, but if what he says is true then it sounds like he's pretty right on. (Example: Some pages actually devote more on-screen space to contributor/sponsor logos than to content.) Here's hoping they're already taking steps to improve it.

    --
    Breakfast served all day!