Slashdot Mirror

← Back to Stories (view on slashdot.org)

Wikipedia To Host Human Gene Repository

Posted by CmdrTaco on from the hope-i-can-anonymously-edit-it dept.

schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."

13 of 73 comments (clear)

  1. I saw it on Wikipedia by omnichad · · Score: 5, Funny

    It says that gene #45A79 controls glowing in the dark! It must be true!

    1. Re:I saw it on Wikipedia by voltel · · Score: 4, Funny

      Like we're fooled Anonymous Coward! Your just trying to make yourself look good after that epic fail!

  2. Original research? by coffeepriest · · Score: 2, Interesting

    the article states that the researchers hope to speed up research by doing this, and goes on to say that they're using a computer program to copy the information into Wikipedia... If the only thing they are doing is copying data to Wikipedia, how will this speed up research? It's against Wikipedia's rules to post original research, so I'm assuming this is all they CAN do. While it is neat, I'm not sure I understand how this will speed up new research...

    1. Re:Original research? by Chyeld · · Score: 5, Interesting

      Citation needed? ^_^

      Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

    2. Re:Original research? by omnichad · · Score: 3, Funny

      Well...anyone can post a gene. That means more information, right? I've already made up 50.

    3. Re:Original research? by philspear · · Score: 5, Interesting

      I could be wrong, but doesn't wiki allow you to submit your research as long as it's been published somewhere you can reference? If you discover a gene, you're going to publish it somewhere you can put on your CV.

      Anyway, this will be pretty redundant. NCBI already has a gene database that is well crosslinked.

      http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene

      As this database is powered by published research and updated by a government sponsored organization, it also cannot easily be vandalized, unlike wiki.

      Lastly, a lot of researchers put information about their favorite gene up on wiki currently.
      Example: reelin. I couldn't help noticing the last time I looked that one of the major contributors was referencing her own (peer-reviewed published) research on reelin.

    4. Re:Original research? by philspear · · Score: 2, Informative

      P.P.S. the biggest need IMHO in the industry is a means to get a list of genes that are "similar" to the one that you are working for.

      That sounds like BLAST, which if you work in genetics you've undoubtedly heard of, so maybe I don't understand what you're talking about?

    5. Re:Original research? by Insightfill · · Score: 4, Funny

      Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

      Should we perhaps call it a gene pool?

  3. GATTA by BadAnalogyGuy · · Score: 3, Funny

    TAGGATTACACCT

    Yo Yo I gots my GAT
    rat a tat tat anotha nigga on his BAAACK

    Steve W sucks cock! lol!!!1

    16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)

  4. What could possibly go wrong? by SirGarlon · · Score: 3, Insightful

    I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical when, as TFA says,

    The stub articles are expected to seed the posting of more detailed information by Wikipedia users.

    What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable? Think for a moment about the potential consequences.

    --
    [Sir Garlon] is the marvellest knight that is now living, for he destroyeth many good knights, for he goeth invisible.
    1. Re:What could possibly go wrong? by jesdynf · · Score: 3, Funny

      Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

      --
      Yahoo! Pipes are awesome. How awesome? http://pipes.yahoo.com/jesdynf/slashdot
  5. Editing the Human Genome by D+Ninja · · Score: 5, Funny

    Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

    Title: Bill Gates Genome
    ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

    Title: Linus Torvalds Genome
    ATTATATACGYAYOPENSOURCETAGCCGCGATCG

    Title: Cowboy Neal Genome
    ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

  6. Oh, no you don't! by Illbay · · Score: 3, Funny

    I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."

    I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."

    The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!

    --
    Any technology distinguishable from magic is insufficiently advanced.